Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “MUTATION”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 955 records · Page 53Linked to original sources
PubMed2006

Mutation analysis of the FRAS1 gene demonstrates new mutations in a propositus with Fraser syndrome.

Fraser syndrome (OMIM 219000) is a rare, autosomal recessive condition with classical features of cryptophthalmos, syndactyly, ambiguous genitalia, laryngeal, and genitourinary malformations, oral clefting and mental retardation. Mutations causing loss of function of the FRAS1 gene have been demonstrated in five patients with Fraser syndrome. However, no phenotype-genotype correlation was established and there was evidence for genetic heterogeneity. Fraser syndrome is rare and the FRAS1 gene has 75 exons, complicating mutation screening in affected patients. We have screened two patients who fulfilled the diagnostic criteria for Fraser syndrome and three patients with related phenotypes (two patients with Manitoba oculotrichoanal syndrome and one patient with unilateral cryptophthalmos and labial fusion) for mutations in FRAS1 to increase the molecular genetic data in patients with Fraser syndrome and related conditions. We report two new mutations in a patient with Fraser syndrome, a frameshift mutation and a deletion of two amino acids that we consider pathogenic as both alter the NG2-like domain of the protein. Although we are still unable to clarify a phenotype-genotype relationship in Fraser syndrome, our data add to the list of mutations associated with this syndrome.

Adolescent↗
PubMed1996

Mutation detection by highly sensitive methods indicates that p53 gene mutations in breast cancer can have important prognostic value.

Human cancer cells with a mutated p53 tumor-suppressor gene have a selective growth advantage and may exhibit resistance to ionizing radiation and certain chemotherapeutic agents. To examine the prognostic value of mutations in the p53 gene, a cohort of 90 Midwestern Caucasian breast cancer patients were analyzed with methodology that detects virtually 100% of all mutations. The presence of a p53 gene mutation was by far the single most predictive indicator for recurrence and death (relative risks of 4.7 and 23.2, respectively). Direct detection of p53 mutations had substantially greater prognostic value than immunohistochemical detection of p53 overexpression. Analysis of p53 gene mutations may permit identification of a subset of breast cancer patients who, despite lack of conventional indicators of poor prognosis, are at high risk of early recurrence and death.

Alternative Splicing↗
PubMed1996

Identification of 17 mutations in ten exons in the COL4A5 collagen gene, but no mutations found in four exons in COL4A6: a study of 250 patients with hematuria and suspected of having Alport syndrome.

Conditions for polymerase chain-reaction amplification of ten exon regions (Exons 3, 7, 11 through 13, and 15 through 19) of the collagen COL4A5 gene and four exon regions (Exons 2, and 12 through 14) of the COL4A6 gene were sequenced and established in this study. These Type IV collagen genes contain 51 and 48 exons, respectively. The sequences of these exons were determined in the two genes in 250 male patients with hematuria and suspected Alport syndrome. Seventeen mutations were found in nine of the ten exons studied in the COL4A5 gene in 17 patients, whereas no mutations were identified in COL4A6. One mutation was identical in two patients known to be unrelated. The results indicate that mutations in COL4A5 that leading to renal failure are more frequent than those involved in classic Alport syndrome, and also that mutations in COL4A6 are not likely to cause this disease. Furthermore, mutations in COL4A5 are distributed quite randomly and no "hot spots" were found.

Adolescent↗
PubMed1998

Ki-ras gene mutations and absence of p53 gene mutations in spontaneous and urethane-induced early lung lesions in CBA/J mice.

Ki-ras and p53 genes are involved in human lung carcinogenesis; however, the role of these genes in experimental lung tumors is not well known. In our study, the CBA/J mouse strain was used to investigate the presence of Ki-ras and p53 alterations in lung carcinogenesis of spontaneous tumors and tumors induced with high and low doses of urethane (ethyl carbamate). To study the presence of these alterations in the early stages of lung carcinogenesis and in very small lung tumors, restriction fragment length polymorphism and single-strand conformation polymorphism analyses were performed on polymerase chain reaction-amplified DNA from microdissected tumoral and normal lung samples. Ki-ras gene mutations in codons 12 and 61 were detected in all types of lung lesions, even in small and preneoplastic lesions, and their incidence increased with progression from lung hyperplasias (18%) to adenomas (75%) and to carcinomas (80%). Urethane exposure, in both high and low doses, increased the incidence of Ki-ras mutations in lung tumors, especially in adenomas. The presence of Ki-ras gene mutations in very small urethane-induced lung tumors and the absence of hyperplasias among the treated-group lesions may indicate that urethane accelerates tumoral progression. No p53 mutations were detected in exons 5-8 in any of the epithelium-derived lung tumors. Only one p53 mutation in exon 5 was found in a spontaneous lymphoma. Therefore, p53 mutations do not seem to cooperate with Ki-ras gene mutations or represent an alternative molecular pathway in murine carcinogenesis.

