Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Yield stability”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 919 records · Page 51Linked to original sources
PubMed1997

The effects of truncations of the small subunit on m-calpain activity and heterodimer formation.

In order to study subunit interactions in calpain, the effects of small subunit truncations on m-calpain activity and heterodimer formation have been measured. It has been shown previously that active calpain is formed by co-expression of the large subunit (80 kDa) of rat m-calpain with a delta 86 form (21 kDa) of the small subunit. cDNA for the full-length 270 amino acid (28.5 kDa) rat calpain small subunit has now been cloned, both with and without an N-terminal histidine tag (NHis10). The full-length small subunit constructs yielded active calpains on co-expression with the large subunit, and the small subunit was autolysed to 20 kDa on exposure of these calpains to Ca2+. A series of deletion mutants of the small subunit, NHis10-delta 86, -delta 99, -delta 107, and -delta 116, gave active heterodimeric calpains with unchanged specific activities, although in decreasing yield, and with a progressive decrease in stability. NHis10-delta 125 formed a heterodimer which was inactive and unstable. Removal of 25 C-terminal residues from delta 86, leaving residues 87-245, abolished both activity and heterodimer formation. The results show that: (a) generation of active m-calpain in Escherichia coli requires heterodimer formation; (b) small subunit residues between 94 and 116 contribute to the stability of the active heterodimer but do not directly affect the catalytic mechanism; (c) residues in the region 245-270 are essential for subunit binding. Finally, it was shown that an inactive mutant Cys103-->Ser-80k/delta 86 calpain, used in order to preclude autolysis, did not dissociate in the presence of Ca2+, a result which does not support the proposal that Ca(2+)-induced dissociation is involved in calpain activation.

Amino Acid Sequence↗
PubMed2002

Folding free energy function selects native-like protein sequences in the core but not on the surface.

An automatic protein design procedure is used to select amino acid sequences that optimize the folding free energy function for a given protein. The only information used in designing the sequences is a set of known backbone structures for each protein, a rotamer library, and a well established classical empirical force field, which relies on basic physical chemical principles that underlie molecular interactions and protein stability, and has not been adjusted to yield native-like sequences. Applying the procedure to 7 different known protein folds, representing a total of 45 different native protein structures, yields ensembles of designed sequences displaying remarkable similarity to their natural counterparts in the protein core, but which are distinctly non-native on the protein surface. We show that natural and designed sequences for a given fold score significantly higher than random sequences against profiles derived from both, designed and natural sequence ensembles. Furthermore, we find that designed sequence profiles can be used to retrieve the native sequences for many of the analyzed proteins using standard PSI-BLAST searches in sequence databases. These findings may have important implications for our understanding the selection pressures operating on natural protein sequences and hold promise for improving fold recognition.

Amino Acid Sequence↗
PubMed1983

Marking snails with nail varnish as a field experimental technique.

The use of nail varnish to mark snails for release and recapture in aquatic habitats in the Gezira Irrigation Canals has been evaluated. The nail varnish withstood immersion in canal water and adhered to the snail shell. The recovery of marked snails from a backwater site in a slow moving canal was satisfactory and indicated the usefulness of the technique in predicting changing patterns of immigration and emigration of snails. The method may also indicate ecological changes which affect the stability and mobility of snail populations and yield data on growth rates and longevity.

Animal Identification Systems↗
PubMed1989

Theoretically determined three-dimensional structures for amphipathic segments of the HIV-1 gp41 envelope protein.

Three-dimensional computer models for two segments of the C terminus of gp41, the transmembrane AIDS envelope protein, which may form amphipathic alpha-helices, have been generated using structure prediction techniques combined with energy minimization and molecular dynamics simulations. Regions gp41(772-790) and gp41(828-848) of the HXB2 strain of HIV-1 display extraordinarily high hydrophobic moment maxima as alpha-helices and when in an antiparallel conformation exhibit charge complementarity, implying that they may bind with each other and associate with the membrane. The feasibility of this hypothesis was tested in a series of computer simulations of these peptides, extended by several residues to include additional charge pairing. Beginning with a trial structure in the form of antiparallel alpha-helices of segments 770-794 and 824-856, systematic axial rotations and displacements were used to generate alternative initial states. Molecular dynamics simulations with alpha-helical torsional restraints yielded several approximately cylindrical dimeric structures highly stabilized by numerous salt links and other hydrogen bonds. This suggests that these two regions may fold back on each other in antiparallel fashion to form a loop in the tertiary structure over residues 770-856, with the loop closed by membrane-associated amphipathic alpha-helices with charged sides facing each other. We speculate that such structures could aggregate to form channels or otherwise destabilize the membrane, thereby contributing to the cytopathic effects of the gp120-gp41 complex.

