Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Inverted Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 973 records · Page 54Linked to original sources
PubMed2004

Estrogen receptor-related receptor gamma has an exceptionally broad specificity of DNA sequence recognition.

Estrogen receptor-related receptors (ERRs) constitute a subfamily of the nuclear hormone receptor superfamily. ERRs are closely related to estrogen receptors (ERs), but apparently lack ligand dependence. In this study, we cloned rat ERRgamma as an interacting partner of an orphan nuclear receptor, small heterodimer partner (SHP). ERRgamma exhibited significant binding affinities with a wide spectrum of sequences: inverted and direct repeat motifs composed of AGGTCA half-sites with various spacings, as well as a monovalent motif of the same sequence carrying extra T(C/G)A trinucleotides on the 5' side. On the other hand, inverted repeat spaced by three nucleotides was dominantly efficient for the binding of ERalpha. These results were mostly consistent with those of gene reporter assays. ERRgamma bound as a homodimer to all binding sequences tested, including a monovalent binding site, and ERRgamma did not heterodimerize with ERalpha. Taken together, ERRgamma recognizes a tremendously broad range of sequences as a homodimer. Finally, we found that SHP efficiently represses the transcriptional activity of ERRgamma, even at a far lower concentration than that of ERRgamma.

Animals↗
PubMed1991

Nucleotide sequences of genome segments S8, encoding a capsid protein, and S10, encoding a 36K protein, of rice gall dwarf virus.

The nucleotide sequences of DNAs complementary to the eighth (S8) and the tenth (S10) largest of the 12 genome segments of rice gall dwarf virus (RGDV) were determined. The S8 and S10 segments consist of 1578 and 1198 nucleotides, each with a single open reading frame extending for 1278 nucleotides from nucleotide 21, and 960 nucleotides from nucleotide 22, respectively. S8 encodes a polypeptide of 426 amino acids with an Mr of 47419. The amino acid sequences of several peptide fragments of the major outer capsid protein reported as 45K were contained in the predicted polypeptide. This protein, renamed the 47K protein, showed high homology with the outer capsid proteins of rice dwarf virus (RDV) and wound tumour virus (WTV); there was 56, 52 and 48% amino acid sequence identity between RGDV and WTV, RGDV and RDV, and RDV and WTV, respectively. S10 had the coding potential for a polypeptide of 320 amino acids with an Mr of 36,095 (36K protein), which exhibits 32% and 35% amino acid sequence identity with the predicted translation product of RDV S9 and the P9 capsid protein encoded by WTV S11, respectively. The conserved terminal sequences 5' GG...GAU 3' which are present in all genome segments of WTV and RDV so far analysed, and in S9 of RGDV, were also found in RGDV S8 and S10. This conserved sequence together with the segment-specific inverted repeats found in the terminal sequence of RGDV S8 and S10 are thus characteristic structures common to all three phytoreoviruses. The nucleotide sequence of the region surrounding the inverted repeats was more similar between RGDV and WTV than between RGDV and RDV.

Amino Acid Sequence↗
PubMed1988

TGGCA protein is present in erythroid nuclei and binds within the nuclease-hypersensitive sites 5' of the chicken beta H- and beta A-globin genes.

The developmentally regulated 5'-flanking DNase-I-hypersensitive site of the chicken beta H-globin gene in nuclei contains a subregion which is resistant to DNase I and which disappears when nuclei are extracted with 0.3 M NaCl, suggesting that there are salt-extractable proteins bound to sequences within this region. The 0.3 M NaCl extract contains two proteins which bind in vitro to these sequences. One of the binding sequences has an inverted repeat very similar to that bound by TGGCA protein. Partially purified TGGCA protein from chicken liver binds to this sequence in vitro giving exactly the same footprint as that obtained with erythroid nuclear proteins. Similarly TGGCA protein binds to an inverted repeat with the beta A-globin 5'-hypersensitive site giving a footprint identical to that obtained with erythroid nuclear protein extracts. From competition footprinting experiments and the electrophoretic mobility of the protein-DNA complex, it is concluded that the erythroid proteins previously described as binding to the beta H- and beta A-globin inverted repeats within the 5'-flanking hypersensitive sites both belong to the TGGCA protein family.

