Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genes, Developmental”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources
PubMed2004

Arrays of ultraconserved non-coding regions span the loci of key developmental genes in vertebrate genomes.

BACKGROUND: Evolutionarily conserved sequences within or adjoining orthologous genes often serve as critical cis-regulatory regions. Recent studies have identified long, non-coding genomic regions that are perfectly conserved between human and mouse, termed ultra-conserved regions (UCRs). Here, we focus on UCRs that cluster around genes involved in early vertebrate development; genes conserved over 450 million years of vertebrate evolution. RESULTS: Based on a high resolution detection procedure, our UCR set enables novel insights into vertebrate genome organization and regulation of developmentally important genes. We find that the genomic positions of deeply conserved UCRs are strongly associated with the locations of genes encoding key regulators of development, with particularly strong positional correlation to transcription factor-encoding genes. Of particular importance is the observation that most UCRs are clustered into arrays that span hundreds of kilobases around their presumptive target genes. Such a hallmark signature is present around several uncharacterized human genes predicted to encode developmentally important DNA-binding proteins. CONCLUSION: The genomic organization of UCRs, combined with previous findings, suggests that UCRs act as essential long-range modulators of gene expression. The exceptional sequence conservation and clustered structure suggests that UCR-mediated molecular events involve greater complexity than traditional DNA binding by transcription factors. The high-resolution UCR collection presented here provides a wealth of target sequences for future experimental studies to determine the nature of the biochemical mechanisms involved in the preservation of arrays of nearly identical non-coding sequences over the course of vertebrate evolution.

Animals↗
PubMed1997

Developmental gene expression of procollagen III in bovine extraembryonic membranes during early pregnancy.

A major secretory protein produced by bovine chorioallantoic membranes, in vitro, was previously identified as the carboxyl-propeptide of alpha-1 type III collagen. In the present study, the protein and gene expression of procollagen III by bovine chorioallantois between days 17 and 45 of pregnancy was investigated. In addition, differential usage of multiple transcription termination sites by chorioallantois was examined. Two-dimensional PAGE of proteins synthesized and released by whole conceptuses or isolated chorioallantoic membranes into culture medium demonstrated that the C-terminal of procollagen III was not detectable before day 21 of pregnancy and concentrations increased thereafter. Developmental gene expression was determined by Northern blot analysis using a probe (A) that preceded all five polyadenylation sites of the previously sequenced clone 9.22. Procollagen III mRNA expression was undetectable at day 17, low on day 20, and increased through day 36. Two major transcripts of 5.9 and 4.9 kb were identified, the latter of which was expressed more prominently. A second probe (B), which terminated between poly-A sites 2 and 3, was designed to identify transcripts that terminated at poly-A site 1 or 2. This probe bound to the 5.9-kb mRNA only. Two additional procollagen III cDNA clones were isolated from our bovine conceptus cDNA library and sequenced. One, designated 9.29, terminated at poly-A site 5. The other, designated 11.7, terminated at poly-A site 2, indicating that the bovine conceptus uses these stop sites in procollagen III transcription. Results from this study demonstrate that procollagen III gene and protein expression coincide with the development of the allantois, which progressively fuses with the chorion forming the chorioallantois placenta. In addition, multiple termination sites are used in procollagen III transcription.

Animals↗
PubMed2003

Analysis of fruE, a novel developmental gene of Myxococcus xanthus.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, a TnV insertion developmental mutation, Omega773, of M. xanthus was analyzed. The TnV Omega773 insertion was found to be located within a novel developmental gene, fruE. The FruE protein is composed of 140 amino acid residues and bears an N-terminal signal peptide. The amino acid sequence of FruE shared no significant similarity with any other known protein in the databases. The fruE mutant displayed a development-delayed phenotype. The formation of tightly aggregated mounds in the fruE mutant was slower than that in the wild-type strain. The initiation of spore production in the fruE mutant was delayed by 12 h in comparison to the wild-type strain, and the process of spore formation was more asynchronous than that of the wild-type strain. The transcription initiation sites of the fruE gene were located 81 bp (P1) and 57 bp (P2) upstream of the fruE initiation codon. Although both promoters were active during vegetative growth and development, the P1 promoter was more active during development and the P2 promoter was more active during vegetative growth. The expression of the fruE gene increased to a peak at 6 h poststarvation and then decreased. The decrease in fruE expression was not observed in the D and E signal mutants.

