Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “ALFALFA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 901 records · Page 50Linked to original sources
PubMed2005

Targeted down-regulation of cytochrome P450 enzymes for forage quality improvement in alfalfa (Medicago sativa L.).

Improving the digestibility of forages provides a means to enhance animal performance and protect the environment against excessive animal waste. Increased lignin content during maturity, and corresponding changes in lignin composition, correlate with decreased digestibility of forages. These relationships have yet to be investigated in isogenic systems. By targeting three specific cytochrome P450 enzymes of the lignin pathway for antisense down-regulation, we generated transgenic alfalfa lines with a range of differences in lignin content and composition. There was a strong negative relationship between lignin content and rumen digestibility, but no relationship between lignin composition and digestibility, in these transgenic lines. Models for genetic manipulation of forage digestibility based on the changes in lignin composition that increase paper-pulping efficiency in trees are therefore invalid. Down-regulation of 4-coumarate 3-hydroxylase provided the largest improvements in digestibility yet seen in a forage crop.

Animal Feed↗
PubMed1977

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Base Sequence↗
PubMed1979

3'-Terminal nucleotide sequence of alfalfa mosaic virus RNA 4.

The sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus RNA 4, the messenger for the viral coat protein, has been elucidated. A fragment containing the 3' terminus of the RNA was obtained by mild digestion with RNase T1. The primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of RNA sequencing techniques. The sequence is completely extracistronic and is believed to contain the binding sites for the viral coat protein and replicase.

Base Sequence↗
PubMed1988

Synthesis of an opine-like compound, a rhizopine, in alfalfa nodules is symbiotically regulated.

We show that the promoter of the mos locus, which encodes genes required for the synthesis of a nodule-specific, opine-like compound, a rhizopine, in alfalfa nodules is regulated by the symbiotic nitrogen-fixation regulatory gene nifA. The 5'-regulatory region and amino-terminal end of the first open reading frame of the mos locus are highly homologous to the 5'-regulatory region and amino-terminal portion of the Rhizobium meliloti nifH gene. The coordinate regulation of mos and nif genes suggests that the mos locus plays a symbiotic role. We propose that the rhizopine enhances the survival of the bacterial partner in the symbiosis.

Bacterial Proteins↗
PubMed1991

The second amino acid of alfalfa mosaic virus coat protein is critical for coat protein-mediated protection.

Transgenic plants expressing the coat protein (CP) of alfalfa mosaic virus (AIMV) are resistant to infection by AIMV. A mutation was introduced into the second amino acid of the cDNA for the CP of AIMV. Three different transgenic tobacco lines expressing the mutant CP and two different transgenic tobacco lines expressing the wild-type CP at similar levels were challenged with AIMV virions and viral RNA. Whereas the lines expressing the wild-type CP were highly resistant to infection by AIMV virions and viral RNA, the lines expressing the mutant CP were susceptible to infection by both. The binding affinity of the mutant and the wild-type CPs for the 3' terminal protein binding site on AIMV RNAs was similar, as determined by electrophoretic mobility shift assay. A mixture of AIMV genomic RNAs 1-3 was infectious on the plants expressing the mutant CP but not on vector control plants or plants expressing the wild-type CP, indicating that the mutant CP can activate the AIMV genomic RNAs for infection. These results demonstrate that the second amino acid of the AIMV CP is critical for protection from AIMV but not for the initial interaction between the AIMV RNA and CP, suggesting that this initial interaction does not play a major role in CP-mediated protection.

Journal Article↗
PubMed1995

Oxygen as a key developmental regulator of Rhizobium meliloti N2-fixation gene expression within the alfalfa root nodule.

The symbiotic pattern of expression of Rhizobium meliloti N2-fixation genes is tightly coupled with the histological organization of the alfalfa root nodule and thus is under developmental control. N2-fixation gene expression is induced very sharply at a particular zone of the nodule called interzone II-III that precedes the zone where N2 fixation takes place. We show here that this coupling can be disrupted, hereby resulting in ectopic expression of N2-fixation genes in the prefixing zone II of the nodule. Uncoupling was obtained either by using a R. meliloti strain in which a mutation rendered N2-fixation gene expression constitutive with respect to oxygen in free-living bacterial cultures or by placing nodules induced by a wild-type R. meliloti strain in a microoxic environment. These results implicate oxygen as a key determinant of the symbiotic pattern of N2-fixation gene expression.

