Information access. Building a "GenBank" of the published literature.
Explore the source record for details and available documents.
SEARCH · Search PubMed
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Global gene-expression analysis is carried out using different technologies that are either array- or sequence-tag-based. To compare experiments that are performed on these different platforms, array probes and sequence tags need to be linked. An additional challenge is cross-referencing between species, to compare human profiles with those obtained in a mouse model, for example. We have developed the web-based search engine GeneHopper to link different expression resources based on UniGene clusters and HomoloGene orthologs databases of the National Center for Biotechnology Information (NCBI).
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Traditional ways of identifying slow growing bacteria is slow and often difficult. In this study, a small, Gram-negative, facultative anaerobic, slow growing bacillus was isolated from the blood culture of a 7-year old traffic accident victim. The bacterium was non-hemolytic, catalase and oxidase positive. An attempt to use the Vitek system (GNI+) and the API system (20NE) to identify the strain was unsuccessful as the growth controls showed negative results. 16S ribosomal RNA gene sequencing showed that there was 1 base difference between the isolate and Arcobacter cryaerophilus (GenBank Accession no. U25805), 1 base difference between the isolate and A. cryaerophilus (GenBank Accession no. U34387), 10 base differences between the isolate and A. cryaerophilus (GenBank Accession no. L14624), 34 base differences between the isolate and A. butzleri (GenBank Accession no. U34386), 34 base differences between the isolate and A. butzleri (GenBank Accession no. U34387), and 38 base differences between the isolate and A. butzleri (GenBank Accession no. L14626), indicating that the isolate most closely resembled a strain of A. cryaerophilus. Identification of the isolate in our case by conventional methods was difficult, as the absence of a curved morphology has made it confused with other Gram-negative non-fermentative bacteria, and the slow growth rate has made it unidentifiable by both the Vitek and API systems. Although the exact source of infection and route of transmission in our case remains elusive, we speculate that the bacteria were transmitted through the respiratory tract while the boy was suffocated in the mud. The present report represents an example of showing the usefulness of 16S rRNA gene sequencing for identification of slow growing bacteria.
Small Tail Han sheep is an excellent local sheep breed in China. Small Tail Han sheep has significant characteristics of high prolificacy. The lambing percentage averaged 260 percent in Small Tail Han sheep. The genetic detection of 4 microsatellite loci OarAE101, OarHH35, BM143 and BMS2508 which were closely linked to the fecundity gene FecB in Booroola sheep was conducted in 159 sheep in Small Tail Han sheep, Dorset sheep, F1 hybzids(Dorset x Small Tail Han sheep). The results confirmed the genetic characteristics of codominance of microsatellite DNA. The PCR amplified products of microsatellites were detected by non-denatured (natural) polyacrylamide gel electrophoresis. The sequences of PCR amplification fragment of 6 clones of 4 microsatellite loci in Small Tail Han sheep were accepted by GenBank of National Center for Biotechnology Information, National Institutes of Health in USA, the GenBank accession numbers were AF394445, AF394446, AF394447, AF394448, AF394449, AF394450, respectively. The sequence homogeneity between OarAE101 in Small Tail Han sheep in this study and the ovine OarAE101 in GenBank was 98 percent. The sequence homogeneity between OarHH35 in Small Tail Han sheep in this study and the ovine OarHH35 in GenBank was 99 percent. The sequence homogeneity between BM143 in Small Tail Han sheep in this study and the bovine BM143 in GenBank was 95 percent. The sequence homogeneity between BMS2508 in Small Tail Han sheep in this study and the bovine BMS2508 in GenBank was 95 percent. OarAE101, OarHH35, BM143 and BMS2508 in Small Tail Han sheep were all perfect microsatellites. These results could provide molecular basic data for the research on the germplasm characteristics of Small Tail Han sheep.
Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.