Amino Acid Sequence↗
PubMed2005

Effects of compression on the vibrational modes of marginally jammed solids.

Glasses have a large excess of low-frequency vibrational modes in comparison with most crystalline solids. We show that such a feature is a necessary consequence of the weak connectivity of the solid, and that the frequency of modes in excess is very sensitive to the pressure. We analyze, in particular, two systems whose density D(omega) of vibrational modes of angular frequency omega display scaling behaviors with the packing fraction: (i) simulations of jammed packings of particles interacting through finite-range, purely repulsive potentials, comprised of weakly compressed spheres at zero temperature and (ii) a system with the same network of contacts, but where the force between any particles in contact (and therefore the total pressure) is set to zero. We account in the two cases for the observed (a) convergence of D(omega) toward a nonzero constant as omega-->0, (b) appearance of a low-frequency cutoff omega*, and (c) power-law increase of omega* with compression. Differences between these two systems occur at a lower frequency. The density of states of the modified system displays an abrupt plateau that appears at omega*, below which we expect the system to behave as a normal, continuous, elastic body. In the unmodified system, the pressure lowers the frequency of the modes in excess. The requirement of stability despite the destabilizing effect of pressure yields a lower bound on the number of extra contact per particle deltaz:deltaz> or =p1/2, which generalizes the Maxwell criterion for rigidity when pressure is present. This scaling behavior is observed in the simulations. We finally discuss how the cooling procedure can affect the microscopic structure and the density of normal modes.

Journal Article↗
PubMed1986

An enzyme-linked immunosorbent assay for measuring antisperm autoantibodies following vasectomy in Lewis rats.

An indirect enzyme-linked immunosorbent assay (ELISA) was devised to measure antisperm auto-antibodies in the Lewis rat following vasectomy. The assay system was validated by employing prevasectomy sera and postvasectomy antisera, previously demonstrated to contain antisperm antibodies by indirect immunofluorescence. A standardized ELISA protocol was developed employing 10(5) sperm per microtiter plate well and sucrose-polyvinylpyrrolidone as a postcoat stabilizer solution. The ELISA was shown to yield significant detectable antibody at dilutions of 1/512 or greater in the most reactive sera. A standard for scoring positive titers was adopted: 1.96 standard deviations above the mean of the preimmune value. Using the criterion, 88% of 7-week postvasectomy samples could be discriminated from preimmune samples at a 1:16 dilution, which was adopted for subsequent assays. The ELISA demonstrated 73% and 91% reproducibility for an intraassay analysis of single prevasectomy and postvasectomy serum samples (7 weeks postvasectomy) tested in 160 determinations on a standard sperm pool. When this single antigen pool was employed in 35 determinations at 0, 1, and 4 weeks in an interassay study, 56% and 70% reproducibility was found for pre- and postvasectomy sera respectively. A correlation (r = 0.75) was made between a single absorbance value and the endpoint titer of the same sera, which indicated that single absorbance values could be used to predict serum titer and single dilutions could be used for general screening of a large number of samples. The ELISA described provides a rapid, sensitive, and reliable method that discriminated between samples taken before and after vasectomy.

Animals↗
PubMed1976

Adaptation of an osmotically fragile L-form of Streptococcus pyogenes to physiological osmotic conditions and its ability to destroy human heart cells in tissue culture.

An osmotically fragile L-form of Streptococcus pyogenes, type 12, was quickly rendered osmotically stable by decreasing the sodium chloride content of the growth medium and with the temporary use of oleic acid. The change from osmotic fragility to stability was accompanied by changes in cell yield, generation time, saturated/unsaturated fatty acid ratio of the membrane, and cytoplasmic protein composition. Finally, this resulting osmotically stable L-form survived and was capable of rapidly destroying Girardi human heart cells in tissue culture.

Cell Survival↗
PubMed2005

Is NMDA receptor activation essential for the production of locomotor-like activity in the neonatal rat spinal cord?