Adenoma↗
PubMed1984

Allele-specific suppression of dnaA(Ts) mutations by rpoB mutations in Escherichia coli.

Extragenic suppressor mutations for dnaA (Ts) mutations mapping in the rpoB gene (beta-subunit of RNA polymerase) were isolated by selection of spontaneous rifampicin resistant mutants and screening for temperature resistance. Six rpoB mutations were analysed for suppression of 12 different dnaA (Ts) mutations. The analysis showed that all dnaA(Ts) mutations could be suppressed by some rpoB mutation. All six rpoB mutations showed allele specificity when tested for suppression of 12 dnaA(Ts) mutant strains. The allele specificity was found to correlate with the map position of the dnaA (Ts) alleles.

Alleles↗
PubMed1982

The effect of liver homogenate (S20) concentration on polycyclic aromatic hydrocarbon activation and mutation induction in the L5178Y mouse lymphoma mutation assay.

Hydrocarbon activation and mutation induction in the L5178Y mouse lymphoma mutation assay were studied as a function of the concentration of an exogenously added rat liver homogenate activation system (S20). Four polycyclic aromatic hydrocarbons were tested at constant dosage levels with 4 concentrations of S20 for ability to induce forward mutations at the thymidine kinase (TK) locus. With all 4 hydrocarbons, increasing S20 concentration resulted in a significant (p less than 0.001) decrease in mutation frequency and corresponding increase in survival. In the absence of S20, no significant mutation induction was observed. Within 5 min after the addition of S20 to a reaction mixture containing [3H]benzo[a]pyrene [B(a)P] (3 micrograms/ml) and appropriate cofactors, 70% of the B(a)P was metabolized with a high S20 concentration, whereas only 14% was metabolized with a low S20 concentration. In the absence of S20, the cells did not metabolize B(a)P. Incubation of B(a)P with a low concentration of S20 in the presence of calf thymus DNA (1.5 mg/ml) resulted in twice as much covalently bound B(a)P per mg DNA (33 pmoles/mg) as incubation with a high concentration of S20 (15 pmoles/mg). The amount of the major B(a)P-DNA adduct, (+/-)-7 beta,8 alpha-dihydroxy-9 alpha, 10 alpha-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene-deoxyguanosine, per mg DNA was 5 times greater with low S20 concentration than with high (11.6 pmoles/mg and 2.1 pmoles/mg, respectively). These results suggest that the decrease in mutation frequency with high S20 concentrations results from the rapid oxidation of the hydrocarbon which reduces the opportunity for mutagenic derivatives that are formed from B(a)P to interact with DNA and induce mutation.

Animals↗
PubMed2000

Early mutation of precore (A1896) region prior to core promoter region mutation leads to decrease of HBV replication and remission of hepatic inflammation.

To evaluate the relationship between mutations and clinical courses, we investigated precore (preC) and core promoter (CP) mutations and serum HBV DNA levels in HBe-antibody-positive HBV carriers. Fifty-six asymptomatic carriers (ASC), 29 patients with chronic hepatitis who showed normal ALT levels for more than two years (CH-ASC), 31 patients with chronic hepatitis (CH), and 32 patients with hepatocellular carcinoma (HCC) were studied. Almost all patients (99.2%) had mutations in either CP or preC. Mutation only in preC (A1896) was present in 52.2% with ASC, 25.0% with CH-ASC, 16.1% with CH, and 8.0% with HCC, and was significantly higher in ASC (P < 0.01). The patients with only preC mutation showed low HBV DNA levels in each clinical stage. The mutation of preC (A1896) prior to the mutation of CP might control the replication of HBV, which leads to the remission of hepatitis.

Adult↗
PubMed2003

Analysis of GNAS1 and overlapping transcripts identifies the parental origin of mutations in patients with sporadic Albright hereditary osteodystrophy and reveals a model system in which to observe the effects of splicing mutations on translated and untranslated messenger RNA.