Amino Acid Sequence↗
PubMed2002

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Amino Acid Sequence↗
PubMed1996

Expression patterns of developmental genes reveal segment and parasegment organization of D. melanogaster genital discs.

We have used the expression patterns of genes known to be important during early Drosophila development to determine the segment-parasegment organization of the genital discs and to localize the three primordia in the male and female genital discs, engrailed (en) and hedgehog (hh) were used to locate posterior compartments in A8-A10, while cubitus interrupts (ci) localized the anterior compartments for each segment, decapentaplegic (dpp) identified the anterior cells that abut en and hh at the anterior-posterior border. abdominal-A (abd-A) identified the anterior compartment for abdominal segment 8 (aA8) in females but was not detected in the repressed female primordium in male discs. Abdominal-B (Abd-B) was expressed throughout the discs except for a small area along the edge of the posterior lobes, leaving open the possibility that A11 may contribute to the genital discs, caudal (cad) was expressed segmentally in the anal primordium of A10, extending through the Abd-B unstained region, wingless (wg) and gooseberry (gsb) may have assumed an added role in the discs perhaps providing proximal-distal cues. Models are presented to show how the segments and parasegments may fuse together during embryogenesis to form the mature male and female genital discs.

Animals↗
PubMed1995

Characterization of npf mutants identifying developmental genes in Physarum.

In Physarum polycephalum, uninucleate haploid amoebae develop into macroscopic multinucleate plasmodia. Wild-type, sexual development is triggered when two amoebae carrying different alleles of matA fuse to form a zygote which develops into a diploid plasmodium. Mutations in the matA genetic region give rise to apogamic strains in which a single haploid amoeba can develop into a haploid plasmodium. An essential stage in both sexual and apogamic plasmodium formation is an extended cell cycle in uninucleate cells, which ends with the formation of a binucleate cell by mitosis without cytokinesis. Using a 'brute force' screening method, we have isolated mutants blocked in apogamic plasmodium development. Genetic analysis showed that the mutations we have identified were unlinked to matA, unlike mutations previously identified following an enrichment step. Most of the loci revealed by our screen were represented by only one allele, indicating that further screening should lead to the identification of additional genes required for plasmodium development. Phenotypic analysis showed that different mutants were blocked at different stages of plasmodium formation. Some of the mutations blocking apogamic development at an early stage, close to the start of the long cell cycle, failed to block sexual development in zygotes homozygous for the mutation. Since the two modes of plasmodium formation differ only in the initiation of development, these mutations presumably interfere with the initiation process. In the remaining mutants, in which both sexual and apogamic development were blocked, development first became abnormal towards the end of the long cell cycle. This suggested that the wild-type gene products were required by this time and was consistent with previous evidence that many changes in cellular organization and gene expression occur during the long cell cycle. Each of these mutants showed a different terminal phenotype and some aspects of plasmodium development occurred normally although others were blocked, suggesting that development involves multiple pathways rather than a dependent sequence of events. Phenotypic analysis of double mutants supported this conclusion and also revealed epistatic interactions, presumably due to blocks in the same pathway. In several of the mutants, terminally differentiated cells died by an apoptosis-like mechanism; since this was never observed in vegetative cells, it was presumably triggered by the failure of development. Phenotypic analyses of additional mutants will extend our understanding of the pathways involved in plasmodium development.

Animals↗
PubMed1996

A compartmentalized regulator of developmental gene expression in Bacillus subtilis.