Previous work has established that in vitro bath application of N-methyl-D-aspartic acid (NMDA) promotes locomotor activity in a variety of vertebrate preparations including the neonatal rat spinal cord. In addition, NMDA receptor activation gives rise to active membrane properties that are postulated to contribute to the generation or stabilization of locomotor rhythm. However, earlier studies yielded conflicting evidence as to whether NMDA receptors are essential in this role. Therefore in this study, we examined the effect of NMDA receptor blockade, using D-2-amino-5-phosphono-valeric acid (AP5), on locomotor-like activity in the in vitro neonatal rat spinal cord. Locomotor-like activity was induced using 5-hydroxytryptamine (5-HT), acetylcholine, combined 5-HT and NMDA receptor activation, increased K(+) concentration, or electrical stimulation of the brain stem and monitored using suction electrode recordings of left and right lumbar ventral root discharge. We also studied the effect on locomotor capacity of selectively suppressing NMDA receptor-mediated active membrane properties; this was achieved by removing Mg(2+) ions from the bath, which in turn abolishes voltage-sensitive blockade of the NMDA receptor channel. The results show that, although NMDA receptor activation may seem essential for locomotor network operation under some experimental conditions, locomotor-like rhythms can nevertheless be generated in the presence of AP5 if spinal cord circuitry is exposed to appropriate levels of non-NMDA receptor-dependent excitation. Therefore neither NMDA receptor-mediated nonlinear membrane properties nor NMDA receptor activation in general is universally essential for locomotor network activation in the in vitro neonatal rat spinal cord.

2-Amino-5-phosphonovalerate↗
PubMed2003

Developmental regulation of plasticity in the forepaw representation of ferret somatosensory cortex.

This study characterized the spatiotemporal responses in ferret somatosensory cortex after sensory deprivation at different phases of cortical development. We hypothesized that cortical responses to stimulation of intact superficial radial nerve in adults will vary systematically according to maturation of thalamocortical relationships at the time of an ulnar nerve transection. Depending on the age of the animal at the time of the lesion, we found differential effects on the spatial distribution of the short- and long-latency components of the cortical response. In animals lesioned at postnatal days 5-7, when thalamic projections are not yet stabilized and layer 4 is not yet formed, we found that initial (short-latency) cortical responses are widespread and fragmented. Ulnar nerve transections performed at postnatal day 20 or 21, when thalamocortical afferents are more stabilized and layer 4 is clearly identifiable, yield moderate expansions in the distribution of short- and long-latency components of the cortical response. Nerve lesions in adults lead to a wider distribution of long-latency cortical activity. Neonatal lesions broaden the spatial distribution and increase the latency of the initial cortical response; interruption of nerve input in older juveniles alters both the early and later components; and nerve lesions in adult animals expand the distribution of later cortical activity only. These findings demonstrate correlation between developmental phase at the time sensory input is interrupted and the latency of affected components of the cortical response. This supports the hypothesis that differential response changes are regulated by functional reorganization of thalamocortical connections after neonatal lesions and alteration of corticocortical dynamics after adult lesions.

Age Factors↗
PubMed2006

Identification of interleukin-13 receptor alpha2 peptide analogues capable of inducing improved antiglioma CTL responses.

Restricted and high-level expression of interleukin-13 receptor alpha2 (IL-13Ralpha2) in a majority of human malignant gliomas makes this protein an attractive vaccine target. We have previously described the identification of the IL-13Ralpha2(345-353) peptide as a human leukocyte antigen-A2 (HLA-A2)-restricted CTL epitope. However, as it remains unclear how efficiently peptide-based vaccines can induce specific CTLs in patients with malignant gliomas, we have examined whether analogue epitopes could elicit heteroclitic antitumor T-cell responses versus wild-type peptides. We have created three IL-13Ralpha2 analogue peptides by substitutions of the COOH-terminal isoleucine (I) for valine (V) and the NH(2)-terminal tryptophan (W) for either alanine (A), glutamic acid (E), or nonsubstituted (W; designated as 1A9V, 1E9V, and 9V, respectively). In comparison with the native IL-13Ralpha2 epitope, the analogue peptides 9V and 1A9V displayed higher levels of binding affinity and stability in HLA-A2 complexes and yielded an improved stimulatory index for patient-derived, specific CTLs against the native epitope expressed by HLA-A2(+) glioma cells. In HLA-A2-transgenic HHD mice, immunization with the peptides 9V and 1A9V induced enhanced levels of CTL reactivity and protective immunity against an intracranial challenge with IL13Ralpha2-expressing syngeneic tumors when compared with vaccines containing the native IL-13Ralpha2 epitope. These findings indicate highly immunogenic IL-13Ralpha2 peptide analogues may be useful for the development of vaccines capable of effectively expanding IL-13Ralpha2-specific, tumor-reactive CTLs in glioma patients.