Aerobiosis↗
PubMed1996

Half tetrad analysis in alfalfa using multiple restriction fragment length polymorphism markers.

A maximum likelihood approach of half tetrad analysis (HTA) based on multiple restriction fragment length polymorphism (RFLP) markers was developed. This procedure estimates the relative frequencies of 2n gametes produced by mechanisms genetically equivalent to first division restitution (FDR) or second division restitution and simultaneously locates the centromere within a linkage group of RFLP marker loci. The method was applied to the diploid alfalfa clone PG-F9 (2n = 2x = 16) previously selected because of its high frequency of 2n egg production. HTA was based on four RFLP loci for which PG-F9 was heterozygous with codominant alleles that were absent in the tetraploid tester. Models including three linked and one unlinked RFLP loci were developed and tested. Results of the HTA showed that PG-F9 produced 6% FDR and 94% second division restitution 2n eggs. Information from a marker locus belonging to one linkage group was used to more precisely locate the centromere on a different linkage group. HTA, together with previous cytological analysis, indicated that in PG-F9, FDR 2n eggs are likely produced by diplospory, a mechanism common among apomictic species. The occurrence of FDR 2n eggs in plant species and their importance for crop evolution and breeding is discussed together with the potential applicability of multilocus HTA in the study of reproductive mutants.

Centromere↗
PubMed1996

A synthetic cryIC gene, encoding a Bacillus thuringiensis delta-endotoxin, confers Spodoptera resistance in alfalfa and tobacco.

Spodoptera species, representing widespread polyphagous insect pests, are resistant to Bacillus thuringiensis delta-endotoxins used thus far as insecticides in transgenic plants. Here we describe the chemical synthesis of a cryIC gene by a novel template directed ligation-PCR method. This simple and economical method to construct large synthetic genes can be used when routine resynthesis of genes is required. Chemically phosphorylated adjacent oligonucleotides of the gene to be synthesized are assembled and ligated on a single-stranded, partially homologous template derived from a wild-type gene (cryIC in our case) by a thermostable pfu DNA ligase using repeated cycles of melting, annealing, and ligation. The resulting synthetic DNA strands are selectively amplified by PCR with short specific flanking primers that are complementary only to the new synthetic DNA. Optimized expression of the synthetic cryIC gene in alfalfa and tobacco results in the production of 0.01-0.2% of total soluble proteins as CryIC toxin and provides protection against the Egyptian cotton leafworm (Spodoptera littoralis) and the beet armyworm (Spodoptera exigua). To facilitate selection and breeding of Spodoptera-resistant plants, the cryIC gene was linked to a pat gene, conferring resistance to the herbicide BASTA.

Amino Acid Sequence↗
PubMed1997

Expression of early nodulin genes in alfalfa mycorrhizae indicates that signal transduction pathways used in forming arbuscular mycorrhizae and Rhizobium-induced nodules may be conserved.

Transcripts for two genes expressed early in alfalfa nodule development (MsENOD40 and MsENOD2) are found in mycorrhizal roots, but not in noncolonized roots or in roots infected with the fungal pathogen Rhizoctonia solani. These same two early nodulin genes are expressed in uninoculated roots upon application of the cytokinin 6-benzylaminopurine. Correlated with the expression of the two early nodulin genes, we found that mycorrhizal roots contain higher levels of trans-zeatin riboside than nonmycorrhizal roots. These data suggest that there may be conservation of signal transduction pathways between the two symbioses-nitrogen-fixing nodules and phosphate-acquiring mycorrhizae.

Journal Article↗
PubMed1986

Fluorescence studies on the coat protein of alfalfa mosaic virus.

