Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “COTTON”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 901 records · Page 50Linked to original sources
PubMed2003

[Cloning and expression analysis of a LIM-domain protein gene from cotton (Gossypium hirsuturm L.)].

LIM-domain protein plays an important role in various cellular processes, including construction of cytoskeleton, transcription control and signal transduction. Based on cotton fiber EST database and contig analysis, the coding region of a cotton LIM-domain protein gene (GhLIM1) was obtained by RT-PCR from 4DPA (day post anthesis) ovule with fiber. The cloned fragment of 848 bp contains an open reading frame of 570 bp, coding for a polypeptide of 189 amino acids. It was demonstrated that the deduced GhLIM1 protein was highly homologous to the LIM-domain protein of sunflower (Helianthus annuus), tobacco (Nicotiana tabacum) and Arabidopsis thaliana. Two intact LIM-domains, with the conserved sequence of a double zinc-finger structure (C-X2-C-X17-19-H-X2-C-X2-C-X2-C-X16-24-C-X2-H), were found in the GhLIM1 protein. RT-PCR and Northern blot analysis showed that GhLIM1 gene expressed in root, shoot tip, hypocotyls, bud, leaf, anther, ovule and fiber (4DPA, 12DPA, 18DPA). However it was preferentially expressed in the shoot tip, fiber and ovule. It was proposed that the express of GhLIM1 gene is related to cotton fiber development.

Amino Acid Sequence↗
PubMed2003

[HPLC analysis of main flavonoid chemicals and their spatio-temporal dynamics in Bt transgenic cotton].

Flavonoids are important chemicals of resistance to pests in cotton plant. The main flavonoid chemicals and their spatio-temporal dynamics of content in Bt transgenic cotton were tested by HPLC. The results showed that the flavonoid chemicals of resistance to pests mainly including rutin, isoquercitrin and quercetin could be detected and quantitatively analyzed by HPLC. The contents of rutin, isoquercitrin and quercetin were the highest in petal, but lower in calyx, bract and cotton boll. Moreover, the total content of flavonoid chemicals in top leaf was much higher at developmental stage than at seedling stage. The content of each flavonoid chemicals of resistance to pests was different during different developmental stage and in different organs. It was indicated that different flavonoid chemicals played different roles in resistance to pests.

Bacillus thuringiensis↗
PubMed2003

[Evaluation of the effect of pollen irradiation on karyotype variability in cotton plants].

The effect of pollen irradiation at dose rates of 10, 15, 20, and 25 Gy on variability in cotton plants Gossypium hirsutum L. was studied. The modified plants showed a reduced fertility, mainly caused by chromosomal rearragements and genomic mutations during meiosis. The genomic mutations involved primary and tertiary monosomics, monotelodisomics, and a haploid plant. The decrease in meiotic index and pollen fertility in the cotton aneuploids was related not only to aberrations in chromosome pairing but also to genetic features of the original plants. It was found that heterozygosity for interchromosomal exchanges found in M1 plants resulted in the formation of multivalent associations of chromosomes of various forms and types of segregation from translocation complexes. Another result was high variability in pollen fertility. An increase in irradiation dose rate caused an increase in the number of translocants with a high frequency of quadrivalents. The results suggest that the great diversity of forms observed in M1 after pollination with irradiated pollen is determined, first, by elimination of some chromosomes or their arms or the whole paternal genotype and second, by interchromosomal rearrangements. The high variability in pollen fertility of translocants hampers using this trait as a marker of heterozygosity for exchanges in cotton.

Aneuploidy↗
PubMedDate not supplied

[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction].

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.

Acyltransferases↗
PubMed2004

[The structural characteristics, alternative splicing and genetic experession analysis of ADP-ribosylation-factor 1 (arf1) in cotton].

The full-length cDNA,DNA and promoter of ADP-ribosylation-factor 1 (arf1) was isolated from Gossypium hirsutum Y18 by means of isocaudarner inverse PCR (II-PCR) and rapid isolating cDNA 5' unknown sequence and promoter (RICUP) established in our lab. Results indicated that the gene is 4 360 bp in size, including seven exons and six introns. Interestingly, alterative splicing occurs at intron I. Differential processing of intron 1 yields three different transcripts with 1 026 bp, 1103 bp and 1 544 bp in sizes, respectively. Arf1 encodes 181 amino acids. Sequence analysis indicated that sequence upstream transcription initiation site of arf1 includes typical initiator, TATA box, CCAAT box, GC box and several forward and reverse repeat sequences. And typical promoter structures, such as AT-rich sequence and palindrome structure have been detected in the sequence downstream transcription initiation site. Southern blot analysis indicated that the gene has two copies in the genome of cotton. Northern blot confirmed the predominate expression of arf1 in reproductive organs of cotton, including bud, flower, fiber and boll. Also, the feature and character of arf1 and its promoter have been studied. This study will lay foundation for the other research on function of arf1 in the development of reproductive organs in cotton.