Animals↗
PubMed2006

Cathepsin L splice variants in human breast cell lines.

Transcripts of the lysosomal cysteine proteinase cathepsin L are spliced into five variants (L-A, L-A1, LA-2, LA-3 and L-B), which have similar stabilities but different translation efficiencies, thus potentially yielding diverse amounts of the protein. The aim of this study was to investigate whether the abnormally elevated expression of cathepsin L in invasive tumours is due to overexpression of L-A3, the splice variant translated most efficiently. The expression pattern of cathepsin L mRNA variants was measured by quantitative polymerase chain reaction (qPCR) in two panels of cell lines obtained from precancerous and cancerous breast tissue. In both panels, the cell line exhibiting the highest in vitro invasiveness also expressed the highest amount of L-A3. Although the pattern of expression varied, the expression of the L-B variant was always remarkably lower than for other variants. We propose that posttranscriptional regulation of cathepsin L expression is altered during breast tumour progression.

Alternative Splicing↗
PubMedDate not supplied

ET-743: a novel agent with activity in soft tissue sarcomas.

Ecteinascidin-743 (ET-743) is a natural product derived from the marine tunicate Ectenascidia turbinate. ET-743 binds in the minor groove of DNA, blocks transcription factors activity, and traps protein from the nucleotide excision repair system, thus blocking cells in G2-M phase. ET-743 demonstrated cytotoxic activity at very low concentrations against sarcoma cell lines in pre-clinical studies. In several phase II clinical studies in patients with advanced sarcoma failing conventional doxorubicin- and ifosfamide-based chemotherapy, ET-743 delivered by continuous intravenous 24-hour infusion at a dose of 1,500 microg/m2 every 21 days yielded 8% overall response and 30%-40% stabilization rates for a clinical benefit rate close to 40%. Interestingly, long-term stabilizations over more than 3 years have been described. In vivo, ET-743 has a specific toxicity profile, the major toxicity of this product being hepatic, through biliary duct destruction, and hematologic. ET-743 has also been evaluated in first-line treatment for these patients. Finally, due to its original mode of action and the lack of cross-resistance with other chemotherapy agents, ET-743 was tested in a preclinical model in combination with other drugs. Synergy was reported in vitro with doxorubicin and cisplatin; phase I combination studies are in progress.

Antineoplastic Combined Chemotherapy Protocols↗
PubMed1999

Landscape and history: a multidisciplinary approach. Project Group Environmental History (P.G.E.H.).

Human societies have inhabited parts of the Central European country of Austria for thousands of years. The development process shopping the landscape by this long period of human impact remains poorly understood. The present study is an attempt to research landscape history on a local scale and compares an alpine, pre-alpine and midland-village area in Austria. We have developed an appropriate concept to describe the landscape ecology features of the study areas in several stages of the past from 1733 on. The landscape analysis is based on the interpretation of different kinds of historical data (e.g., documents, maps) going back to the pre-industrial epoch, which has--at least in terms of landscape ecology--hardly been accessible until now. An important aim of the study is to localize the historical information in the landscape. Individual plots can be traced back even to the early 14th century. Based on the quality of the available historical data, the historical landscape is analysed with regard to categories such as form and intensity of land use, distribution of nutrients and water as well as the pattern of landscape elements and their ecological functions. The comparison of present stages with former ones yields detailed knowledge on the dynamics and stability of landscape structure. This approach allows present-day land units to be identified as a result of long-term development going back to Medieval times. The primary aim of the study is to analyze factors that bring about change or resist it by creating stability. We therefore examine factors coupling landscape structure, agricultural production and population development. For this reason, we have studied the people and the evidence for their labor over a period of 400 years (1400-1800). Besides demographic data of the 18th and 19th century, historical registrar material has been collected; it enabled the land tenures to be reconstructed from the 15th to the 19th century. This type of data is a valuable source of information for investigating the socio-economic status of a local population or its farmsteads. The collected data reveal similarities in trends between time series of demography, land holding stability and landscape ecology features. A theoretical model shows how population, production and natural resources are connected in the investigated pre-modern communities.