Albright hereditary osteodystrophy (AHO) is caused by heterozygous deactivating GNAS1 mutations. There is a parent-of-origin effect. Maternally derived mutations are usually associated with resistance to parathyroid hormone termed "pseudohypoparathyroidism type Ia." Paternally derived mutations are associated with AHO but usually normal hormone responsiveness, known as "pseudo-pseudohypoparathyroidism." These observations can be explained by tissue-specific GNAS1 imprinting. Regulation of the genomic region that encompasses GNAS1 is complex. At least three upstream exons that splice to exon 2 of GNAS1 and that are imprinted have been reported. NESP55 is exclusively maternally expressed, whereas exon 1A and XL alphas are exclusively paternally expressed. We set out to identify the parental origin of GNAS1 mutations in patients with AHO by searching for their mutation in the overlapping transcripts. This information would be of value in patients with sporadic disease, for predicting their endocrine phenotype and planning follow-up. In doing so, we identified mutations that resulted in nonsense-mediated decay of the mutant Gs alpha transcript but that were detectable in NESP55 messenger RNA (mRNA), probably because they lie within its 3' untranslated region. Analysis of the NESP55 transcripts revealed the creation of a novel splice site in one patient and an unusual intronic mutation that caused retention of the intron in a further patient, neither of which could be detected by analysis of the Gs alpha complementary DNA. This cluster of overlapping transcripts represents a useful model system in which to analyze the effects that mutant sequence has on mRNA-in particular, splicing-and the mechanisms of nonsense-mediated mRNA decay.

Alternative Splicing↗
PubMed1988

New suppressor mutation sur0B of spo0B and spo0F mutations in Bacillus subtilis.

Two extragenic suppressor mutations, sur0B20 and sur0F1, which restore the sporulation of spo0B or spo0F mutants of Bacillus subtilis to the wild-type level, were obtained. These suppressor mutations were located in the spo0A gene. Their location is close to that of the sof-1 mutation, which suppresses spo0B, spo0E and spo0F mutations. However, spo0 strains bearing the sur0B20 mutation differed in several phenotypic characteristics from spo0 mutants bearing the sof-1 suppressor. Nucleotide sequence analysis revealed that the sur0B20 and sur0F1 mutations resulted in Glu14 to Val and Asn12 to Lys conversion, respectively, in the spo0A gene. This result indicates that sur0B20 is a new suppressor of spo0b and spo0F mutations, whereas sur0F1 is identical to sof-1.

Alleles↗
PubMed2000

Analysis of the amplification refractory mutation allele-specific polymerase chain reaction system for sensitive and specific detection of p53 mutations in DNA.

The sensitivity of the amplification refractory mutation allele-specific polymerase chain reaction system (ARMAS-PCR) to detect known p53 mutations was determined using DNA extracted from two human tumour cell lines collected by cytobrush, as a model for its use in exfoliative cytology. Using DNA extracted from SW480 and CEM cell lines diluted with normal human fibroblasts, a nested ARMAS-PCR was more sensitive than a non-nested version and could detect one mutated cell amongst 100 000 normal cells. When compared with PCR-single stranded conformational polymorphism, nested ARMAS-PCR was 10 000 times more sensitive for detecting mutant p53 in extracted DNA. Primer design proved to be influential on the sensitivity and specificity of the assay; increased specificity was achieved by the use of deliberate mismatches upstream from the 3' end of mutation-specific primers. ARMAS-PCR was confirmed to be specific for the mutation that each primer was designed to detect. Nested ARMAS-PCR offered a rapid and sensitive method of analysis of cells with predetermined p53 mutations and has the potential to be applied to the study of the molecular progression of cancer, including diagnosis and detection of residual disease. It could also be extended to the in situ detection of aberrant cells.

DNA Mutational Analysis↗
PubMed1999

Characterization of eleven novel mutations (M45L, R119H, 544delG, G145V, H154Y, C184Y, D289V, 862+5A, 1172delC, R411X, E459K) in the tissue-nonspecific alkaline phosphatase (TNSALP) gene in patients with severe hypophosphatasia. Mutations in brief no. 217. Online.

Hypophosphatasia is a rare inherited disorder characterized by defective bone mineralization and deficiency of serum and tissue liver/ bone/kidney tissue alkaline phosphatase (L/B/K ALP) activity. We report the characterization of tissue-nonspecific alkaline phosphatase (TNSALP) gene mutations in a series of 9 families affected by severe hypophosphatasia. Fourteen distinct mutations were found, 3 of which were previously reported in the North American or Japanese populations. Seven of the 11 new mutations were missense mutations (M45L, R119H, G145V, C184Y and H154Y, D289V, E459K), the four others were 2 single nucleotide deletions (544delG and 1172delC), a mutation affecting donor splice site (862 + 5A) and a nonsense mutation (R411X).

