Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Affinity purification”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 991 records · Page 55Linked to original sources
PubMed1987

Preparation of phosphorylcholine derivatives of bovine serum albumin and their application to the affinity chromatography of C-reactive protein.

A simple method for the preparation of phosphorylcholine derivatives of bovine serum albumin (PC-BSA) by reductive alkylation of the amino groups of bovine serum albumin with choline phosphoryl glycoaldehyde is described. Choline phosphoryl glycoaldehyde was generated by periodate oxidation of glyceryl phosphorylcholine. PC-BSA was immobilized on SH-derivatized Toyopearl HW 65 by reacting the single SH group of PC-BSA with a bismaleimido reagent and then coupling maleimidated PC-BSA to the thiolated gel. The affinity purification of C-reactive protein (CRP), which is based on the Ca2+-dependent affinity of CRP for the phosphorylcholine residue of PC-BSA, was readily accomplished using the PC-BSA Toyopearl HW 65 column. The resulting CRP preparation from serum and pleural fluid was homogeneous as assessed by native polyacrylamide gel electrophoresis. PC-BSA derivatives were also shown to be reactive with Limulus polyphemus CRP.

C-Reactive Protein↗
PubMed2000

Purification of a viral coat protein by an engineered polyionic sequence.

Virus-like particles composed of the polyoma coat protein VP1 were produced as a central building block of an artificial vector system for gene therapy. For this purpose, recombinant VP1 was expressed in E. coli. Classical purification schemes resulted only in low yields of protein. Therefore, we developed a new affinity purification procedure. We decided to use a polyionic sequence containing eight glutamic acid residues which allows efficient purification using ion-exchange chromatography. This peptide was inserted in a solvent exposed loop on the surface of VP1. After recombinant expression and cell lysis the first purification and concentration step consisted of a fractionated ammonium sulfate precipitation. The resuspended VP1 was loaded on an anion-exchange column. Elution with ca. 600 mM NaCl yielded almost homogeneous protein. Subsequently a size exclusion chromatography was performed to separate the pentameric VP1 from higher oligomeric and aggregated material. In contrast to wildtype VP1 the highly charged mutant form showed no significant tendency to aggregate. To demonstrate the functional state of the VP1 mutant, the in vitro assembly was investigated. At conditions similar to those for wildtype VP1 assembly, the mutant protein could form homogeneous virus-like particles.

Base Sequence↗
PubMed2002

Cellulose-binding domains: biotechnological applications.

Many researchers have acknowledged the fact that there exists an immense potential for the application of the cellulose-binding domains (CBDs) in the field of biotechnology. This becomes apparent when the phrase "cellulose-binding domain" is used as the key word for a computerized patent search; more then 150 hits are retrieved. Cellulose is an ideal matrix for large-scale affinity purification procedures. This chemically inert matrix has excellent physical properties as well as low affinity for nonspecific protein binding. It is available in a diverse range of forms and sizes, is pharmaceutically safe, and relatively inexpensive. Present studies into the application of CBDs in industry have established that they can be applied in the modification of physical and chemical properties of composite materials and the development of modified materials with improved properties. In agro-biotechnology, CBDs can be used to modify polysaccharide materials both in vivo and in vitro. The CBDs exert nonhydrolytic fiber disruption on cellulose-containing materials. The potential applications of "CBD technology" range from modulating the architecture of individual cells to the modification of an entire organism. Expressing these genes under specific promoters and using appropriate trafficking signals, can be used to alter the nutritional value and texture of agricultural crops and their final products.

Journal Article↗
PubMed1992

Production of monoclonal antibodies specific to major allergens of Cryptomeria japonica pollen.

Monoclonal antibodies (MAbs) directed against Cryptomeria japonica pollen antigen (CPAg) were prepared. CPAg was precipitated with these MAbs and both MAbs CPA7 (IgG2a) and CPA9 (IgG1) recognized two major glycoproteins (m = 41 kDa and 46 kDa) of CPAg. MAb CPA7 or CPA9 was coupled to CNBr activated sepharose and affinity purification of the major allergen of CPAg from the crude extract was performed. The affinity purified CPAg bound IgE antibody present in patients with Cedar pollinosis.

Allergens↗
PubMed2000

Small molecule-based chemical affinity system for the purification of proteins.

A new chemical affinity system is described for the purification of proteins. The Linx Affinity Purification System enables researchers to quickly and easily bind a protein ligand to a chromatographic matrix and use the resulting affinity resin to purify a second protein from crude mixtures. The entire process takes approximately 2 h.

Animals↗
PubMed2004

A method for the purification of Shiga-like toxin 1 subunit B using a commercially available galabiose-agarose resin.