Vascular endothelial growth factor (VEGF) is a key regulator for placental angiogenesis and vascular functions via activating two high affinity tyrosine-kinase receptors, VEGF receptor-1 (VEGFR-1) and -2 (VEGFR-2). Recently, a specific VEGF165 receptor, neuropilin-1 (NP-1), was also identified in endothelial cells and upon VEGF binding, NP-1, synergistically with VEGFR-2, enhances VEGF-induced cell proliferation and migration. To evaluate the role of VEGF and NP-1 in regulating fetoplacental angiogenesis and endothelial function, an ovine fetal placental artery endothelial (OFPAE) cell line was established. In this study, an OFPAE cell cDNA library was constructed. Two positive clones for VEGF and one for NP-1 were isolated from the OFPAE cell cDNA library, and their partial 3' sequences were identified. The sequence of VEGF cDNA insert had 98% homology to the reported ovine VEGF (GenBank accesssion # X89506). The partial NP-1 cDNA sequence included a portion of the protein coding region and a complete 3' untranslated region (UTR), and had 90% homology to human NP-1 (GenBank accession # AF016050). The predicted amino acid sequence of ovine NP-1 was 97-98% identical to human (GenBank accession # AAC12921.1), mouse (GenBank accession # NP_032763), and rat (GenBank accession # AAC53345.1) NP-1. Two CU-rich stabilizing and two consensus destabilizing elements 5'-AUUUA-3' were identified in the 3' UTR of ovine NP-1 cDNA sequence. These elements are the potential binding sites for mRNA-binding proteins which may regulate the stability of NP-1 mRNA. Expression of VEGF and NP-1 in OFPAE cells and fetal placentas was confirmed by Northern and Western blot analyses. Using PCR analysis, we also identified partial sequences of multiple VEGF isoforms (VEGF188, 183, 164, and 120) as well as VEGFR-1, VEGFR-2, and neuropilin-2 (NP-2) from the OFPAE cell cDNA library. These results indicate that multiple isoforms of VEGF are expressed in OFPAE cells. Moreover, we also identified, for the first time, a complete 3' UTR of NP-1 cDNA in any species. Together with expression of VEGF and VEGF receptors in OFPAE cells, we propose that there is an autocrine mechanism by which VEGF regulates fetal placental angiogenesis and other functions of endothelial cells.
A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance.
Random sequencing of cDNA and genomic libraries has been used to study the genome of the hyperthermophile Thermotoga maritima. To date, 175 unique clones have been analyzed by comparing short sequence tags with known proteins in the PIR and GenBank databases. We find that a significant proportion of sequences can be matched to previously identified protein from non-Thermotoga sources. A high match rate was obtained from an oligo(dT)-primed cDNA library, where one-third of all unique sequences analyzed (21/65) shared high amino acid sequence similarity with proteins in the PIR and GenBank databases. Also, approximately one-third of the unique sequences from a second cDNA library (28/89), constructed with random oligo primers, could be matched to sequences in PIR and GenBank. Identification of genes from the oligo(dT)-primed cDNA library indicates that some Thermotoga mRNAs are polyadenylated. Genes have also been identified from a 1 to 2 kb genomic DNA library. Here, (3/21) of genomic sequences analyzed could be matched to protein in PIR and GenBank. One of the genomic clones had high sequence similarity to the tryptophan synthesis gene anthranilate synthase component I (trpE). Using this sequence tag, the Thermotoga trp operon was isolated and sequenced. The Thermotoga maritima trp operon is arranged with trpE forming an overlapping transcript with a second protein consisting of a fusion of anthranilate synthase component II (trpG) and anthranilate phosphoribosyltransferse (trpD). With regard to the fusion, the operon organization is similar to Escherichia coli and Salmonella typhimurium, but lacks the classic attenuation system of enteric bacteria. Amino acid sequence comparison with 19 trpE, 18 trpG and 14 trpD genes from other organisms suggest that the Thermotoga trp genes resemble corresponding genes from other thermophiles more closely than expected.