ADP-Ribosylation Factor 1↗
PubMed1992

[The evaluation of the efficacy of drapes and gowns of nonwoven fabric versus drapes and gowns of cotton in reducing the incidence of postoperative wound infections].

The importance of the preparation of an operative field which will guarantee satisfactory conditions of asepsis during the entire operation is an indispensible premise for controlling the development of postoperative wound infections. This paper compared the efficacy of disposable clothes and gowns in TNT FABRIC 450* in relation to cotton gowns in reducing the incidence of postoperative wound infections. Cotton items were used for 25 subjects out of a group of 50 operated patients and nonwoven fabric (TNT FABRIC 450*) items were used for the other 25. Thorough bacteriological tests were performed in each patient before, during and after the operation. On the basis of the duration of the operation, it was observed that TNF FABRIC 450* was as efficacious as cotton in controlling postoperative infections in those operations with a short or medium duration; it offered greater protection in lengthy operations, with a higher risk of endogenous and exogenous contamination. It was also observed that disposable items were indispensable in patients treated with radioactive materials and offered greater safety in seropositive patients.

Asepsis↗
PubMed2004

[Glyphosate-resistant cotton (Gossypium hirsutum L.) Transformed with aroAM12 gene via Agrobacterium tumefaciens].

A mutant, aroAM12, exhibiting resistance to glyphosate produced in a previous study using the staggered extension process with aroA genes from Salmonella typhimurium and Eschrichia coli. In this paper, we constructed a vector pGRA1300 carrying aroAM12 gene, comprising transit peptide of Arabidopsis EPSPS, under the control of the CaMV35S promoter and used as selectable marker for cotton plant (Gossypium hirsutum L.) transformation. Transgenic cottons with increased resistance to glyphosate were obtained by cotransformtion of hypocotyl segments with Agrobacterium tumefaciens and selected directly on medium containing glyphosate. Regeneration of glyphosate-resistant calli was carried out on a MS basic medium containing 2,4-D 0.1 mg/L, KT 0.1 mg/L, cefotaxime 500 mg/L and glyphosate 60 micromol/L. Globular embryos were induced and then developed by culturing on MSB (MS salts+B(5) vitamins) medium supplemented with asparagine 1 g/L and glutamine 2 g/L, but not containing hormone, for 40 d. The developed plantlets were then removed and cultured on an MS medium. After about 20 d, the deeply-rooted shoots were in soil. PCR analysis showed that the aroAM12 gene was present in all T(0) transgenic plants. The integration of the aroAM12 gene in the genomic DNA of cotton was further confirmed by Southern blot, which showed that the transgenic plants carried one or two copies of the aroAM12 genes. Western blot analysis showed that a 48-kD band of was detected in all T(0) transgenic plants. There was no apparent corelation between copy numbers and the expression level of the aroAM12 gene. Greenhouse screening for glyphosate resistance was performed to test 65 independent T(0) plants by spraying (three times) with an aqueous suspension at a dose corresponding to 9.317 kg/ha of Roundup (once every 5 d). After 15 d, phenotype examination was carried out of the plants in comparison with untransformed control plants. Under these conditions, it was observed that the plants transformed with pGRA1300 showed high resistance to glyphosate whereas the control plants were all killed. The glyphosate resistance of T(1) generation was measured by spraying with Roundup, the numbers of glyphosate resistance and sensitive phenotypes showed Mendelian segregation ratio.

Agrobacterium tumefaciens↗
PubMed2004

[Different effects of illumination with xenon and sulfur lamp on growth and development of cotton plants].

Experiments were carried out with cotton (Gossgpium hirsutum cv. Xuzhou 142) plants to study the effects of illumination with xenon and sulfur lamp on development of cotton plants. The results showed that, compared with xenon lamp, illumination with sulfur lamp inhibited excessive elongation of hypocotyl via promotion of longitudinal elongation of epidermis and cortex cells, increased the numbers of branches, buds and bolls significantly. It suggested that illumination with sulfur lamp rendered cotton photomorphogenesis more favorable to yield formation.

Gossypium↗
PubMed2005

[A physiological development time-based simulation model for cotton development stages and square- and boll formation].

