SEARCH · Search PubMed

Results for “Polyribonucleotides”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 973 records · Page 54Linked to original sources

PubMed1985

Proton exchange and base-pair kinetics of poly(rA).poly(rU) and poly(rI).poly(rC).

Proton exchange of poly(rA).poly(rU) and poly(rI).poly(rC) has been studied by nuclear magnetic resonance line broadening and saturation transfer from H2O. Five exchangeable peaks are observed. They are assigned to the imino, amino and 2'-OH ribose protons. The aromatic spectrum is also assigned. Contrary to previous observations, we find that the exchange of the imino proton is strongly buffer sensitive. This property is used to derive the base-pair lifetime, which is in the range of milliseconds at 27 degrees C, 100 times smaller than published values. The enthalpy for the base-opening reaction (-86 kJ/mol) and the insensitivity of the reaction to magnesium suggest that the open state involves a small number of base-pairs. The similarities in the exchange from the two duplexes indicate that the same open state is responsible for exchange of purine and pyrimidine imino protons. For the lifetime of the open state and for the base-pair dissociation constant, we obtain only lower limits. At 27 degrees C they are three microseconds and 10(-3), respectively. The analysis that yields the much larger values published previously is based on the assumption that amino protons exchange only from open base-pairs. But theory and preliminary experiments indicate that it may occur from the closed duplex. The exchange of amino protons is slower than that of the imino protons. Exchange of the 2'-OH protons from the duplexes is much slower than from single-stranded poly(rU), and it is accelerated by magnesium. This could indicate hydrogen-bonding to backbone phosphate. Discrepancies between our results and those of previous studies are discussed.

Kinetics↗

PubMed1985

Template-directed synthesis on oligodeoxycytidylate and polydeoxycytidylate templates.

Oligodeoxycytidylic acids and polydeoxycytidylic acid are effective templates for the polymerization of guanosine 5'-(phospho-2-methylimidazolide). They may be substituted for the corresponding ribo-oligomers without greatly changing the course of the reactions. Since oligomers of deoxynucleotides are much more easily synthesized than the ribo-oligomers, this finding, if it proves general, should greatly facilitate the study of the template properties of oligomers containing two or more bases. Oligodeoxycytidylates facilitate the synthesis of oligoguanylates up to one residue longer than the template in high yield, and oligoguanylates up to twice the length of the template in significant yield. The time-course and regiospecificity of these reactions suggest that "sliding" and "double-templating" are important factors in determining the pattern of reaction products.

Chromatography, High Pressure Liquid↗

PubMed1986

Non-enzymic template-directed synthesis on RNA random copolymers. Poly(C, G) templates.

Poly(C, G) random copolymer templates direct the oligomerization of 2-Me-ImpG and 2-MeImpC, resulting in the production of a variety of oligo(G, C)s. The efficiency of monomer incorporation into newly synthesized oligomers is greater for 2-MeImpG than for 2-MeImpC, and decreases for both monomers as the guanine content of the template increases. The relatively low efficiency of oligomerization on guanine-rich templates is largely a consequence of intra- and intermolecular template self-structure. The problem of template self-structure is clearly a major obstacle to the development of a system of self-replicating polynucleotides. The distribution of oligomeric products can be characterized in detail using high-pressure liquid chromatography on an RPC-5 column. Oligomers are separated on the basis of chain length, base composition and phosphodiester-linkage isomerism. Oligomers up to about the 12-mer, with base composition Gn, Gn-1C and Gn-2C2, have been identified. The 3' to 5' regiospecificity of the products is high, particularly for oligomers with base composition Gn.

Chromatography, High Pressure Liquid↗

PubMed1986

Initiation, attenuation and RNase III processing of transcripts from the Escherichia coli operon encoding ribosomal protein S15 and polynucleotide phosphorylase.

The rpsO gene of Escherichia coli, which encodes ribosomal protein S15 is located at 69 minutes on the chromosome. It is adjacent to the pnp gene, which encodes polynucleotide phosphorylase. The two genes are separated by 249 nucleotides and are transcribed in the same direction. We report here in vivo S1 nuclease mapping and in vitro transcription experiments that demonstrate that rpsO and pnp are cotranscribed from a promoter P1, located 108 nucleotides upstream from rpsO, and that another promoter P2, located between the two genes 158 nucleotides upstream from pnp, also directs the transcription of pnp. Transcription from P1 can either terminate at the terminator t1 identified in vivo and in vitro, 18 nucleotides downstream from rpsO, or transcribe through t1 and into pnp. Comparison of the transcripts synthesized in wild-type and RNase III-deficient strains of E. coli shows that all the P1 readthrough transcripts and P2 transcripts are cleaved by RNase III. Two specific cuts are made by RNase III in a double-stranded structure about 100 nucleotides upstream rpsO. We also found that some transcripts of this operon start 47 nucleotides downstream from rpsO, in the region of t1. No promoter has been identified in this region. This mRNA is attributed to an endonucleolytic cleavage of the polycistronic transcripts and the location of the cut is named M. The order of the transcription signals and of the maturation sites in relation to rpsO and pnp can be summarized as follows: P1, rpsO, t1, M, P2, RNase III-processing sites, pnp. The possible roles of mRNA processing events in the expression of rpsO-pnp operon are discussed.