Animals↗
PubMed2001

Ikirara insertions reveal five new Anopheles gambiae transposable elements in islands of repetitious sequence.

Characterization of Anopheles gambiae genomic clones containing Ikirara inverted repeats revealed five novel sequences related to known transposable elements (TEs). One TE is related to the mariner/Tc1 superfamily of class II (DNA-to-DNA) transposons, while four are related to class I (RNA-mediated transposition) elements. Crusoe, the class II element; is most similar to the Caenorhabditis elegans transposon Tc1-like TEs. Vash elements, represented twice in our clones, are related to the Q/T1 family of A. gambiae non-LTR retrotransposable elements. Guildenstern is a member of the RT1 and RT2 non-LTR retrotransposon family. Although RT1 and RT2 elements normally have a highly stereotyped insertion preference for sequences within ribosomal genes, Guildenstern is not located in ribosomal sequence. JuanAg is the first anopheline member of the mosquito non-LTR retrotransposon family of Juan elements that previously had included just the culicine elements JuanA and JuanC. Approximately 753 bp is missing from the central portion of the JuanAg reverse transcriptase gene, where an Ikirara inverted repeat is found in its stead. Ozymandias, the only LTR retrotransposon found in the clones, is most similar to the Drosophila melanogaster 412 element. Single Ikirara inverted repeats were also found adjacent to nontransposable element repetitious sequences. Our analysis suggests that the A. gambiae genome organization could best be described as islands of short-period interspersion repetitious DNA in a sea of long-period interspersion, mostly unique sequence DNA.

Amino Acid Sequence↗
PubMed1995

The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX.

Analysis of the 50-kb R-plasmid pTP10 from the clinical isolate Corynebacterium xerosis M82B revealed that the erythromycin resistance gene, ermCX, is located on a 4524-bp composite transposable element, Tn5432. The ends of Tn5432 are identical, direct repeats of an insertion sequence, designated IS1249, encoding a putative transposase of the IS256 family. IS1249 consists of 1385 bp with 45/42 imperfect terminal inverted repeats. The nucleotide sequence of the 1754-bp Tn5432 central region is 99% identical to the previously sequenced erythromycin resistance region of the Corynebacterium diphtheriae plasmid pNG2. It encodes the erythromycin resistance gene, ermCX, and an ORF homologous to the amino-terminal end of the transposase of IS31831 from Corynebacterium glutamicum. Transposons with regions flanking the insertion sites were recovered from the C. glutamicum chromosome by a plasmid rescue technique. Insertion of Tn5432 created 8-bp target site duplications. A Tn5432-induced isoleucine/valine-auxotrophic mutant was found to carry the transposon in the 5' region of the ilvBNC cluster; in pTP10 the transposon is inserted in a region similar to replication and partitioning functions of the Enterococcus faecalis plasmid pAD1 and the Agrobacterium tumefaciens plasmid pTAR.

Amino Acid Sequence↗
PubMed1987

The Ds1 controlling element family in maize and Tripsacum.

Hybridization experiments indicated that the maize genome contains a family of sequences closely related to the Ds1 element originally characterized from the Adh1-Fm335 allele of maize. Examples of these Ds1-related segments were cloned and sequenced. They also had the structural properties of mobile genetic elements, i.e., similar length and internal sequence homology with Ds1, 10- or 11-bp terminal inverted repeats, and characteristic duplications of flanking genomic DNA. All sequences with 11-bp terminal inverted repeats were flanked by 8-bp duplications, but the duplication flanking one sequence with 10-bp inverted repeats was only 6 bp. Similar Ds1-related sequences were cloned from Tripsacum dactyloides. They showed no more divergence from the maize sequences than the individual maize sequences showed when compared with each other. No consensus sequence was evident for the sites at which these sequences had inserted in genomic DNA.

Base Sequence↗
PubMed1983

Sequence of the site-specific recombinase gene cin and of its substrates serving in the inversion of the C segment of bacteriophage P1.