In this study, three cotton varieties (CRI 36, CRI 35 and CRI 41) were planted in Nanjing, Anyang, Baoding and Shihezi, respectively, in 2002, and the dynamic relationships between their development and environmental factors were analyzed. Based on this, a simulation model for cotton development stages and square-and boll development was built in terms of physiological development time (PDT). In calculating relative thermal effectiveness, the effect of diurnal temperature differences in different regions on cotton development was incorporated, and the enhancement of plastic mulching on air temperature was quantified. To simulate development stages, the initial fruiting node index (IFIN), sunlight duration factor (FSH), and solar radiation index on fruiting branch (IFBR) were introduced, besides earliness factor of a given genotype. The validation of the model with the data obtained from different years, ecological zones, genotypes, and cultivation practices indicated a high goodness of fitness between the simulated results and observed values. The root mean square error (RMSE) between simulated and observed days from sowing to emergence, emergence to squaring, anthesis to boll opening, and sowing to boll opening was 0.9, 2.2, 1.7, and 2.1 d, respectively, with a mean of 2.1 d, and in all plant sites, the RMSE between simulated and observed days from squaring to boll opening was 1.8-3.7 d, and that from squaring to opening was 4.6-5.8 d.

Gossypium↗
PubMed2005

William J. Morrison (1860-1926): co-inventor of the cotton candy machine.

William James Morrison (1860-1926), from Nashville, Tennessee was a noted dentist, lawyer, author and leader in civic and political affairs. An 1890 graduate of the University of Tennessee Dental College, Dr. Morrison became President of the Tennessee State Dental Association in 1894. He had a wide interest in both science and politics, and was personally associated with both William Jennings Bryan and President Woodrow Wilson. Additionally, he was a popular author of children's books and particularly effective in fostering reading among youngsters. Also, Dr. Morrison patented several important inventions. He developed a process for extracting oils from cotton seed, and converting them into a lard substitute. Likewise, he devised a chemical process to purify the public drinking water for Nashville. In 1897, he and John C. Wharton (a fellow Nashville candy maker) conceived and co-patented an "electric candy machine" which produced cotton candy (then called "Fairy Floss".) This article provides background information about the production of spun sugar during medieval times and later, it describes the development of their cotton candy machine, the process of its operation and details about its eventual worldwide commercialization. In addition, it discusses the introduction of this new confection to the public, during the 184 day, Louisiana Purchase Exposition, held in St. Louis, MO. in 1904. In late 1926, Dr. Morrison, died of a stroke at age 66.

Candy↗
PubMed2005

[Spontaneous and induced programmed cell death in suspension cell cultures of cotton (Gossypium hirsutum L.)].

Cotton suspension cells grew well in the MS medium supplemented with 0.1 mg/L 2,4 D and 0.1 mg/L KT. Senescence occurred when the cells were unsubcultured. The cells began to lose their viabilities on the 17th day, and on the 21th day oligonucleosomal sized DNA fragments ( DNA ladder) could be detected. Oligonucleosomal sized DNA fragments ( DNA ladder) was the hallmark of the programmed cell death. Programmed cell death of cotton suspension cells could be induced respectively by some stress factors which included heatshock (42+/-3 degrees C for 8 hours), 10 micromol/L camptothecin, 20 micromol/L fumonisin B1 and 50 mmol/L cycloheximide. The cotton suspension cells which grew in the MS medium supplemented with 0.1 mg/L 2,4 D and 0.1 mg/L KT differred physiologically from the cells in the MS medium supplemented with 0.1 mg/L IBA and 0.1 mg/L KT, and they responded differentially to the heatshock, 10 micromol/L camptothecin and 20 micromol/L fumonisin B1, while the same to 50 mmol/L cycloheximide.

Apoptosis↗
PubMed2005

Function analysis of promoter trapping system after inserted into cotton (Gossypium hirsutum L. ) genome.

The technique of promoter trapping was developed to investigate its viability in cotton ( Gossypium hirsutum L.) functional genomics. 141 independent transformants of cotton were generated via Agrobacterium tumefaciens mediated transformation, of which 97% showed positive by PCR detection. The reporter, GUS gene, was expressed to different extent in different organs, with a frequency of 48% in roots, 9.2% in vascular bundles of stem, 5.2% in leaves, and 51% in flowers. Meanwhile, we discovered that there existed great differences in expression patterns among different transgenic lines. Their GUS expression patterns were organ- or tissue-specific or ubiquitous in all of the plants. The promoter trapping system developed here was characterized as an effective method for creating mutants with diverse reporter gene expression patterns, which laid a solid foundation for further research of functional genomics in cotton.

Base Sequence↗
PubMed2006

[Cloning of GhAQP1 gene and its specific expression during Ovule development in cotton].

Plant aquaporins, belonging to the MIP superfamily, are a series of transmembrane proteins that facilitate water transport through cell membranes. In this study, a cDNA clone encoding the PIP1-like protein was isolated from cotton (Gossypium hirsutum) cDNA libraries, and designated as GhAQP1 (Fig.1). We also isolated the GhAQP1 gene from cotton genome by PCR. The gene is 2,096 bp in length, including an open reading frame (ORF) and 5'-/3'-untranslated regions (UTR). It contains two introns in its ORF. The first intron is inserted between codons 209 and 210 in the fifth transmembrane helix, and another is located between codons 256 and 257 in the sixth transmembrane helix of GhAQP1, respectively (Figs.2 and 3). Northern blot analysis showed that GhAQP1 gene is expressed specifically in 6-15 DPA ovule, and reaches a peak in 9 DPA ovule (Figs.4 and 5), suggesting that its expression is ovule-specific and developmentally regulated in cotton.