The intrinsic luminescence of different forms of the alfalfa mosaic virus (AMV) strain 425 coat protein has been studied, both statically and time resolved. It was found that the emission of the protein (Mr 24,250), which contains two tryptophans at positions 54 and 190 and four tyrosines, is completely dominated by tryptophan fluorescence. The high fluorescence quantum yield indicates that both tryptophans are emitting. Surprisingly, the fluorescence decay is found to be strictly exponential, with a lifetime of 5.1 nsec. Similar results were obtained for various other forms of the protein, i.e. the 30-S polymer, the mildly trypsinized forms of the protein lacking the N-terminal part and the protein assembled into viral particles. Virus particles and proteins of stains S and VRU gave similar results, as well as the VRU protein polymerised into tubular structures. The fluorescence decay is also monoexponential in the presence of various concentrations of the quenching molecules acrylamide and potassium iodide. Stern-Volmer plots were linear and yield for the coat protein dimer with acrylamide a quenching constant of 4.5* 10(8) M-1 sec-1. This indicates that the tryptophans are moderately accessible for acrylamide. For the 30-S polymer a somewhat smaller value was found, whereas in the viral Top a particles the accessibility of the tryptophans is still further reduced. From the decay of the polarisation anisotropy of the fluorescence of the coat protein dimer the rotational correlation time was obtained as 35 nsec. Since this roughly equals the expected rotational correlation time of the dimer as a whole, it suggests that the tryptophans are contained rigidly in the dimer. The results show that in the excited state of the protein the two tryptophans are strongly coupled and suggest that the trp-trp distance is smaller than 10 A. Because the coat protein occurs as a dimer, the coupling can be inter- or intramolecular. The implications for the viral structure are discussed.

Capsid↗
PubMed1994

Voluntary intake and digestibility by mature beef cattle and Holstein steer calves consuming alfalfa or orchardgrass hay supplemented with soybean oil and(or) corn.

Effects and interactions of corn and soybean oil supplementation and forage source on feed intake and digestibility by mature and growing cattle were determined. Eight mature beef cattle (571 +/- 17 kg initial body weight) were used in two simultaneous 4 x 4 Latin squares. Cattle in each square consumed long-stemmed alfalfa (AL; 16% crude protein, 54% neutral detergent fibre and 6.1% acid detergent lignin) or orchardgrass (OR; 11% crude protein, 71% neutral detergent fibre and 9.4% acid detergent lignin) hay ad libitum for 15 d followed by 6 d of restricted consumption (85% of ad libitum). Supplement treatments were Control, ground corn (C; 0.5% body weight), soybean oil (O; 0.125% body weight), or C + O. Total ad libitum dry matter (DM) intake was greater for AL than for OR (P < 0.05) and with than without C (P < 0.05), and a corn x soybean oil interaction occurred (P = 0.07; 11.8, 14.0, 13.6, 14.2, 8.4, 10.7, 9.3 and 10.3 kg/d); total tract neutral detergent fibre (NDF) digestibility was 66.0, 67.7, 65.8, 68.8, 52.5, 50.6, 55.1 and 59.4% for AL, AL - C, AL - O, AL - C + O, OR, OR - C, OR - O, and OR - C + O, respectively (SE 2.46). Eight Holstein steer calves (83 +/- 5 and 131 +/- 11 kg initial and final body weight, respectively) were subjected to the same dietary treatments, except for higher levels of C (1.0% body weight) and O (0.25% body weight) and periods with 21 d of ad libitum forage intake. Total DM intake was greater (P = 0.06) for AL than for OR, increased (P < 0.05) by C, and decreased (P < 0.05) by O (3.92, 4.17, 3.51, 4.00, 2.53, 2.90, 2.09 and 2.51 kg/d), and total tract NDF digestibility was affected by forage source (P < 0.05) and a corn x soybean oil interaction (P = 0.08; 58.8, 56.9, 60.1, 56.0, 41.9, 44.5, 45.8 and 40.1% for AL, AL - C, AL - O, AL - C + O, OR, OR - C, OR - O and OR - C + O, respectively). In conclusion, effects of supplementation with corn and (or) soybean oil on feed intake and digestibility were similar for AL and OR, which differed in voluntary intake and digestibility, and animal characteristics such as stage of maturity may have influenced effects of soybean oil on feed intake.

Aging↗
PubMed2002

In vivo characterization of the effects of abscisic acid and drying protocols associated with the acquisition of desiccation tolerance in alfalfa (Medicago sativa L.) somatic embryos.

Although somatic embryos of alfalfa (Medicago sativa L.) had acquired some tolerance to desiccation at the cotyledonary stage of development (22 d after plating), additional culturing in 20 microm abscisic acid (ABA) for 8 d induced greater desiccation tolerance, as determined by increased germination. Compared with fast drying, slow drying of the ABA-treated embryos improved desiccation tolerance. However, slow drying of non-ABA-treated embryos led to the complete loss of germination capacity, while some fast-dried embryos survived. An electron paramagnetic resonance spin probe technique and in vivo Fourier transform infrared microspectroscopy revealed that cellular membrane integrity and a-helical protein secondary structure were maintained during drying in embryos cultured in media enriched with 20 microM ABA, but not in embryos cultured in the absence of ABA. Slow-dried, non-ABA-treated embryos had low oligosaccharide to sucrose ratios, an increased proportion of beta-sheet protein secondary structures and broad membrane phase transitions extending over a temperature range of more than 60 degrees C, suggestive of irreversible phase separations. The spin probe study showed evidence of imbibitional damage, which could be alleviated by prehydration in humid air. These observations emphasize the importance of appropriate drying and prehydration protocols for the survival and storage of somatic embryos. It is suggested that ABA also plays a role in suppressing metabolism, thus increasing the level of desiccation tolerance; this is particularly evident under stressful conditions such as slow drying.

