Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “EXPECTORANTS”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 955 records · Page 53Linked to original sources
PubMed2001

Topical azathioprine in the treatment of immune-mediated chronic oral inflammatory conditions: a series of cases.

OBJECTIVES: After hematopoietic cell transplantation, a variety of complications can occur, including chronic graft-versus-host disease (GVHD), with 25% to 70% of these involving the oral cavity. Those lesions, as well as oral involvement of autoimmune mucocutaneous diseases, might present as painful, erythematous, and ulcerative oral lesions. Management includes topical and systemic immunosuppressive agents, including systemic azathioprine (AZA). The purpose of this study was to evaluate the efficacy of topical AZA in chronic oral GVHD and in oral autoimmune diseases in a series of patients. METHODS: Four men and 2 women with GVHD and 2 men with autoimmune vesiculo-ulcerative oral lesions were treated with topical AZA. A rinse of 5 mL of 5 mg/mL AZA in methylcellulose were rinsed 3 to 4 times daily for over 1 minute and expectorated, or a gel in the same concentration in 3% methylcellulose was topically applied. The outcome was evaluated separately for total ulcer size, assessment of the erythema, and severity of pain by using a visual analogue scale. Global estimated improvements represented a proportional combined improvement of ulcers, erythema, and pain. RESULTS AND CONCLUSIONS: The mean estimated global improvement for 6 patients with GVHD who used AZA rinse was 60% in a mean of 16.67 weeks. Ulcers improved by 58%, erythema by 55%, and pain was reduced by 63%. Two patients with oral lesions of vesiculo-ulcerative diseases (1 AZA rinse and 1 topical gel) improved by 95% and 96%, respectively, in 3 months. One patient with GVHD applied topical AZA gel in addition to mouthrinses, and a 29% estimated global improvement was achieved in addition to 50% of improvement achieved with AZA mouthrinses. The observed effect of topical AZA suggests that it can be used for management of oral immune-mediated inflammatory conditions, and for patients who are provided with systemic immunosuppressives it can allow control of oral findings with lower systemic dosing. The therapeutic potential of topical AZA as mouthrinse versus topical applications and the most effective concentration should be further investigated.

Adult↗
PubMed2002

Induced sputum inflammatory measures correlate with lung function in children with cystic fibrosis.

OBJECTIVE: To validate a sputum induction technique in cystic fibrosis (CF), we examined the relation between airway inflammation and pulmonary function in children with CF by correlating inflammatory indexes in induced sputum with FEV(1). STUDY DESIGN: We measured baseline spirometry and oxygen saturations and then performed sputum inductions with 3% hypertonic saline in 20 clinically stable children with CF (11 girls). We examined the relation of airway inflammation and lung function in the 19 individuals (95%) who expectorated an adequate sputum sample. Measures of airway inflammation in induced sputum included total cell counts, neutrophil (PMN) counts, interleukin-8 levels, and free neutrophil elastase activity. RESULTS: There were significant inverse relations between FEV(1) and total cell counts and PMN counts (r = -0.57, P <.01 for both), interleukin-8 (r = -0.72, P =.002), and elastase (r = -0.75, P =.001). Airway infection, as assessed by bacterial density in induced sputum, did not correlate with lung function or indexes of inflammation. CONCLUSIONS: We conclude that measures of inflammation in induced sputum correlate with FEV(1) in clinically stable children with CF with normal to mildly abnormal lung function and that they may be useful as surrogate outcome measures in clinical trials.

Adolescent↗
PubMed2004

Characteristics, clinical effect profile and tolerability of a nasal spray preparation of Artemisia abrotanum L. for allergic rhinitis.