Agriculture↗
PubMedDate not supplied

Radio-iodination of monoclonal antibody using potassium [125I]-(4-isothiocyanatobenzylammonio)-iodo-decahydro-closo-dodecaborate (iodo-DABI).

BACKGROUND: Negatively-charged polyhedral boron clusters can be easily halogenated with highly stable boron-halogen bonds and are promising in radionuclide diagnostics and cancer therapy. MATERIALS AND METHODS: The radio-iodination conditions for the closo-dodecaborate anion and for the conjugation of its labeled isothiocyanatobenzylammonio derivative to the monoclonal antibody (mAb) were optimized. RESULTS: The labeling yield was about 90% and the overall conjugation yield was 55-60%. The in vitro stability of the radio-iodinated mAb was good under physiological and non-physiological conditions. The immunoreactivity of the labeled mAb (SK-BR-3 cells) was retained in the one-pot two-step labeling. CONCLUSION: Negatively-charged polyhedral boron clusters can be used for indirect radio-iodination of mAbs.

Antibodies, Monoclonal↗
PubMed1984

[Condylar plates in the reconstructive surgery of the proximal tibia].

Eleven proximal pseudarthroses of the tibia and elevated osteotomies of the head of the tibia were treated by fitting a condylar plate; this was done at two hospitals in Berlin and Bayreuth in the course of the past ten years. In all osteosyntheses, osseous reconstruction was achieved within a favourable time. Although mounting is technically intricate, it yields immediate or at least early exercise stability.

Aged↗
PubMedDate not supplied

[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors].

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.

Alkylation↗
PubMed1977

[Properties of C1. perfringens toxoids obtained from purified toxins].

The authors present the results of comparative study of the properties of experimental perfringens toxoids obtained from purified alpha-toxoids of different degrees of purity. Experimental toxoids proved to possess a greater immunogenicity than preparations obtained by detoxication of alpha-toxin under conditions of cultural fluid, the greater--the more the purity of alpha-toxin used for procuring the experimental toxoid. C1. perfringens alpha-toxin recovered as a result of two-stage alpha-toxin purification, including its primary concentration and fractionation on DEAE-cellulose under conditions of negative alpha-toxin sorption, changed during detoxication into toxoid whose immunogenicity exceeded that of manufactured preparations 3--4 fold. The toxoid was harmless and sorbed in a dose of 100 BU on 2--3 mg of aluminium hydroxide; stability of its antigenic properties and its yield was not less than those of manufactured toxoids. Perfringens toxoid prepared from highly purified alpha-toxoid was 10 times greater by immunogenicity than the manufactured preparation, and was sorbed on 1--2 mg of aluminium hydroxide.

Animals↗
PubMed1989

Ligand stabilization of cholinesterases.

Stabilization of fetal bovine serum (FBS) acetylcholinesterase (acetylcholine acetylhydrolase, EC 3.1.1.7) (AChE) and human butyrylcholinesterase (acylcholine acylhydrolase, EC 3.1.1.8) (BuChE) by ligands and inhibitors was studied as a function of physical and chemical perturbation. Denaturation of AChE occurred as a binary exponential function in the temperature range studied (50-56 degrees C); the slower fraction progressively diminished as the temperature was increased. Inclusion of ligands or inhibitors stabilized AChE as a function of temperature, ligand concentration and time. The rank order in which ligands stabilized AChE was: edrophonium greater than decamethonium greater than pralidoxime chloride much greater than procainamide. BuChE denaturation was retarded by ligands in the order: decamethonium greater than procainamide greater than edrophonium greater than pralidoxime. A plot of the quotient of the fast/slow ratio against the log of the 50% inhibitory concentration (I50) for ligands providing substantial protection yielded a linear relation, suggesting that these compounds stabilized AChE by a common mechanism involving the anionic site of the active center. Urea-induced cholinesterase denaturation was also retarded by these ligands.

Acetylcholinesterase↗