We describe a procedure for the affinity purification of Shiga toxin 1 subunit B (SLTB) using a commercial galabiose-agarose resin. Recombinant SLTB was purified to 99% homogeneity in a single-step protocol, from the periplasmic extracts of Vibrio cholerae 0395 N1/pSBC54. SDS-PAGE of the affinity purified SLTB showed one band of 8 kDa MW. SLTB purified by this procedure retained its chemical and biological activity as demonstrated by re-binding to the galabiose-agarose resin, and receptor-mediated binding and uptake in Vero cells. The galabiose-agarose resin could isolate roughly 1mg of SLTB/mL of gel. The resin was stable over 3 years and 500 cycles/year of usage. Hence, this method is a straightforward approach to the large-scale preparation of SLTB at a reasonable cost.

Animals↗
PubMed1991

AIC2A is a component of the purified high affinity mouse IL-3 receptor: temperature-dependent modulation of AIC2A structure.

IL-3, a potent hemopoietic growth factor, interacts with distinct classes of receptor, one of high affinity and the other of low affinity. The gene for a 115 kDa, low affinity IL-3 binding protein (AIC2A) was recently cloned. Ligand affinity purification was used to show that the AIC2A gene product participates in the formation of a high affinity IL-3 receptor (IL-3R). Cells were incubated with biotin-IL-3 at 4 degrees C and IL-3 bound to the low affinity site was removed by washing, cells were detergent extracted, and then streptavidin - agarose was used to purify proteins bound to biotin-IL-3. A 115 kDa phosphotyrosine (Ptyr)-containing protein was specifically purified and its identity as AIC2A was shown in Western assays using polyclonal anti-AIC2A antibodies. A brief temperature shift of the intact, biotin-IL-3-treated cells from 4 to 37 degrees C, prior to receptor purification, results in structural and compositional changes in the IL-3R, including: (i) a 10-20 kDa increase in the apparent Mr of both the AIC2A and the Ptyr antigens, and (ii) the association of a serine/threonine kinase. These observations indicate that in its native environment, the low affinity IL-3 binding protein, AIC2A, participates to form the high affinity IL-3R and is a substrate for a tyrosine kinase. Moreover, a ligand-induced, temperature-regulatable structural change in the IL-3R may be of importance in the transduction of information through the receptor, as suggested by the enhanced association of the IL-3R with a serine/threonine kinase.

Amino Acid Sequence↗
PubMed1998

Expression and characterisation of single-chain antibody fragments produced in transgenic plants against the organic herbicides atrazine and paraquat.

Single-chain antibody fragments (scAbs), which have a human C-kappa constant domain and a hexa-histidine tail attached to the carboxy terminus of the single-chain Fv (ScFv) fragments to facilitate purification, have been raised against the herbicides paraquat and atrazine and expressed in transgenic Nicotiana tabacum cv. Samsun NN. Prior to purification, the anti-atrazine scAb is expressed as up to 0.014% of soluble leaf protein and has a binding profile in ELISA, against an atrazine-bovine serum albumin (BSA) conjugate, similar to that of the scAb produced in Escherichia coli. Competition ELISA has shown that the plant-derived scAb also recognises free atrazine. Following antibody affinity purification to isolate dimers, the affinity for immobilised antigen approaches that of the parental monoclonal antibody. This was confirmed by surface plasmon resonance analysis. The purified scAb also recognises related triazine herbicides. When isolated from cell-suspension cultures, the anti-paraquat scAb binds to a paraquat conjugate in a concentration-dependent manner, with a profile similar to the parental monoclonal antibody. This is the first demonstration that functional scAbs against organic pollutants can be produced in transgenic plants and that the scAbs may be appropriate for the development of immunoassay-based detection systems.

Atrazine↗
PubMed2006

Comparative serological diagnosis of toxoplasmosis in horses using locally isolated Toxoplasma gondii.

A total of 420 serum samples collected from horses of different ages, sexes and breeds, located at some horse farms in Egypt, were used for serological studies. A crude antigen of the locally isolated Toxoplasma gondii tachyzoites from horse tissues (LA) was used for the detection of T. gondii antibodies in horses. It showed good diagnostic efficiency (38.1%) by Enzyme Linked Immunosorbent Assay (ELISA). To increase this efficiency, an affinity purification process was performed. Two fractions were obtained from LA by CNBr-Sepharose 4B affinity column chromatography named; unbound (LAunb) and bound (LAb). LAb showed the highest diagnostic potency (51.7%), while LAunb showed the lowest value (31.7%) using ELISA. The electrophoretic profile of LA (12 bands), LAb (6 bands) and LAunb (6 bands) showed molecular weights ranged from 25.1 to 184.3kDa. The immunoreactive bands of each of the three antigens were identified with infected horse sera by immunoblot assay. Four immunogenic bands of 155.8, 115.1, 83.2 and 66.2kDa were identified in LAb and probably were responsible for the highest diagnostic potency. Examination of horse sera by Indirect Fluorescence Antibody Test (IFAT) at a dilution of 1: 64 and Modified Agglutination Test (MAT) at a dilution of 1: 25 revealed that 170 (40.5%) and 202 (48.1%) had antibodies against T. gondii, respectively. The current research introduces crude and purified fractions (bound and unbound) obtained from the locally isolated tachyzoites (equine origin), which are utilized globally for the first time in detection of T. gondii antibodies in horses. Furthermore, this study recommended utilization of the bound fraction in diagnosis of toxoplasmosis using indirect ELISA which proved better diagnostic potency compared with IFAT and MAT.