Abscisic Acid↗
PubMed1994

Second site mutations specifically suppress the Fix- phenotype of Rhizobium meliloti ndvF mutations on alfalfa: identification of a conditional ndvF-dependent mucoid colony phenotype.

Rhizobium meliloti mutants carrying ndvF insertion or deletion mutations induce nodules on alfalfa which contain very few infected cells and fail to fix N2 (Fix-). We have characterized five independent second site mutations (designated sfx) which completely suppress the Fix- phenotype of ndvF mutants on Medicago sativa but not on another R. meliloti host Melilotus alba. Genetic mapping and phenotypic analysis revealed that the suppressor mutations sfx-1, sfx-4 and sfx-5 mapped to a single locus which was distinct from another locus defined by the sfx-2 and sfx-3 mutations. Tn5-mob-mediated conjugal mapping experiments showed that the sfx-1 locus was located clockwise from trp-33 on the R. meliloti chromosome and a detailed cotransduction map of this region was generated. To clone the sfx-1 locus, we prepared a cosmid library from total DNA obtained from an sfx-1, ndvF deletion strain. From this library, a cosmid pTH56, which converted Fix- ndvF mutants to Fix+, was isolated. Southern blot analysis provided direct physical evidence that the insert DNA in plasmid pTH56 was contiguous with the sfx-1 region. On low osmolarity glutamate-yeast extract-mannitol-salts medium (GYM) agar medium, ndvF insertion and deletion mutants were found to have a mucoid colony phenotype, as opposed to the dry colony phenotype of the wild-type strain. This phenotype was shown to be dependent on the exoB and expE genes required for synthesis of exopolysaccharide II in R. meliloti but not to be dependent on genes required exclusively for the synthesis of the succinoglycan or exopolysaccharide I. Transduction of either sfx-1 or sfx-2 or transfer of the cosmid pTH56 into the ndvF mutants restored them to a wild-type dry colony phenotype. The mucoid phenotype is not responsible for the Fix- phenotype of ndvF mutants as the Fix-, ndvF exp double mutants can be complemented to Fix+ by introducing plasmids which carry only the wild-type ndvF genes.

Alleles↗
PubMed2001

Transgenic tobacco plants that overexpress alfalfa NADH-glutamate synthase have higher carbon and nitrogen content.

This work reports the characterization of transgenic tobacco (Nicotiana tabacum L.) plants that constitutively overexpress NADH-GOGAT. Three independent transformants, designated GOS10, GOS13 and GOS19 (for GOGAT sense), with stable integration of the chimeric alfalfa NADH-GOGAT gene fused to the CaMV 35S promoter were studied. The transgene was stably integrated and inherited by the progeny. In these GOS lines, the expression of NADH-GOGAT mRNA and protein was detected at low levels in roots and leaves, while the expression of the host tobacco NADH-GOGAT gene was nearly undetectable. The roots of GOS lines showed an elevated (15-40%) enzyme activity as compared to control plants. When GOS plants were grown under greenhouse conditions and fed with either nitrate or ammonium as the sole nitrogen source, they showed higher total carbon and nitrogen content in shoots and increased shoot dry weight when plants were entering into the flowering stage, as compared to control plants. The observed phenotype of GOS plants was interpreted as reflecting a higher capacity to assimilate nitrogen due to a higher NADH-GOGAT activity.

Amino Acid Oxidoreductases↗
PubMed2002

Linear amplification coupled with controlled extension as a means of probe amplification in a cDNA array and gene expression analysis during cold acclimation in alfalfa (Medicago sativa L.).