Amino Acid Sequence↗
PubMedDate not supplied

Integration of enzyme-linked immunosorbent assay with conventional chromatographic procedures for quantitation of aflatoxin in individual cotton bolls, seeds, and seed sections.

Integration of an enzyme-linked immunosorbent assay (ELISA) with conventional chromatographic methods proved the versatility of ELISA as a research tool and allowed for rapid assessment of aflaxtoxin in individual cottonseeds, parts of cottonseed, and composite samples of seeds taken from individual cotton bolls. Aqueous acetone was substituted for methanol in the extraction procedure prescribed by ELISA. The substitution allowed the use of a common extract for all analytical methods. An aliquot of the extract was used to screen samples by ELISA. Negative samples were identified, and toxin levels between 1 and 70 ng/g were quantitated by ELISA. Samples with toxin levels beyond the upper limit of detection by ELISA were then subjected to more time-consuming conventional cleanup prior to quantitation by liquid chromatography (LC) or thin-layer chromatography (TLC). Toxin levels detected by LC or TLC ranged from 100 to 845,000 ng/g sample. The screen by ELISA detected large numbers of toxin-negative cotton bolls or individual seeds in minimum analysis time. The combination of techniques verified the presence of seed with no toxin adjacent to toxin-containing seed in the same lock. Toxin-negative portions of individual seed with high toxin in another portion were identified for the first time. Integration of techniques provided needed information on distribution patterns of aflatoxin in cotton so that preventive measures can be developed.

Aflatoxin B1↗
PubMedDate not supplied

[Adaptation of the type I poliomyelitis virus to cotton rats].

Adaptation of poliomyelitis virus type I (Mahoney strain) to the CNS of cotton rats which at the time of inoculation had been temporarily immunosuppressed with cyclophosphane is described. In the course of passages the virus properties were observed to change. The virus became pathogenic for cotton rats with normal immunologic responsiveness by the intracerebral, intraperitoneal and subcutaneous routes, as well as for white mice intracerebrally. Virions pathogenic for cotton rats were predominant in the adapted strain population.

Adaptation, Physiological↗
PubMed1990

The effects of rewarming hypothermic postanesthesia patients using Thermadrape covering, heat lamps, and warmed cotton blankets.

The following article includes a brief review of hypothermia and describes contributing factors that cause hypothermia in the operating room as well as the methods used to rewarm patients in the PACU. Thermadrape coverings (OR Concepts, Inc, Roanoke, TX) were studied to determine if they were effective in maintaining body temperature within a normothermic range. Of 55 patients evaluated in the PACU, 18 (32%) who received Thermadrape coverings in the perioperative period remained normothermic. The methods used to rewarm postanesthesia patients included three combinations: Thermadrape and warmed cotton blankets, warmed cotton blankets and heat lamps, and warmed cotton blankets alone.

Bedding and Linens↗
PubMedDate not supplied

Efficacy of the cytobrush versus the cotton swab in the collection of endocervical cells.

Cervical smears should contain endocervical cells to be accepted as adequate for a cytologic diagnosis. Before this study was undertaken, one-third of the smears received in the Cytology Laboratory of Odense University Hospital were inadequate. In an attempt to increase the rate of adequate smears, a randomized study was undertaken to compare the efficacy of the combined spatula-Cytobrush method to that of the spatula-cotton swab method traditionally used by doctors in Denmark. The incidence of smears containing cylindrical and/or metaplastic cells was 89% by the spatula-Cytobrush method as compared to 62% by the spatula-cotton swab method (P less than .001). There were large differences between the rates of adequate smears from the various doctors when using the spatula-cotton swab method (range, 14% to 82%); these differences were far less when using the spatula-Cytobrush method (range, 75% to 100%). A large-scale application of the spatula-Cytobrush method should result in fewer repeat smears required and fewer false-negative smears.

Cervix Uteri↗
PubMed1989

Myofibroblasts in cotton-induced granulation tissue and the bovine adrenal capsule: morphological aspects.

Ultrastructural studies of one week old cotton-induced granulation tissue revealed the presence of polymorphonuclear neutrophils (PMN), macrophages and mast cells, whilst the granulation tissue from two week old cotton implants contained fibroblasts, myofibroblasts and abundant collagen fibres. Similarly, the bovine adrenal capsule contained both fibroblasts and myofibroblasts. It is proposed that the bovine adrenal capsule and two week cotton-induced granulation tissue could be utilized as in-vitro models to study the mechanism(s) involved in myofibroblast contraction.

Adrenal Glands↗