We have identified a new Bacillus subtilis gene, spoVT, whose gene product is homologous to the transcriptional regulator AbrB and serves as a regulator of E sigmaG-controlled gene expression. SpoVT acts both positively and negatively in controlling sigmaG-dependent gene expression, providing an additional level of refinement to forespore gene regulation and feedback control of spoIIIG expression.

Amino Acid Sequence↗
PubMed2003

Novel developmental genes, fruCD, of Myxococcus xanthus: involvement of a cell division protein in multicellular development.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development.

Amino Acid Sequence↗
PubMed1997

A developmental gene (Tolloid/BMP-1) is regulated in Aplysia neurons by treatments that induce long-term sensitization.

Long-term sensitization training, or procedures that mimic the training, produces long-term facilitation of sensory-motor neuron synapses in Aplysia. The long-term effects of these procedures require mRNA and protein synthesis (Montarolo et al., 1986; Castellucci et al., 1989). Using the techniques of differential display reverse transcription PCR (DDRT-PCR) and ribonuclease protection assays (RPA), we identified a cDNA whose mRNA level was increased significantly in sensory neurons by treatments of isolated pleural-pedal ganglia with serotonin for 1.5 hr or by long-term behavioral training of Aplysia. The effects of serotonin and behavioral training on this mRNA were mimicked by treatments that elevate cAMP. The aplysia mRNA increased by serotonin and behavioral training was 41-45% identical to a developmentally regulated gene family which includes Drosophila tolloid and human bone morphogenetic protein-1 (BMP-1). Both tolloid and BMP-1 encode metalloproteases that might activate TGF-beta (transforming growth factor beta)-like molecules or process procollagens. Aplysia tolloid/BMP-1-like protein (apTBL-1) might regulate the morphology and efficacy of synaptic connections between sensory and motor neurons, which are associated with long-term sensitization.

Amino Acid Sequence↗
PubMed2003

Variants of developmental genes (TGFA, TGFB3, and MSX1) and their associations with orofacial clefts: a case-parent triad analysis.

We selected 262 case-parent triads from a population-based study of orofacial clefts in Norway, and examined variants of developmental genes TGFA, TGFB3, and MSX1 in the etiology of orofacial clefts. One hundred seventy-four triads of cleft lip cases (CL+/-P) and 88 triads of cleft palate only cases (CPO) were analyzed. There was little evidence for an association of any of these genes with CL+/-P. The strongest association was a 1.7-fold risk with two copies of the TGFB3-CA variant (95% CI=0.9-3.0). Among CPO cases, there was a 3-fold risk with two copies of the TGFA TaqI A2 allele, and no increase with one copy. Assuming this to be a recessive effect, we estimated a 3.2-fold risk among babies homozygous for the variant (95% CI=1.1-9.2). Furthermore, there was strong evidence of gene-gene interaction. While there was only a weak association of the MSX1-CA variant with CPO, the risk was 9.7-fold (95% CI=2.9-32) among children homozygous for both the MSX1-CA A4 allele and the TGFA A2 allele. No association of CPO with the TGFA variant was seen among the other MSX1-CA genotypes. In conclusion, no strong associations were found between CL+/-P and variants at these three genes. There was a possible recessive effect of the TGFA TaqI variant on the risk of CPO, with a 3-fold risk among children homozygous for the variant. The effect of this TGFA genotype was even stronger among children homozygous for the MSX1-CA A4 allele, raising the possibility of interaction between these two genes.

Adult↗
PubMed2005

Midkine, a newly discovered regulator of the renin-angiotensin pathway in mouse aorta: significance of the pleiotrophin/midkine developmental gene family in angiotensin II signaling.