Inversion of the 4.2-kb C segment flanked by 0.6-kb inverted repeats on the bacteriophage P1 genome is mediated by the P1-encoded site-specific cin recombinase. The cin gene lies adjacent to the C segment and the C inversion cross-over sites cixL and cixR are at the external ends of the inverted repeats. We have sequenced the DNA containing the cin gene and these cix sites. The cin structural gene consists of 561 nucleotides and terminates at the inverted repeat end where the cixL site is located. Only two nucleotides in the cixL region differ from those in the cixR and they are within the cin TAA stop codon. The cin promoter was localized by transposon mutagenesis within a 0.1-kb segment, which contains probable promoter sequences overlapping with a 'pseudo-cix' sequence cixPp. In a particular mutant, integration of an IS1-flanked transposon into the cin control region promoted weak expression of the cin gene. The cin and cix sequences show homology with corresponding, functionally related sequences for H inversion in Salmonella and with cross-over sites for G inversion in phage Mu. Based on a comparison of the DNA sequences and of the gene organizations, a possible evolutionary relationship between these three inversion systems and the possible significance of the cixPp sequence in the cin promoter are discussed.

Base Sequence↗
PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗
PubMed1996

Internal eliminated sequences interrupting the Oxytricha 81 locus: allelic divergence, conservation, conversions, and possible transposon origins.

Internal eliminated sequences (IESs) often interrupt ciliate genes in the silent germline nucleus but are exactly excised and eliminated from the developing somatic nucleus from which genes are then expressed. Some long IESs are transposons, supporting the hypothesis that short IESs are ancient transposon relics. In light of that hypothesis and to explore the evolutionary history of a collection of IESs, we have compared various alleles of a particular locus (the 81 locus) of the ciliated protozoa Oxytricha trifallax and O. fallax. Three short IESs that interrupt two genes of the locus are found in alleles from both species, and thus must be relatively ancient, consistent with the hypothesis that short IESs are transposon relics. In contrast, TBE1 transposon interruptions of the locus are allele-specific and probably the results of recent transpositions. These IESs (and the TBE1s) are precisely excised from the DNA of the developing somatic macronucleus. Each IES interrupts a highly conserved sequence. A few nucleotides at the ends of each IES are also conserved, suggesting that they interact critically with IES excision machinery. However, most IES nucleotide positions have evolved at high rates, showing little or no selective constraint for function. Nonetheless, the length of each IES has been maintained (+/- 3 bp). While one IES is approximately 33 bp long, three other IESs have very similar sizes, approximately 70 bp long. Two IESs are surrounded by direct repeats of the sequence TTCTT. No other sequence similarities were found between any of the four IESs. However, the ends of one IES do match the inverted terminal repeat consensus sequence of the "TA" IESs of Paramecium. Three O. trifallax alleles appear to have been recipients in recent conversion events that could have been provoked by double-strand breaks associated with IES ends subsequent to IES transposition. Our findings support the hypothesis that short IESs evolved from ancient transposons that have lost most of their sequences, except those necessary for precise excision during macronuclear development.

Alleles↗
PubMed1991

Origin of human chromosome 2: an ancestral telomere-telomere fusion.

We have identified two allelic genomic cosmids from human chromosome 2, c8.1 and c29B, each containing two inverted arrays of the vertebrate telomeric repeat in a head-to-head arrangement, 5'(TTAGGG)n-(CCCTAA)m3'. Sequences flanking this telomeric repeat are characteristic of present-day human pretelomeres. BAL-31 nuclease experiments with yeast artificial chromosome clones of human telomeres and fluorescence in situ hybridization reveal that sequences flanking these inverted repeats hybridize both to band 2q13 and to different, but overlapping, subsets of human chromosome ends. We conclude that the locus cloned in cosmids c8.1 and c29B is the relic of an ancient telomere-telomere fusion and marks the point at which two ancestral ape chromosomes fused to give rise to human chromosome 2.

Base Sequence↗
PubMed1996

The Magnaporthe grisea DNA fingerprinting probe MGR586 contains the 3' end of an inverted repeat transposon.