A nasal spray formulation containing an extract of Artemisia abrotanum L. was developed for therapeutic use in patients with allergic rhinitis and other upper airway disorders. The nasal spray preparation used contains a mixture of essential oils (4 mg/ml) and flavonols (2.5 microg/ml), of which some components have been shown to possess antiinflammatory, expectorant, spasmolytic as well as antiseptic and antimicrobial activities. The most important constituents in the essential oil fraction of the preparation are 1,8-cineole, linalool and davanone, while the flavonol fraction contains centauredin, casticin and quercetin dimethyl-ethers. No trace of thujon was observed in the essential oil of the Artemisia abrotanum L. genotype "Tycho" used for the manufacture of the nasal spray preparation. In 12 patients with diagnoses of allergic rhinitis, allergic conjunctivitis and/or bronchial obstructive disease, the nasal spray was given immediately after the appearance of characteristic allergic nasal symptoms. In 10 of the 12 patients, allergic rhinitis with nasal congestion, sneezing and rhinorrhea was dominant. After administration of the nasal spray, all patients experienced a rapid and significant symptom relief of nasal symptoms, comparable to the effect of antihistamine and chromoglicate preparations which several of the patients had used previously. The effect was present within 5 minutes after the administration and lasted for several hours. In 7 of the 10 rhinitis patients with concomitant symptoms of allergic conjunctivitis, a significant subjective relief of eye symptoms was also experienced. In 3 of the 6 patients who had a history of characteristic symptoms of endogenous, exogenous or exercise induced bronchial obstructive disease, there was a bronchial symptom relief by the nasal spray preparation which was experienced as rapid and clinically significant. It is concluded from the present proof of concept study, that a nasal spray formulation containing an extract characterised by a mixture of essential oils and flavonols from the Artemisia abrotanum L. genotype "Tycho", appears to be clinically useful and suitable for the prophylactic and therapeutic management of patients with allergic rhinitis and adjuvant symptoms.

Administration, Inhalation↗
PubMed2001

Second meal effect: modified sham feeding does not provoke the release of stored triacylglycerol from a previous high-fat meal.

The present study was carried out to determine whether cephalic stimulation, associated with eating a meal, was sufficient stimulus to provoke the release of stored triacylglycerol (TAG) from a previous high-fat meal. Ten subjects were studied on three separate occasions. Following a 12 h overnight fast, subjects were given a standard mixed test meal which contained 56 g fat. Blood samples were taken before the meal and for 5 h after the meal when the subjects were randomly allocated to receive either water (control) or were modified sham fed a low-fat (6 g fat) or moderate-fat (38 g fat) meal. Blood samples were collected for a further 3 h. Compared with the control, modified sham feeding a low- or moderate-fat meal did not provoke an early entry of TAG, analysed in either plasma or TAG-rich lipoprotein (TRL) fraction (density <1.006 kg/l). The TRL-retinyl ester data showed similar findings. A cephalic phase secretion of pancreatic polypeptide, without a significant increase in cholecystokinin levels, was observed on modified sham feeding. Although these data indicate that modified sham feeding was carried out successfully, analysis of the fat content of the expectorant showed that our subjects may have accidentally ingested a small amount of fat (0.7 g for the low-fat meal and 2.4 g for the moderate-fat meal). Nevertheless, an early TAG peak following modified sham feeding was not demonstrated in the present study, suggesting that significant ingestion of food, and not just oro-sensory stimulation, is necessary to provoke the release of any TAG stored from a previous meal.

Adult↗
PubMed1994

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

AIDS-Related Opportunistic Infections↗
PubMed2004

Comparative study of community-acquired pneumonia caused by Streptococcus pneumoniae, Legionella pneumophila or Chlamydia pneumoniae.