Endonucleases↗

PubMed1988

Non-enzymatic template-directed synthesis on RNA random copolymers. Poly(C,A) templates.

Poly(C,A) random copolymer templates direct the oligomerization of 2-MeImpG (2-MeImpX is the 5'-phospho-2-methylimidazolide of the nucleoside X) and 2-MeImpU, resulting in the production of a variety of oligo (G,U)s. This reaction is less efficient than comparable reactions involving poly(C,U) or poly(C,G) templates. The efficiency of monomer incorporation into newly synthesized oligomers is lower for 2-MeImpU than 2-MeImpG, and cannot be improved by increasing the concentration of 2-MeImpU relative to 2-MeImpG. This suggests that RNA templates containing runs of consecutive adenine residues would not be suitable for use in a chemical self-replicating system. The distribution of oligomeric products can be characterized in detail using high-pressure liquid chromatography on an RPC-5 column. Oligomers are separated on the basis of chain length, base composition, and phosphodiester-linkage isomerism. Oligomers up to about the 13-mer, with base composition Gn, Gn-1, U, and Gn-2, U2, have been identified.

Chromatography, High Pressure Liquid↗

PubMed1990

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

Base Sequence↗

PubMed1990

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

Base Sequence↗

PubMed1991

Decay of mRNA encoding ribosomal protein S15 of Escherichia coli is initiated by an RNase E-dependent endonucleolytic cleavage that removes the 3' stabilizing stem and loop structure.

The transcripts of the rpsO-pnp operon of Escherichia coli, coding for ribosomal protein S15 and polynucleotide phosphorylase, are processed at four sites in the 249 nucleotides of the intercistronic region. The initial processing step in the decay of the pnp mRNA is made by RNase III, which cuts at two sites upstream from the pnp gene. The other two cleavages are dependent on the wild-type allele of the rne gene, which encodes the endonucleolytic enzyme RNase E. The cuts are made 37 nucleotides apart at the base of the stem-loop structure of the rho-independent attenuator located downstream from rpsO. The cleavage downstream from the attenuator generates an rpsO mRNA.nearly identical with the monocistronic attenuated transcript, while the cleavage upstream from the transcription attenuator gives rise to an rpsO mesage lacking the terminal 3' hairpin structure. The rapid degradation of the processed mRNA in an rne+ strain, compared to the slow degradation of the transcript that accumulates in an rne- strain, suggests that RNase E initiates the decay of the rpsO message by removing the stabilizing stem-loop at the 3' end of the RNA.

Base Sequence↗

PubMed1992

Association of AUUUA-binding protein with A+U-rich mRNA during nucleo-cytoplasmic transport.

Resealed nuclear envelope (NE) vesicles from rat liver containing entrapped exogenous RNA were used to study the effect of adenosine+uridine binding factor (AUBF), present in cytosolic cell extracts, on ATP-dependent transport of A+U-rich RNA (AU+RNA) and A+U-free RNA (AU-RNA) across the NE. This factor specifically binds to A+U-rich sequences present in the 3' untranslated regions of lymphokine and cytokine mRNAs, containing overlapping AUUUA boxes (granulocyte-macrophage colony stimulating factor, interleukin-3). Addition of AUBF to the extravesicular compartment markedly increased the efflux of the in vitro transcribed, capped and polyadenylated AU+ RNAs. Export of entrapped AU- control RNA, such as beta-globin RNA, was not affected by AUBF, in contrast to chimeric AU+ beta-globin RNA containing the A+U-rich sequence of human interferon-alpha mRNA (6 reiterated AUUUA motifs). Competition experiments revealed that AUBF enhances the affinity of poly(A)-containing AU+ RNAs to the NE poly(A)-binding component (poly(A)-recognizing mRNA carrier p106), and thereby accelerates nuclear export of these RNAs. We could demonstrate that AUBF added to the extravesicular space forms stable complexes with polyadenylated AU+ RNA with relative molecular masses of about 45,000, 62,000 and 70,000 inside the vesicles or during ATP-dependent export. In addition we determined that AUBF may affect mRNA stability by protecting A+U-rich RNA against degradation by trans-acting, nuclear matrix-associated and A+U-specific endoribonuclease V.

Adenosine↗

PubMed1985

Ribosomal ribonucleases in avian liver during estrogen-induced vitellogenin synthesis.

The ribonuclease activity associated with rooster liver ribosomes decreases and the endogenous ribosomal RNAase inhibitor becomes undetectable during estrogen-induced vitellogenin synthesis. The RNAase-catalyzed autodegradation of ribosomes in vitro is inhibited by Mg2+ and spermidine, while EDTA in low concentrations has an activating effect. Single-stranded, uridylic acid containing ribonucleotide polymers are the best substrates for the enzyme. Of the four homopolyribonucleotides, ribosomal RNAase catalyzes the degradation of poly(U), poly(A), and poly(C) in decreasing order of reactivity, while poly(G) is not degraded. Ribosomal RNAases from control and estrogen-stimulated roosters show differences in response to Mg2+, spermidine and EDTA. In addition, the reactivities of poly(U) and poly(C) as substrates using RNAases from stimulated roosters are markedly different from those obtained with the enzymes from control roosters.

Animals↗

PubMed1976