We previously demonstrated that pleiotrophin (PTN the protein, Ptn the gene) highly regulates the levels of expression of the genes encoding the proteins of the renin-angiotensin pathway in mouse aorta. We now demonstrate that the levels of expression of these same genes are significantly regulated in mouse aorta by the PTN family member midkine (MK the protein, Mk the gene); a 3-fold increase in expression of renin, an 82-fold increase in angiotensinogen, a 6-fold decrease in the angiotensin converting enzyme, and a 6.5-fold increase in the angiotensin II type 1 and a 9-fold increase in the angiotensin II type 2 receptor mRNAs were found in Mk-/- mouse aorta in comparison with the wild type (WT, +/+). The results in Mk-/- mice are remarkably similar to those previously reported in Ptn-/- mouse aorta, with the single exception of that the levels of the angiotensinogen gene expression in Ptn-/- mice are equal to those in WT+/+ mouse aorta, and thus, in contrast to Mk gene expression unaffected by levels of Ptn gene expression. The data indicate that MK and PTN share striking but not complete functional redundancy. These data support potentially high levels importance of MK and the MK/PTN developmental gene family in downstream signals initiated by angiotensin II either in development or in the many pathological conditions in which MK expression levels are increased, such as atherosclerosis and many human neoplasms that acquire constitutive endogenous Mk gene expression by mutation during tumor progression and potentially provide a target through the renin-angiotensin pathway to treat advanced malignancies.

Angiotensin II↗
PubMed1987

Cloning of genes developmentally regulated during plant embryogenesis.

Genes specifically induced during somatic embryogenesis may play key roles in plant embryo development. An antiserum against an extract of carrot somatic embryos revealed a few rare antigens induced at the onset of embryogenesis. Through differential immunoadsorption techniques, we purified antibodies against the embryo-specific antigens and probed a phage lambda gt11 library of cDNA from carrot somatic embryos. This paper describes three distinct cDNA clones that hybridize to embryo-specific RNAs. Monospecific antibodies, purified by affinity to the recombinant phage fusion proteins, confirm that the cloned cDNAs encode unique embryo-specific peptide antigens. One 50-kDa protein correlates with embryogenic ability in cultures of other plant species, including cereals.

Journal Article↗
PubMed2005

Characterization and developmental gene regulation of a large gene family encoding amastin surface proteins in Leishmania spp.

The ability of Leishmania amastigotes to survive within the drastic environmental changes encountered in the phagolysosomes of mammalian macrophages is heavily dependent on the developmental regulation of a variety of genes. The identification of genes that are expressed preferentially in the mammalian stage of the parasite should increase our understanding of the molecular mechanisms regulating stage-specific gene expression and of the determinants that control its intracellular survival and contribute to its pathogenesis. We report here detailed sequence characterization and structural organization of the amastin gene family in Leishmania major and Leishmania infantum and the study of their developmental gene regulation throughout the parasite's life cycle. Amastin surface proteins represent the largest developmentally regulated gene family reported so far in Leishmania comprising up to 45 members. All the members of the amastin gene family in both Leishmania and Trypanosoma species share a similar structural organization and contain a highly conserved 11 amino acid extracellular domain, which is unique to amastin proteins. The majority of the amastin gene homologs are specifically expressed in the amastigote stage of the parasite. Three distinct RNA elements were identified in the 3'-untranslated regions (3'UTR) of the amastin transcripts. The majority of these transcripts contain a conserved 450 nt cis-acting 3'UTR element shown previously to regulate stage-specific gene expression at the level of translation, which suggests that several amastin homologs may be regulated by a similar mechanism of translational control inside the macrophage. These findings further highlight the unique features of gene expression control in Leishmania.

3' Untranslated Regions↗
PubMed2006

Prevalence of mutations in renal developmental genes in children with renal hypodysplasia: results of the ESCAPE study.