A critical feature in the pathogenesis of the respiratory pathogen Histoplasma capsulatum is the conversion from the mold form (found in soil) to the yeast form in the lungs of the host. Little is known about the molecular biology of Histoplasma dimorphism. In particular, the possible roles of genes which are transcriptionally silent in yeast (i.e. mold-specific) have not been studied. We have produced a cDNA library highly enriched for mold-upregulated clones by fragmenting cDNA and removing yeast-specific and common sequences with a highly efficient enzyme degrading subtraction method. Screening of randomly selected clones identified cDNA fragments representing 16 different mold-upregulated genes. Because multiple cDNA fragments can be treated as alleles in a genetic screen, we were able to apply probability analysis to estimate the total number of mold-upregulated genes. We estimate that there are 27 upregulated genes; cDNA fragments of 16 have been isolated. Here we report the first isolation and analysis of cDNA from two mold-specific genes, MS8 (GenBank AF292398) and MS88 (GenBank AF357882). The MS8 transcript was very strongly expressed in mold but not detected on Northern blots with yeast RNA. The putative MS8 protein was predicted to be 21.3 kDa (203 aa), very rich in glutamine and glycine and had a calculated pI of 6.76. The MS88 transcript was weakly expressed in mold and not detected in yeast. The putative MS88 protein was predicted to be 22.5 kDa (219 aa) with a pI of 4.46. GenBank similarity searches revealed that the putative MS8 protein was similar to a glutamine-rich protein, of unknown function, from the fungus Colletotrichum gloeosporioides (GenBank U94186). No significant matches were found for the putative MS88 protein.
The physiological regulation of food intake is a critical factor in both the rate at which an animal grows and its reproductive activity. Recently, progress has been made in elucidating a complex system in which insulin, leptin, and neuropeptide Y function to monitor an animal's energy balance and regulate feed intake and fertility. RNA was extracted from ovine hypothalamic, anterior pituitary, pancreas, and adipose tissue. Using the reverse transcription-polymerase chain reaction. cDNAs were cloned and sequenced for leptin (350 base pairs [bp], GenBank accession number U62123 and 441 bp, GenBank accession number U84247), NPY-Y1 receptor (350 bp, GenBank accession no. U62122) and NPY-Y2 receptor (440 bp, GenBank accession no. U83458). Probes generated from these clones were used to detect mRNA expression within tissues thought to be involved in the coregulation of feed intake and reproduction. Leptin was found to be expressed in sheep adipose tissue. The ovine NPY-Y1 receptor mRNA was detected within the arcuate nucleus and paraventricular nucleus of the hypothalamus, the dentate gyrus of the hippocampus and in pancreatic, anterior pituitary, and adipose tissues. Expression of ovine NPY-Y2 receptor mRNA was detected in the hippocampus and within pancreatic tissue. These observations provide evidence of potential mechanisms that exist for mediating communication between peripheral and central tissues within the insulin-leptin-NPY pathway.
Prestin, the fifth member of the anion transporter family SLC26, is the outer hair cell molecular motor thought to be responsible for active mechanical amplification in the mammalian cochlea. Active amplification is present in a variety of other auditory systems, yet the prevailing view is that prestin is a motor molecule unique to mammalian ears. Here we identify prestin-related SLC26 proteins that are expressed in the auditory organs of nonmammalian vertebrates and insects. Sequence comparisons revealed the presence of SLC26 proteins in fish (Danio, GenBank accession no. AY278118, and Anguilla, GenBank accession no. BAC16761), mosquitoes (Anopheles, GenBank accession nos. EAA07232 and EAA07052), and flies (Drosophila, GenBank accession no. AAF49285). The fly and zebrafish homologues were cloned and, by using in situ hybridization, shown to be expressed in the auditory organs. In mosquitoes, in turn, the expression of prestin homologues was demonstrated for the auditory organ by using highly specific riboprobes against rat prestin. We conclude that prestin-related SLC26 proteins are widespread, possibly ancestral, constituents of auditory organs and are likely to serve salient roles in mammals and across taxa.