Alkaline Phosphatase↗
PubMed2004

Five haplotypes account for fifty-five percent of ATM mutations in Brazilian patients with ataxia telangiectasia: seven new mutations.

We have studied the molecular genetics of 27 Brazilian families with ataxia telangiectasia (AT). Five founder effect haplotypes accounted for 55.5% of the families. AT is an autosomal recessive disorder of childhood onset characterized by progressive cerebellar ataxia, ocular apraxia, telangiectasia, immunodeficiency, radiation sensitivity, chromosomal instability, and predisposition to cancer. The ATM gene spans more than 150 kb on chromosome region 11q23.1 and encodes a product of 3056 amino acids. The ATM protein is a member of the phosphatidylinositol 3-kinase (PI-3K) family of proteins and is involved in cell cycle control and DNA repair pathways. DNA was isolated from lymphoblastoid cell lines and haplotyped using four STR markers (D11S1818, NS22, D11S2179, D11S1819) within and flanking the ATM gene; all allele sizes were standardized in advance. In addition to the STR haplotypes, SNP haplotypes were determined using 10 critical polymorphisms. The entire gene was screened sequentially by protein truncation testing (PTT), single strand conformation polymorphism (SSCP), and then denaturing high performance liquid chromatography (dHPLC) to identify the disease-causing mutations. Of the expected 54 mutations, 50 were identified. All mutations but one, led to a truncated or null form of the ATM protein (nonsense, splice site, or frameshift). Five families (18.5%) carried a deletion of 3450nt (from IVS28 to Ex31), making this one of the two most common Brazilian mutations. Mutations were located throughout the entire gene, with no clustering or hotspots. Standardized STR haplotype analysis greatly enhanced the efficiency of mutation screening.

Ataxia Telangiectasia↗
PubMed2002

Heavy-ion-induced mutations in the gpt delta transgenic mouse: comparison of mutation spectra induced by heavy-ion, X-ray, and gamma-ray radiation.

Heavy-ion radiation accounts for the major component of absorbed cosmic radiation and is thus regarded as a significant risk during long-term manned space missions. To evaluate the genetic damage induced by heavy particle radiation, gpt delta transgenic mice were exposed to carbon particle irradiation and the induced mutations were compared with those induced by reference radiations, i.e., X-rays and gamma-rays. In the transgenic mouse model, deletions and point mutations were individually identified as Spi(-) and gpt mutations, respectively. Two days after 10 Gy of whole-body irradiation, the mutant frequencies (MFs) of Spi(-) and gpt were determined. Carbon particle irradiation significantly increased Spi(-) MF in the liver, spleen, and kidney but not in the testis, suggesting an organ-specific induction of mutations by heavy-ion irradiation. In the liver, the potency of inducing Spi(-) mutation was highest for carbon particles (3.3-fold increase) followed by X-rays (2.1-fold increase) and gamma-rays (1.3-fold increase), while the potency of inducing gpt mutations was highest for gamma-rays (3.3-fold increase) followed by X-rays (2.1-fold increase) and carbon particles (1.6-fold increase). DNA sequence analysis revealed that carbon particles induced deletions that were mainly more than 1,000 base pairs in size, whereas gamma-rays induced deletions of less than 100 base pairs and base substitutions. X-rays induced various-sized deletions and base substitutions. These results suggest that heavy-ion beam irradiation is effective at inducing deletions via DNA double-strand breaks but less effective than X-ray and gamma-ray irradiation at producing oxidative DNA damage by free radicals.

Aerospace Medicine↗
PubMed1995

TP53 mutations and breast cancer prognosis: particularly poor survival rates for cases with mutations in the zinc-binding domains.

Acquired mutations in TP53 as well as immunohistochemically detectable protein expression have been implicated as prognostic factors for breast cancer. We have evaluated the relationship between mutations detected in 119 breast tumours and various clinicohistopathological indices, stratifying the mutations according to the functional domains as defined by the recent elucidation of the crystal structure of the protein. Patients with missense mutations located in regions encoding parts of the protein involved in zinc-binding had significantly decreased disease-free and overall survival relative to patients whose tumours had mutations in other domains. These results indicate that these biochemically defined domains also have biological relevance in terms of breast cancer disease course, and suggest that some mutations in TP53, more than others, can contribute to the development of clinically more aggressive and perhaps treatment resistant breast tumours. When confirmed, this will be of potential importance in predicting the clinical behaviour of breast cancer and its responsiveness to therapy.