The objective of this study was to compare epidemiological data and clinical presentation of community-acquired pneumonia (CAP) caused by Streptococcus pneumoniae, Legionella pneumophila or Chlamydia pneumoniae. From May 1994 to February 1996, 157 patients with S. pneumoniae (n = 68), L. pneumophila (n = 48) and C. pneumoniae (n = 41) pneumonia with definitive diagnosis, were prospectively studied. The following comparisons showed differences at a level of at least p < 0.05. Patients with S. pneumoniae pneumonia had more frequently underlying diseases (HIV infection and neoplasm) and those with C. pneumoniae pneumonia were older and had a higher frequency of chronic obstructive pulmonary disease (COPD), while L. pneumophila pneumonia prevailed in patients without comorbidity, but with alcohol intake. Presentation with cough and expectoration were significantly more frequent in patients with S. pneumoniae or C. pneumoniae pneumonia, while headache, diarrhoea and no response to betalactam antibiotics prevailed in L. pneumophila pneumonia. However, duration of symptoms > or = 7 d was more frequent in C. pneumoniae pneumonia. Patients with CAP caused by L. pneumophila presented hyponatraemia and an increase in CK more frequently, while AST elevation prevailed in L. pneumophila and C. pneumoniae pneumonia. In conclusion, some risk factors and clinical characteristics of patients with CAP may help to broaden empirical therapy against atypical pathogens until rapid diagnostic tests are available.

Adolescent↗
PubMed1998

Pharmacokinetics of 14C-delmopinol in the healthy male volunteer.

1. The absorption and excretion of delmopinol, an inhibitor of plaque formation and gingivitis, were studied in healthy male volunteers. Each subject received a single dose of a 10-ml aqueous solution of 14C-delmopinol at 2 mg/ml as a 1-min mouth rinse (the intended route of administration; n=6) or as an oral dose (n=6). 2. After mouth rinsing, 72% of the dose was expectorated. The retained portion of the dose was rapidly absorbed and eliminated. Of the dose, 25% was recovered in the urine. Renal excretion was predominant also after oral administration with 92% of the dose excreted in the urine. The total recovery of 14C-activity after 6 days was 99% (rinsing) and 95% (oral) with the bulk, 20% (rinsing) and 80% (oral), of the dose excreted already within 8 h. 3. Peak plasma levels of 14C-labelled compounds were attained at 1.5 h after rinsing and 0.5 h after oral administration; total concentrations were approximately 200 and 3000nmol/l, respectively. For parent delmopinol, peak plasma levels of 49 nmol/l (rinsing) and 8 nmol/l (oral) occurred after 1.5 and 1.3 h, respectively. After rinsing, the concentration of delmopinol declined with a half-life of 2.4 h. The plasma level of 14C-labelled compounds declined multiphasically. In the terminal elimination phase (after 72 h) remaining radioactivity, < 2% of dose (rinse) and < 5% of dose (oral), decreased with a half-life of approximately 130 and 160 h, respectively. 4. Results indicate a very low bioavailability (1-3%) due to extensive first-pass metabolism of delmopinol after oral administration. A high plasma clearance (> 60 l/h) and a large volume of distribution (> 200 l) were also indicated. 5. The results of rapid and almost complete recovery in the urine support that delmopinol can safely be used in the treatment of patients with plaque or gingivitis.

Administration, Oral↗
PubMed1990

Treatment of paracoccidioidomycosis with itraconazole.

Forty-seven patients with active paracoccidioidomycosis were treated with itraconazole. The majority of the patients (45) had the chronic adult form of the disease while the remaining exhibited the juvenile form. All of the patients received itraconazole, 100 mg day-1, with the exception of two for whom the clinical condition necessitated a larger dose. The mean duration of therapy was 6 months, with a range of 3-24 months. Clinically, the skin and mucous membrane lesions as well as abdominal pain, auscultatory alterations and dysphonia improved markedly during treatment with a concomitant increase in weight. However, other symptoms (cough, expectoration and dyspnoea) persisted as sequelae in some cases. As expected adrenal insufficiency also persisted. The radiological lesions showed a gradual decrease of both scattered and confluent infiltrates, present in 67% of patients before, and in 13% at the end of treatment. On the other hand, fibrosis became more evident at the termination of therapy, increasing from 62% of patients at the beginning of therapy to 81% at the end. The mycological tests (direct examination and cultures) became negative during the first month of treatment in 42 patients (87%). A decline in specific antibody titres was observed in 72% of patients by the end of treatment. Evaluation of therapy by means of a scoring system indicated complete resolution of the disease in one patient (2%), marked improvement in 42 (89%) and minor improvement in four (8.5%); none of the patients showed a deterioration of their disease during therapy. Of fifteen patients who were followed up for 12 months post-therapy none showed clinical relapse during this period. The results of this study confirm the efficacy of itraconazole in the treatment of paracoccidioidomycosis.