The Magnaporthe grisea repeat (MGR) sequence MGR586 has been widely used for population studies of the rice blast fungus, and has enabled classification of the fungal population into hundreds of genetic lineages. While studying the distribution of MGR586 sequences in strains of M. grisea, we discovered that the plasmid probe pCB586 contains a significant amount of single-copy DNA. To define precisely the boundary of the repetitive DNA in pCB586, this plasmid and four cosmid clones containing MGR586 were sequenced. Only 740 bp of one end of the 2.6-bp insert in the pCB586 plasmid was common to all clones. DNA sequence analysis of cosmid DNA revealed that all the cosmids contained common sequences beyond the cloning site in pCB586, indicating that the repetitive DNA in the fingerprinting clone is part of a larger element. The entire repetitive element was sequenced and found to resemble an inverted repeat transposon. This putative transposon is 1.86 kb in length and has perfect terminal repeats of 42 bp, which themselves contain direct repeats of 16 bp. The internal region of the transposon possesses one open reading frame which shows similarity at the peptide level to the Pot2 transposon from M. grisea and Fot1 from Fusarium oxysporum. Hybridization studies using the entire element as a probe revealed that some strains of M. grisea, whose DNA hybridized to the pCB586 probe, entirely lacked MGR586 transposon sequences.

Amino Acid Sequence↗
PubMed1995

The human gene encoding the largest subunit of RNA polymerase II.

The nucleotide sequence of a large portion of the human RNA polymerase II large subunit (RpII LS)-encoding gene and its whole gene structure were determined. The RpIILS gene consists of 29 exons. The sequence of the 5' flanking region is highly conserved as compared with that of the mouse RpIILS and contains several SP1-binding sites, a CCAAT sequence and a sequence homologous to a heat-shock element. In addition, several inverted repeats and palindrome sequences were involved in the 5' upstream region. Those suggest that the 5' flanking domain of RpIILS would be highly structured which may be responsible for transcriptional regulation.

Amino Acid Sequence↗
PubMed2005

Identification of a novel class of target genes and a novel type of binding sequence of heat shock transcription factor in Saccharomyces cerevisiae.

In response to hyperthermia, heat shock transcription factor (HSF) activates transcription of a set of genes encoding heat shock proteins (HSPs). The promoter regions of HSP genes contain the HSF binding sequence called the heat shock element (HSE), which consists of contiguous inverted repeats of the sequence 5'-nGAAn-3' (where n is any nucleotide). We have constructed an hsf1 mutant of Saccharomyces cerevisiae and analyzed genome-wide changes in heat shock response in the mutant cells. The results have revealed that Hsf1 is necessary for heat-induced transcription of not only HSP but also genes encoding proteins involved in diverse cellular processes such as protein degradation, detoxification, energy generation, carbohydrate metabolism, and maintenance of cell wall integrity. Approximately half of the Hsf1-regulated genes lacked the typical HSE in their promoter regions. Instead, several of these genes have a novel Hsf1 binding sequence that contains three direct repeats of nTTCn (or nGAAn) interrupted by 5 bp. The number and spacing of the repeating units are critical determinants for heat-induced transcription as well as for recognition by Hsf1. In the yeast genome, the presence of the sequence is enriched in Hsf1-regulated genes, suggesting that it is generally used as an HSE in the Hsf1 regulon.

Base Sequence↗
PubMed1986

IS222, a new insertion element associated with the genome of Pseudomonas aeruginosa.

A new insertion element, IS222, was identified to be associated with the DNA of a mutant strain of the converting Pseudomonas aeruginosa bacteriophage D3. The insertion sequence was 1,350 base pairs in size and possessed terminal inverted repeats. The nucleotide sequence contained single cleavage sites for EcoRI and PvuI but none for BamHI, PstI, HindIII, SmaI, or SalI. By Southern hybridization analysis, no homology was found with genomic DNA from P. aeruginosa PAT or Escherichia coli. Genomic DNA from the phage host, P. aeruginosa PAO, contained two sequences homologous to IS222.

DNA Restriction Enzymes↗
PubMed1991

Structural analysis of the entire proopiomelanocortin gene of Xenopus laevis.