Adult↗
PubMed2002

Splicing mutations, mainly IVS6-1(G>T), account for 70% of fumarylacetoacetate hydrolase (FAH) gene alterations, including 7 novel mutations, in a survey of 29 tyrosinemia type I patients.

Hereditary tyrosinemia type I (HTI) is an autosomal recessive disease characterized by a deficiency in fumarylacetoacetate hydrolase (FAH) activity. In this work, the FAH genotype was established in a group of 29 HTI patients, most of them from the Mediterranean area. We identified seven novel mutations-IVS8-1(G>A, IVS10-2(A>T), 938delC, E6/I6del26, W78X, Q328X, and G343W-and two previously described mutations-IVS6-1(G>T) and IVS12+5(G>A). Fully 92.8% of the patients were carriers of at least one splice site mutation, with IVS6-1(G>T) accounting for 58.9% of the total number of alleles. The splice mutation group of patients showed heterogeneous phenotypic patterns ranging from acute forms with severe liver malfunction to chronic forms with renal manifestations and slow progressive hepatic alterations. Qualitative FAH cDNA expression was the same in all IVS6-1(G>T) homozygous patients regardless of their clinical picture. One patient with a heterozygous combination of a nonsense (Q328X) and a frameshift (938delC) mutation showed an atypical clinical picture of hypotonia and repeated infections. Despite the high prevalence of IVS12+5(G>A) in the northwestern European population, we found only two patients with this mutation in our group.

Alternative Splicing↗
PubMed2001

Eleven novel JAK3 mutations in patients with severe combined immunodeficiency-including the first patients with mutations in the kinase domain.

Defects of the JAK3-gene are known to cause an autosomal recessive form of severe combined immunodeficiency with almost absent T-cells and functionally defective B-cells (T-B+SCID). The JAK3 protein, an intracellular tyrosine kinase, is crucial for signal-transmission from the common gamma chain to the Signal Transducers and Activators of Transcription (STATs) that drive gene expression in the nucleus. We present nine novel patients with eleven distinct mutations (g.96A>G, g.268G>C, IVS12-1G>A, g.2046C>T, g.2160C>T, g.2175G>A, g.2187G>T, g.2391C>T, g.2406C>T, IVS18+3G>C) among them a mutation in the kinase domain (JH1: g.3167del). The clinical phenotype of the patients shows an unusually broad spectrum ranging from classical SCID to almost normal. In order to understand the complex genotype-phenotype correlation we studied expression and function (by IL-2 induced phosphorylation) of the newly identified and two other alleles with JH1 mutations we recently reported. We found the first mutation in the JH1-domain of JAK3, that precludes kinase activity (L910S). The two other JH1 mutations both caused a premature stop. One of them (C1024fsX1037) also abolished any phosphorylation of JAK3 and expression of the protein. The other mutation (Y1023X), affecting the last JH1 tyrosine, may allow for residual protein expression and phosphorylation. This may indicate that the part of the kinase region downstream Y1023, is not essential for the function of JAK3.

Alleles↗
PubMed2003

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Adolescent↗
PubMed2005

Nine mutations including three novel mutations among Russian patients with acute intermittent porphyria.

Acute intermittent porphyria (AIP) is a metabolic disease due to a partial deficiency of hydroxymethylbilane synthase (HMBS) in heme biosynthesis. Direct sequencing of genomic DNA samples of 11 unrelated Russian AIP patients, 32 of their relatives and 50 healthy controls from northwestern Russia including Saint Petersburg revealed nine mutations in the HMBS gene. Three novel mutations, c.825+5G>C, c.825+3_825+6del, and c.770T>C, resulted in varying amounts of abnormal transcripts, r.822_825del and [r.770U>C, r.652_771del, r.613_771del]. Six mutations, c.77G>A (p.R26H), c.517C>T (p.R173W), c.583C>T (p.R195C), c.673C>T (p.R225X), c.739T>C (p.C247R), and c.748G>C (p.E250A), have previously been identified in AIP patients from Western and other Eastern European populations. All mutations expressed in COS-1 cells demonstrated low residual activities (0.1-1%). The majority of the mutations were family-specific and also confirmed allelic heterogeneity among Russian AIP patients. The diversity of mutations may reflect the old international history of Saint Petersburg and immigration of people from other parts of Europe.

Animals↗