Acute Disease↗
PubMed1987

Management of Empyema thoracis in children--a study of 65 cases.

Sixty-five cases of pleural empyema (50 boys and 15 girls) were seen between January 1983 and June 1986. Fifty-three of these 65 children were below 10 years of age. Pulmonary infection was the commonest underlying cause. Cough with or without expectoration (98%) and fever (95%) were the commonest symptoms followed by breathlessness (85%) and chest pain (83%). Staphylococcus aureus was isolated from pus and blood in 61% and 18% of cases, respectively, while pseudomonas was grown in 8% and 3%. Most of the children (88%) were treated with antibiotics and tube thoracostomy drainage. Decortication was needed in 12% of cases. There were four deaths in this study. The overall success rate was 94%.

Anti-Bacterial Agents↗
PubMed1988

Endotracheal aspiration for the bacteriological diagnosis of nosocomial- and measles-associated pneumonia.

Endotracheal aspirates were obtained from 51 young children for the microbiological diagnosis of pneumonia acquired in hospital or associated with measles or severe protein-energy malnutrition. The procedure proved safe and the information obtained assisted in the management of most cases. There was a fairly good correlation between the findings of Gram stain and those of culture of the aspirates, which improved when only Gram stains showing many or moderate numbers of bacteria were used. The bacteria most frequently isolated were Gram-negative enteric bacilli, Staphylococcus aureus, Streptococcus viridans, Streptococcus pneumoniae and Haemophilus influenzae, many strains of which were resistant to conventional antibiotics. The role of endotracheal aspiration in the microbiological diagnosis of pneumonia in the above-mentioned types of patients is compared with that of percutaneous lung puncture, percutaneous transtracheal aspiration and expectorated sputum.

Child↗
PubMed2000

Asthma in adult patients presenting with symptoms of acute bronchitis in general practice.

OBJECTIVES: To investigate the association between asthma and acute bronchitis in adults and to ascertain criteria to help general practitioners (GPs) differentiate between acute bronchitis and asthma. DESIGN: Descriptive study. SETTING: Primary health care centre in The Netherlands. PATIENTS: 192 patients, aged 18-75 years, not known to have asthma or other pulmonary diseases, attending their GP with cough persisting for at least 2 weeks. METHODS: Patients were considered to have asthma or chronic obstructive pulmonary disease on the basis of a questionnaire on respiratory symptoms, spirometry and methacholine challenge testing. They were classified as having acute bronchitis if, according to international guidelines, coughing was more frequent than normal for at least 2 weeks, but no more than 4 weeks. Furthermore, either expectoration of purulent sputum for a maximum of 2 weeks and/or rhonchi as assessed by auscultation had to be present. By means of logistic regression symptoms, signs and peak expiratory flow measurements were sought to predict which patients with acute bronchitis actually had asthma. RESULTS: Of the 80 (41.7%) subjects with symptoms of acute bronchitis, 29 (36.9%) were patients with asthma. Within the acute bronchitis group, female sex and symptoms of current reported wheeze, reported episodes of attacks of dyspnoea over the last year and symptoms elicited by allergens were of help in identifying patients who actually had asthma. CONCLUSIONS: A considerable proportion of the patients presenting with acute bronchitis are actually patients with asthma. The absence or presence of a few symptoms and female sex may help to differentiate between these disorders.

Adult↗
PubMed1999

Chronic bronchitis in Icelandic males: prevalence, sleep disturbances and quality of life.