In the pars intermedia of the pituitary the prohormone proopiomelanocortin (POMC) is tissue-specifically processed to, among other peptides, alpha-melanotropin (alpha MSH). In the South African clawed toad Xenopus laevis this hormone mediates the process of background adaptation: release of alpha-MSH causes darkening of the animal, while inhibition of alpha-MSH release results in a pale toad. Elevated release of alpha-MSH coincides with a higher rate of POMC gene transcription. The present study aims to find possible transcriptional regulatory elements in the Xenopus POMC gene. For that purpose the complete nucleotide sequence of the POMC gene and its 5'- and 3'- flanking regions were determined and analyzed. The Xenopus POMC gene promoter contains several regions which may be regulatory DNA elements in view of their similarity with corresponding regions of mammalian POMC gene promoters. In the rat POMC gene promoter, many of these regions represent protein-binding sequences. Besides the promoter sequence and the protein-coding sequences, no other segments with significant identity between the Xenopus and human POMC genes were found. Intron A of the Xenopus POMC gene contains a simple sequence, (TATC)76, and a JH12 repetitive element, while the 3'-flanking region contains a repetitive-EcoRI-monomer-2 element. Comparison of the JH12 sequence of the POMC gene with JH12 sequences from other Xenopus genes revealed a 335-bp consensus sequence which is flanked by a 30-bp inverted repeat. This JH12 consensus sequence is significantly larger than the previously reported JH12 core region. Alignment of intron B of the Xenopus POMC gene with database sequences revealed a consensus sequence of a novel Xenopus repetitive element of 330 bp flanked by a nearly perfect inverted repeat, indicating that this element may be a transposon-like element.

Animals↗
PubMed1988

Properties of a high-affinity DNA binding site for estrogen receptor.

It has been shown previously that a short sequence from the 5' regulatory region of the Xenopus laevis vitellogenin gene A2, when appropriately placed, can confer estrogen responsiveness to another gene. Using the Xenopus sequence and similar sequences from the 5' regulatory regions of other estrogen-responsive genes, we derived a consensus sequence 38 nucleotides long. The sequence contains an inverted repeat (5' C-A-G-G-T-C-A-G-A-G-T-G-A-C-C-T-G 3') and an A/T-rich region. Plasmids carrying a single copy of the sequence bound 3-fold-more partially purified estrogen receptor (ER) than did control plasmids when assayed by gel filtration. Maximum specificity for ER binding occurs at 100-150 mM ionic strength and pH 7.5-8.0. Plasmids carrying multiple copies of the sequence bound correspondingly more ER. The dissociation constant for ER bound to the sequence is 0.5 nM. This value is lower by a factor of about 400 than the dissociation constant for ER bound to an equivalent length of plasmid DNA. Portions of the consensus sequence were evaluated for binding efficiency. Plasmids containing the inverted repeat alone bound ER, though less efficiently than did plasmids containing the entire sequence. The A/T-rich region alone was ineffective in binding ER. Linearization of the plasmid DNA did not enhance specific binding efficiency for ER. This model system represents an effective tool for characterization of ER binding to DNA sequences involved in the regulation of gene expression.

Animals↗
PubMed1994

The human MCP-3 gene (SCYA7): cloning, sequence analysis, and assignment to the C-C chemokine gene cluster on chromosome 17q11.2-q12.

Monocyte chemotactic proteins (MCPs) are chemokines involved in macrophage recruitment during inflammation and cancer. A full-size MCP-3 cDNA was used to isolate the functional human MCP-3 gene. Based on restriction analysis, subclones were selected and the MCP-3 gene sequence was completed. In addition to a dense region with direct and inverted repeats and palindromic sequences, a double microsatellite (CA)n-(GA)n' was found at the 5'-end of the MCP-3 gene, and an RFLP was detected. The gene was regionally mapped by fluorescence in situ hybridization to human chromosome 17, subbands q11.2-q12. This site contains the MCP-subset of C-C chemokines and can be distinguished from the syntenic MIP-1 alpha locus. SCYA7 was assigned as the locus symbol of the MCP-3 gene. Double-labeling experiments confirmed the regional assignment of the MCP-3 gene close to the ERBB2 locus on human chromosome 17.

Amino Acid Sequence↗