This study describes a rapid and simple way to amplify limited amounts of probes used for cDNA array hybridization while maintaining the original representation of transcripts in the samples. The approach is based on linear amplification of cDNA-coupled controlled extension of amplified products and yielded a 50-75-fold increases in hybridization signal intensity. Controlled extension of products is achieved either by adjusting the amplification conditions or by using a digested template. Linear amplification with controlled extension generates a population of fragments consisting mainly of 3'-end portions of original transcripts and ranging in length from 200 to 800 nucleotides. cDNA array analysis revealed that amplified and non-amplified probes generate expression profiles with correlations ranging from r=0.857 to 0.895. Up to 90% of cDNA clones, differentially expressed during cold acclimation in alfalfa, could be detected with both types of probes. This amplification method should increase the utility of cDNA arrays for identifying novel differentially expressed genes as well as expression profiling in specialized tissues or cells when the amount of analysed material is limited. The possibility of diminishing cross-hybridization of long genes sharing high sequence homology and improving the hybridization kinetics of complex probes after amplification is also discussed.

Acclimatization↗
PubMed1983

Quantitative studies of amino acid flow in the digestive tract of sheep fed alfalfa protein concentrates.

Mature wethers fitted with duodenal and ileal cannulae were fed isonitrogenous and isoenergetic diets containing alfalfa protein concentrate (APC) prepared by various methods. Amino acid concentrations in digesta at the proximal duodenum and distal ileum were influenced by processing method used for preparation of ACP (P less than 0.05). Amino acid pattern at the proximal duodenum was not affected by treatment. Methionine and lysine concentrations were lower in mixed bacteria isolated from the rumen of sheep fed APC prepared by anaerobic fermentation and spray dried when compared to other treatments. Apparent ruminal degradability of individual amino acid was influenced by method of preparation for APC (P less than 0.05). Bacteria contributed 55-74% of total amino acids flowing to the duodenum. Approximately 72% of the amino acids reaching the duodenum disappeared in the small intestine regardless of treatment. Amino acid pattern of residual proteins differed from respective dietary proteins. Results reveal that not all proteins entering the small intestine of ruminants are of equal quality.

Amino Acids↗
PubMed1987

Alfalfa saponins affect site and extent of nutrient digestion in ruminants.

Alfalfa saponins isolated by ethanol extraction and partial acid hydrolysis were intraruminally administered to sheep to investigate the biological activities and nutritional implications in ruminants. Mature wethers fitted with ruminal, duodenal and ileal cannulas were fed a concentrate or roughage diet formulated to be isonitrogenous and isoenergetic. Microbial fermentation and nutrient degradation in the rumen were reduced by saponins. Total protozoal count in the rumen was reduced 34 and 66% by saponins at levels of 2 and 4% dietary dry matter, respectively. Bacterial nitrogen flow to the duodenum was reduced 20 and 30% in the same sequence. Apparent digestion coefficients of organic matter, hemicellulose and cellulose in the total digestive tract were increased by saponins in sheep fed concentrate diets. Fractional digestion coefficients of organic matter, hemicellulose, cellulose and nitrogen were reduced in the stomach while they were increased in the small intestine by saponins in both diets. Saponins inhibited microbial fermentation and synthesis in the rumen and altered the sites of nutrient digestion in sheep.

Animal Feed↗
PubMed2003

Leghaemoglobin oxygenation gradients in alfalfa and yellow sweetclover nodules.

Respiration in support of N(2) fixation by rhizobia in legume root nodules depends on an adequate supply of O(2), but excessive O(2) can damage nitrogenase, the key enzyme. The movement of O(2) into and within the nodule is driven by gradients in the concentration of O(2) or in the oxygenation of the O(2)-carrier, leghaemoglobin. Steeper gradients may increase flux to the sites of respiration, but gradients also raise the possibility of inadequate O(2) in some nodule zones and excessive O(2) in others. No detailed study of O(2) gradients in the interior of nodules has been published previously. Spectral changes in leghaemoglobin with oxygenation, previously used to measure the average O(2) status of the nodule interior, were used to map longitudinal gradients in O(2) and in respiratory capacity in the elongated nodules of alfalfa (Medicago sativa L.) and sweetclover (Melilotus officinalis L.). Variability among nodules under air in the magnitude and direction of internal O(2) gradients was seen in both species. Despite consistently higher respiratory capacity near the meristematic tip, a majority of nodules had higher O(2) towards the tip than towards the base. These results contrast with a previous report, apparently based on limited data, but they are consistent with anatomical and tracer studies showing higher gas permeability near the tip.

Algorithms↗