OBJECTIVE: To study the prevalence of chronic bronchitis in Iceland and some aspects of quality of life among those suffering from chronic bronchitis. DESIGN: Postal questionnaires. SETTING, SUBJECTS: All Icelandic males born in the years 1913 and 1943 who were alive on 1 November 1993. Altogether 1175 (69.7%) responded. MAIN OUTCOME MEASURES: Physical symptoms of chronic bronchitis, stress symptoms, symptoms of dyspnea and sleep disturbances. RESULTS: 7.1% of those 50 years old and 16.7% of those 80 years old and a history of daily sputum expectoration for at least 3 months during the preceding 2 years. These individuals with chronic bronchitis had a higher prevalence of other respiratory symptoms than did the others, such as "wheezing or whistling" (59.6% vs. 7.2%), and "awakened by breathlessness" (35.2% vs. 6.0%). Complaints of dyspnea were more common among those with symptoms of chronic bronchitis, e.g. "dyspnea when walking" (19.4% vs. 1.4%) and "stops walking because of dyspnea" (22% vs. 1.6%). They also complained more often of insomnia and daytime sleepiness and found themselves more stressed than those without chronic bronchitis. These symptoms were all more common among the 80-year-old men. CONCLUSION: Our study indicates that chronic bronchitis is a frequent illness among Icelandic males. Men with chronic bronchitis often have decreased quality of life, difficulties in moving and frequently sleep complaints.

Aged↗
PubMed2006

Malignant esophageal-tracheobronchial strictures: parallel placement of covered retrievable expandable nitinol stents.

PURPOSE: To assess the safety and clinical effectiveness of the parallel placement of covered retrievable expandable metallic stents in the palliative treatment of malignant esophageal and tracheobronchial strictures. MATERIAL AND METHODS: Under fluoroscopic guidance, parallel stents were placed in 12 symptomatic patients with both malignant esophageal and tracheobronchial strictures. Seven of these 12 patients also had an esophagorespiratory fistula (ERF) and one patient had an esophagocutaneous fistula. Technical success, clinical improvement, complications, and survival rates were evaluated. RESULTS: A total of 28 esophageal and airway stents were successfully placed. The grade of dysphagia and dyspnea score significantly decreased after stent placement (P=0.002 and 0.003, respectively). ERF and esophagocutaneous fistula were sealed off in all eight patients after esophageal stent placement; however, the esophagocutaneous fistula reopened 1 month later. Complications included stent migration or expectoration (n=3), tracheal compression by the esophageal stent (n=3), new fistula development due to covering membrane degradation of the esophageal stent (n=1), and symptomatic sputum retention (n=1). Stent removal was easily performed for two stents; one migrated stent and the other with covering membrane degradation. All 12 patients died within the mean survival period of 72.50 days (range 7-375 days). CONCLUSION: Parallel placement of covered retrievable expandable metallic stents is safe and effective for the palliative treatment of malignant esophageal and tracheobronchial strictures.

Adult↗
PubMed2005

Ethylene glycol exposure: an evidence-based consensus guideline for out-of-hospital management.