Agglutination Tests↗
PubMed2003

Next-generation protein-handling method: puromycin analogue technology.

Puromycin is a well-known antibiotic that inhibits protein synthesis by competitive incorporation against an aminoacyl tRNA on the ribosome A site. Novel technology using this property of puromycin has been developed for convenient handling methods in protein research. Puromycin modified with another molecule is incorporated into a protein at the C-terminus, thus linking the desired molecule to the protein. Combination of in vitro translation with puromycin analogues has resulted in novel technologies such as display technology for screening, fluorescence labeling, affinity purification, and protein chip for proteomics.

Biotechnology↗
PubMed1997

Induction of the mammalian GRP78/BiP gene by Ca2+ depletion and formation of aberrant proteins: activation of the conserved stress-inducible grp core promoter element by the human nuclear factor YY1.

Previously, we have identified a constitutive nuclear factor, p70CORE, from HeLa cell nuclear extract which interacts specifically with the stress-inducible change region (SICR) of the grp78 promoter. Here we report that p70CORE is identical to YY1, a member of the GLI zinc finger family, by criteria of biochemical properties including apparent molecular weight, binding site homology, immunoreactivity, and affinity purification. Recombinant YY1 binds the double-stranded SICR with high specificity but has no affinity for its single-stranded form. In cotransfection studies, YY1 specifically enhanced the transcriptional activation of the grp78 promoter under a variety of stress conditions: depletion of the endoplasmic reticulum calcium stores, protein glycosylation block, and formation of aberrant proteins by azetidine treatment. In contrast, YY1 has minimal effect on the stress induction of the hsp70 promoter. YY1 enhancement of the grp78 stress response is dependent on its DNA-binding domain, with little effect on the basal expression of the promoter. The effect of YY1 transactivation may be mediated by the highly conserved grp78 core element. This is the first example of the ubiquitous factor YY1 involved in regulating inducible gene expression and its involvement in mediating stress signals generated from the endoplasmic reticulum to the nucleus.

Azetidines↗
PubMed1994

IgG subclasses of the multimammate rat, Mastomys coucha: isolation and characterization of IgG1 and IgG2.

The objective of the study was to characterize the IgG-system of Mastomys coucha and to provide antibodies specific for IgG subclasses of this animal species. Serum proteins binding to protein A at pH 8.0 could be eluted in two distinct peaks at pH 7.5 - 6.2 and pH 5.0 - 3.9. The fractions were analysed by SDS-PAGE and immunoelectrophoresis. Both tests suggested an IgG character of the fractions. Based on their migration behavior in the electric field they were classified as IgG1 (anodic position) and IgG2 (cathodic position). After cleavage of IgG1 and IgG2 with papain, the Fc fragments were isolated by their binding to protein A and used to raise antisera in rabbits. The specificity of these antisera to IgG1 and IgG2 was improved by mutual affinity purification. Subsequently these specific reagents were used for further characterization of IgG1 and IgG2. Thus, affinity chromatography of IgG to protein G allowed a differentiation of IgG1 into two subtypes which either bound to protein G at pH 8.0 or not. In combination with isoelectric focussing and 2-dimensional immunoelectrophoresis the results suggest the occurrence of two and three subtypes of IgG1 (IgG 1a-b) and IgG2 (IgG 2a-c) respectively. A synoptical table of available information on the immunoglobulins of M. coucha including IgM, IgA, IgE and a homocytotropic IgG3 is presented. In addition, serum levels of IgG1 and IgG2 are determined in male and female M. coucha of different ages.

Animals↗
PubMed1997

Preparation and purification of antisera against different regions or isoforms of beta-amyloid precursor protein.