Renal hypodysplasia (RHD) is characterized by a reduced nephron number, small kidney size, and disorganized renal tissue. A hereditary basis has been established for a subset of affected patients, suggesting a major role of developmental genes that are involved in early kidney organogenesis. Gene mutations that have dominant inheritance and cause RHD, urinary tract anomalies, and defined extrarenal symptoms have been identified in TCF2 (renal cysts and diabetes syndrome), PAX2 (renal-coloboma syndrome), EYA1 and SIX1 (branchio-oto-renal syndrome), and SALL1 (Townes-Brocks syndrome). For estimation of the prevalence of these events, an unselected cohort of 99 unrelated patients with RHD that was associated with chronic renal insufficiency were screened for mutations in TCF2, PAX2, EYA1, SIX1, and SALL1. Mutations or variants in the genes of interest were detected in 17 (17%) unrelated families: One mutation, two variants, and four deletions of TCF2 in eight unrelated patients; four different PAX2 mutations in six families; one EYA1 mutation and one deletion in two patients with branchio-oto-renal syndrome; and one SALL1 mutation in a patient with isolated RHD. Of a total of 27 patients with renal cysts, six (22%) carried a mutation in TCF2. It is interesting that a SIX1 sequence variant was identified in two siblings with renal-coloboma syndrome as a result of a PAX2 mutation, suggesting an oligogenic inheritance. Careful clinical reevaluation that focused on discrete extrarenal symptoms and thorough family analysis revealed syndrome-specific features in nine of the 17 patients. In conclusion, 15% of patients with RHD show mutations in TCF2 or PAX2, whereas abnormalities in EYA1, SALL1, and SIX1 are less frequent.

Adolescent↗
PubMed1998

[The gene of Gorlin's syndrome (basocellular nevomatosis) and the revival of the developmental genes in human carcinogenesis].

Interaction between developmental biology and human pathology has brought new insight on basal cell carcinoma oncogenesis. Alterations of the Patched gene appear to be responsible for the Gorlin syndrome and to be detected in 50% of the sporadic basal cell carcinomas. This relation has recently been extended to all the components of the Hedgehog signalling pathway.

Basal Cell Nevus Syndrome↗
PubMed1976

Activation of developmental genes in neoplastic transformation.

The view is advanced that it is important to fix the stage of development corresponding to the pattern of expression of oncodevelopmental proteins in neoplastic transformation and neoplasia. From a map of development focused on events beginning with the zygote and ending with the establishment of fetus and placenta, it is possible to explain why certain developmental gene products are restricted to fetus or placenta or distributed in both. It also suggests which products can be expected to be expressed concordantly in neoplastic transformation and in neoplasia.

Alkaline Phosphatase↗
PubMed2003

Genomic characterization of a repetitive motif strongly associated with developmental genes in Drosophila.

BACKGROUND: Non-coding DNA represents a high proportion of all metazoan genomes. Although an undetermined fraction of this DNA may be considered devoid of any function, it also contains important information residing in specific cis-regulatory sequences. RESULTS: We report a 27 bp motif that is overrepresented within the fly genome. This motif does not show any significant similarity with transposon sequences and is strongly associated with genes involved in development and/or signal transduction. The 27 bp motif is preferentially located within introns, and has a tendency to be present in multiple copies around genes. Furthermore, it is often found embedded in known non-coding regulatory regions. The regulatory network defined by this motif is partially shared in D. pseudoobscura. CONCLUSION: We have identified a 27 bp cis-regulatory sequence widely distributed within the Drosophila genome in association with developmental genes. This motif may be very useful towards the annotation of functional regulatory regions within the Drosophila genome and the construction of regulatory networks of Drosophila development.

Animals↗
PubMed1992

Expression of early developmental genes in Dictyostelium discoideum is initiated during exponential growth by an autocrine-dependent mechanism.

Throughout growth, Dictyostelium cells continuously produce an autocrine factor, PSF, that accumulates in proportion to cell density. Production of PSF declines rapidly when cells are shifted to starvation conditions, and the properties of PSF are distinct from those of regulatory factors produced by starving cells. During late exponential growth, PSF induces expression of several early developmental genes, including those for proteins important in cAMP signaling and cell aggregation. Examples are the aggregation stage cAMP receptor (cAR1), the aggregation-specific form of cyclic nucleotide phosphodiesterase, and gp24 (contact sites B). Through PSF, growing cells detect environmental conditions (cell number high, food approaching depletion) that are appropriate for production of the gene products needed to initiate aggregation and development.

Animals↗