In 2002, poison centers in the US reported 5816 human exposures to ethylene glycol. A guideline that effectively determines the threshold dose for emergency department referral and need for pre-hospital decontamination could potentially avoid unnecessary emergency department visits, reduce health care costs, optimize patient outcome, and reduce life disruption for patients and caregivers. An evidence-based expert consensus process was used to create this guideline. Relevant articles were abstracted by a trained physician researcher. The first draft of the guideline was created by the primary author. The entire panel discussed and refined the guideline before distribution to secondary reviewers for comment. The panel then made changes based on the secondary review comments. The objective of this guideline is to assist poison center personnel in the out-of-hospital triage and initial management of patients with a suspected exposure to ethylene glycol by (1) describing the process by which the exposure might be evaluated, (2) identifying the key decision elements in managing the case, (3) providing clear and practical recommendations that reflect the current state of knowledge, and (4) identifying needs for research. This guideline is based on an assessment of current scientific and clinical information. The panel recognizes that specific patient care decisions may be at variance with this guideline and are the prerogative of the patient and health professionals providing care, considering all of the circumstances involved. Recommendations are in chronological order of likely clinical use. The grade of recommendation is in parentheses. (1) A patient with exposure due to suspected self-harm, misuse, or potentially malicious administration should be referred to an emergency department immediately regardless of the dose reported (Grade D). (2) Patients with inhalation exposures will not develop systemic toxicity and can be managed out-of-hospital if asymptomatic (Grade B). Patients with clinically significant mucous membrane irritation should be referred for evaluation (Grade D). (3) Decontamination of dermal exposures should include routine cleansing with mild soap and water. Removal of contact lenses and immediate irrigation with room temperature tap water is recommended for ocular exposures. All patients with symptoms of eye injury should be referred for an ophthalmologic exam (Grade D). (4) Patients with symptoms of ethylene glycol poisoning should be referred immediately for evaluation regardless of the reported dose (Grade C). (5) The absence of symptoms shortly after ingestion does not exclude a potentially toxic dose and should not be used as a triage criterion (Grade C). (6) Adults who ingest a "swallow" (10-30 mL), children who ingest more than a witnessed taste or lick, or if the amount is unknown of most ethylene glycol products should be referred immediately for evaluation. The potential toxic volume of dilute solutions (e.g., concentration <20%) is larger and can be estimated by a formula in the text (Grade C). (7) A witnessed taste or lick only by a child, or an adult who unintentionally drinks and then expectorates the product without swallowing, does not need referral (Grade C). (8) Referral is not needed if it has been >24 hours since a potentially toxic unintentional exposure, the patient has been asymptomatic, and no alcohol was co-ingested (Grade D). (9) Gastrointestinal decontamination with ipecac syrup, gastric lavage or activated charcoal is not recommended. Transportation to an emergency department should not be delayed for any decontamination procedures (Grade D). (10) Patients meeting referral criteria should be evaluated at a hospital emergency department rather than a clinic. A facility that can quickly obtain an ethylene glycol serum concentration and has alcohol or fomepizole therapy available is preferred. This referral should be guided by local poison center procedures and community resources (Grade D). (11) The administration of alcohol, fomepizole, thiamine, or pyridoxine is not recommended in the out-of-hospital setting (Grade D).

Adult↗
PubMed2001

Oral stimulation influences postprandial triacylglycerol concentrations in humans: nutrient specificity.

OBJECTIVE: To determined whether the nature of the lipid in an oral stimulus modifies postprandial triacylglycerolemia. METHODS: Sixteen healthy adults (eight male, eight female) participated in six test sessions conducted weekly. The test sessions were administered randomly after overnight fasts and included: ingestion of 50 grams of butter in capsules (to avoid oral stimulation with lipids) and 500 mL of water in 15 minutes followed by oral stimulation with one of the following foods on a cracker: butter, unsaturated fatty acid (UFA) margarine, jelly, UFA margarine + jelly, cracker alone or no oral stimulation. Sensory stimulation entailed masticating and expectorating approximately 5.0 g samples of each stimulus every three minutes for 110 minutes. Blood was drawn immediately after preload ingestion and at minutes 35, 85, 200, 320, and 440 post loading and analyzed for serum triacylglycerol (TAG), insulin and glucose concentrations. RESULTS: Only the oral samples containing the UFA margarine led to significant elevations of serum TAG concentration compared to baseline (p < 0.05). Maximum change of TAG concentrations were greater following orosensory stimulation with UFA margarine compared to orosensory stimulation with butter, jelly or UFA margarine + jelly. No differences were observed relative to vehicle alone or no orosensory stimulation, but this is due to lower nadir values for these treatments. Insulin and glucose concentrations were not different between treatments. CONCLUSION: Oral exposure specifically to an unsaturated dietary lipid augments the postprandial rise of TAG, compared to baseline.

Adolescent↗
PubMed2006

Different effects of arborinine alkaloid obtained from Brazilian Erthela baihensis on spleen and thymus cells stimulated in vitro with different mitogens.