We describe a procedure for the production and peptide affinity purification of polyclonal antisera against synthetic peptides representing different domains of beta-amyloid precursor protein (APP). Rabbits were immunised with keyhole limpet haemocyanin coupled to synthetic peptides representing the amino-terminal APP18-32, Kunitz-type protease inhibitor (KPI) region APP301-316, the A beta region APP670-686, and the carboxy-terminal APP756-770 of APP770 for the production of antisera anti-AP-1, anti-AP-2, anti-AP-4 and anti-AP-5, respectively. Each antiserum was purified to specific antibody using the respective cognate peptides immobilised on affinity columns as ligand, using the 1-ethyl-3-(dimethylaminopropyl)carbodiimide-diaminodipropylamine method. Purified antibodies of these four antisera were highly specific and in enzyme-linked immunosorbent assays (ELISA) reacted only to the corresponding peptide. These purified antisera have been used in Western blot, immunohistochemical and immunoprecipitation techniques to facilitate the understanding of the regulation of APP and amyloid beta-protein (A beta). The A beta is formed by proteolysis of APP, and its deposition leading to the formation of senile plaques in the brain is considered to be a key step in the pathogenesis of Alzheimer's disease.

Alzheimer Disease↗
PubMed2005

Advances and applications of de novo designed affinity ligands in proteomics.

Affinity chromatography represents a promising technique for decoding the proteomics universe. While conventional affinity purification is being used in conjunction with two-dimensional electrophoresis (2D-PAGE) and mass spectrometry (MS) for the study of proteomes and subproteomes, scientists are still confronted with the need for specific and tailor-made affinity ligands to target desired groups and families of proteins. Evidence has shown that, in many situations, synthetic affinity ligands can circumvent inconveniences associated with the utilisation of biological ligands for the chromatography-based purification of biomolecules. This review will highlight the potential applications of affinity chromatography and synthetic de novo designed ligands as separation tools for proteomics.

Bacterial Proteins↗
PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗
PubMed2003

Generation of an affinity column for antibody purification by intein-mediated protein ligation.

Coupling an antigenic peptide to a solid support is a crucial step in the affinity purification of a peptide-specific antibody. Conventional methods for generating reactive agarose, cellulose or other matrices for peptide conjugation are laborious and can result in a significant amount of chemical waste. In this report, we present a novel method for the facile production of a peptide affinity column by employing intein-mediated protein ligation (IPL) in conjunction with chitin affinity chromatography. A reactive thioester was generated at the C-terminal of the chitin binding domain (CBD) from the chitinase A1 of Bacillus circulans WL-2 by thiol-induced cleavage of the peptide bond between the CBD and a modified intein. Peptide epitopes possessing an N-terminal cysteine were ligated to the chitin bound CBD tag. We demonstrate that the resulting peptide columns permit the highly specific and efficient affinity purification of antibodies from animal sera.

Amino Acid Sequence↗
PubMed2003

Immunogenicity of venoms from four common snakes in the South of Vietnam and development of ELISA kit for venom detection.

The antigenicity and antigenic relationship between venoms of four common snakes in the South of Vietnam-Trimeresurus popeorum, Calloselasma rhodostoma, Naja naja and Ophiophagus hannah-were studied. Most of venom components expressed antigenicity and produced high titre antivenoms. The venoms share common components and antivenoms cross-reacted along them. Furthermore, cross-reactions were observed among non-common antigens, indicating that they share common epitopes. Hence, using single component as immunogen for species diagnosis of snakebites can reduce cross-reaction, perhaps may not be totally specific. A three-step affinity purification protocol was set up for preparation of species-specific antivenom antibodies. The steps involved affinity chromatography of IgG from hyper-immunized rabbit sera with protein A columns, immuno-affinity chromatography of monovalent antivenom antibodies with respective homologous venom columns, and immuno-absorption of cross-species reacting antibody molecules with heterologous venom columns. The antibodies were then used for construction of an enzyme-linked immunosorbent assay (ELISA) test kit. The kit can differentiate among the four common snake venoms in various types of samples with the detection limit of 0.2-1.6 ng/ml, depending on the type of samples and species of the snake. The efficacy of this kit for snake venom detection was successfully demonstrated in experimental envenomation in rats. Preliminary evaluation with 140 samples taken from 88 human snakebite victims in Vietnam showed that the kit could detect venom in human samples and would be a very useful tool for fast identification of snakebites in clinics.

Animals↗
PubMed2005

Rapid purification of native dynamin I and colorimetric GTPase assay.

Dynamin I is a large GTPase enzyme required in membrane constriction and fission during multiple forms of endocytosis. The first method described here is for the rapid purification of native dynamin from peripheral membrane extracts of sheep brain using ammonium sulfate precipitation and affinity purification on recombinant SH3 domains. The method greatly enriches for dynamin I at high purity and allows for large-scale biochemical and functional studies. The second method is a nonradioactive, high-throughput colorimetric GTPase assay for dynamin activity. The approach is based on terminating incubations with EDTA and the use of malachite green for high-sensitivity detection of inorganic phosphate release. The two methods will facilitate high-throughput screens for potential dynamin inhibitors or activators.

Animals↗