The present study has examined the effects of arborinine, an alkaloid obtained from Erthela bahiensis, a Brazilian plant popularly used as diuretic, antidiabetic, antithermic and expectorant, on the viability and function of immune system cells in vitro using a murine model. Rat spleen and thymus cells were cultured with 10 nM, 1 microM, 10 microM of the drug in the presence or absence of pokeweed (PWM), lipopolysaccharide (LPS), or concanavallin (ConA) mitogens. Cellular proliferation was analyzed by H3-thymidin uptake after 48 and 72 hr. Our results showed an inhibitory effect of arborinine on splenocytes proliferation under ConA or PWM stimulation and increased apoptosis on splenocytes and thymocytes stimulated with PWM in 24 hr. A decrease was observed on Interferon gamma (IFN-gamma) production by ConA- or LPS-stimulated splenocytes in 48 hr and 72 hr and ConA- or PWM-stimulated thymocytes in 72 hr. In contrast, an increase on lymphoproliferation was observed on LPS-stimulated splenocytes and ConA- or PWM-stimulated thymocytes in 48 hr. On this period, apoptosis decreased on LPS- or PWM-stimulated splenocytes and IFN-gamma production increased in PWM stimulated thymocytes. Arborinine also induced a decrease on Interleukin-10 production by splenocytes and thymocytes stimulated with ConA or PWM. There was no significant variation on the necrosis rate of the cells treated with arborinine or any change on their viability or function values in the absence of mitogenic stimulus.

Alkaloids↗
PubMed2003

Plasma salicylate from methyl salicylate cream compared to oil of wintergreen.

BACKGROUND: Poison Control Centers follow the acetylsalicylic acid (ASA) treatment guideline to manage unintentional ingestions of topical methyl salicylate liniments. For example, one teaspoon of 30% methyl salicylate cream such as Ben Gay provides an "ASA equivalent dose" of 180 mg/kg for a 10 kg child. The ASA treatment guideline advises emesis with syrup of Ipecac and 24 h home followup for this dose. Both the ASA conversion factor to yield the ASA equivalent dose and the treatment guideline assume 100% bioavailability of the salicylate. The nature of this topical dosage product led the investigators to expect less than complete absorption of methyl salicylate. OBJECTIVE: To compare plasma concentrations of salicylate from ingested methyl salicylate cream with plasma concentrations of salicylate from ingested oil of wintergreen. METHODS: Four adult volunteers consented to an open label, four-way crossover design, with randomization to the following treatments: 1 mL Oil of Wintergreen, U.S.P., 6.7 g of Ben Gay 15% and 20 g of Ben Gay 15% and also to hold 5 g of Ben Gay 15% cream in the buccal cavity for 1 minute and then expectorate. Plasma was collected for salicylate determination, and the results analyzed with a noncompartmental pharmacokinetic model. RESULTS: No plasma salicylate was detected after buccal treatment phase. Relative bioavailability for the low-dose treatment was 0.5 compared to oil of wintergreen. CONCLUSION: Plasma salicylate concentrations from methyl salicylate cream are not equal to those achieved after ingestion of oil of wintergreen. Dosage formulation must be considered when predicting toxicity.

Absorption↗
PubMed2000

Endemic contamination of clinical specimens by Mycobacterium gordonae.

Contamination of clinical specimens by Mycobacterium gordonae is a significant endemic problem in many laboratories. To investigate this problem, 84 cases at 1 hospital were retrospectively identified during 20 months. The overall rate of specimen contamination was 2. 4%, and 72 of the contaminated specimens were respiratory. A case-control comparison showed that the risk of respiratory specimen contamination was significantly increased if the specimen was expectorated (odds ratio [OR], 3.62; 95% confidence interval [CI], 1. 36-9.50) or if the patient consumed fluids within 2 days before specimen collection (OR, 8.92; 95% CI, 1.40-71.20). Cultures of tap water, ice, and iced drinking water all yielded M. gordonae at 10(-2)-10(0) cfu/mL. A culture survey of consenting patients showed contamination of 8 (24%) of 34 sputum specimens collected immediately after a tap water mouth rinse. These findings demonstrate that endemic specimen contamination arises from mycobacteria in hospital tap water and provide a foundation for control efforts.

Adult↗