Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Direct RNA sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources
PubMed1978

The attenuator of the tryptophan operon in E.coli: rho-mediated release of RNA polymerase from a transcription termination complex in vitro.

In vivo, termination of transcription at the attenuator site of the tryptophan (trp) operon of E. coli is influenced by the protein termination factor rho. In vitro, termination does not depend on rho factor, and is very efficient in a purified system consisting only of RNA polymerase, the DNA template, nucleoside triphosphates, and buffer. The extent of termination in this system is unaffected over a wide range of salt and nucleoside triphosphate concentration. However, there is a 10-fold stimulation of trp leader mRNA synthesis if rho factor is present during the transcription reaction. This stimulation occurs only at low molar ratios of polymerase to template, and can be blocked by rifampicin. It is thus most likely due to the recycling of RNA polymerase molecules that have been released from the attenuator site by rho factor. In fact, transcription of the trp leader region in vitro results in the fomration of a stable termination complex which can be observed on sucrose gradients or by binding to nitrocellulose filters. These data indicate that a major function of rho at the trp attenuator is to release completed transcripts from a pre-formed termination complex, rather than to cause the cessation of elongation.

Base Sequence↗
PubMed1978

DNA sequences of promoter regions for the str and spc ribosomal protein operons in E. coli.

The DNA sequences have been determined for promoter regions of two ribosomal protein operons in E. coli, the str operon and the spc operon. The site of in vitro transcription initiation within each of these promoter regions has been determined. The start site of the str operon occurs 69 bases upstream from the initiation codon of the S12 gene. The start site of the spc operon occurs 72 bases upstream from the L14 gene, and only 91 bases downstream from the termination codon of the S17 gene (which is in the preceding S10 operon). Both promoters are similar to other sequenced promoters in that they each have an identifiable "Pribnow box" sequence 5 bases upstream from the transcription start site. The spc promoter has a long sequence of 2 fold symmetry centered within the Pribnow box; the str promoter has a shorter but similar symmetry. At positions -69 through -40 in the spc operon, another long region of symmetry is present which may be the termination signal of the preceding S10 operon. Extensive sequence similarity between the str and spc promoter regions is found downstream from the Pribnow box-that is, in a transcribed region preceding the translation start sites.

Bacterial Proteins↗
PubMed1992

Beta-L-thymidine 5'-triphosphate analogs as DNA polymerase substrates.

beta-L-3'-Deoxythymidine 5'-triphosphate (L-ddTTP) and beta-L-3'-deoxy-2',3'-didehydrothymidine 5'-triphosphate (L-d4TTP) were substrates for human immunodeficiency virus reverse transcriptase, Escherichia coli DNA polymerase I (Klenow), and Sequenase (modified T7 DNA polymerase). The beta-D- and beta-L-enantiomers of 5-methyluridine 5'-triphosphate (rTTP) were inhibitors but not substrates of reverse transcriptase. The steady-state Km values for L-ddTTP and L-d4TTP, with all three enzymes, were 12-70-fold larger than the Km values for the corresponding D-enantiomers. The Km value of reverse transcriptase for L-ddTTP was 50-fold larger than that for D-ddTTP because the Kd for L-ddTTP was 5-fold larger than that for D-ddTTP, and the first-order rate constant for incorporation of L-ddTMP into the template-primer was 10% that of the D-enantiomer. The D- and L-enantiomers had kcat values with reverse transcriptase and Sequenase that were similar to kcat for the natural substrate, thymidine 5'-triphosphate (dTTP). Thus, the rate determining step appeared to be dissociation of the enzyme-chain-terminated template-primer complex. In contrast, kcat values for the L-enantiomers with Klenow were only 0.1% that of dTTP, and the kcat values for the D-enantiomers were 15% the kcat for dTTP. The reduced kcat values were due to a change in rate determining step from dissociation of the Klenow-chain-terminated template-primer complex to an earlier step in the reaction mechanism, presumably catalysis. Thus, these DNA polymerases did not stereospecifically recognize D-nucleoside 5'-triphosphate analogs as substrates.

Bacteriophage T7↗
PubMed1977

Terminally repeated sequences in the avian sarcoma virus RNA genome.

The initiation of DNA synthesis in vitro by RNA-directed DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase, EC 2.7.7.7) of avian oncornaviruses requires a tRNAtrp primer molecule located close to the 5' end of the viral RNA genome. DNA transcripts, 100 nucleotides in length, initiated on the tRNAtrp primer molecule contain nucleotide sequences complementary to a large (25 nucleotides) RNase T1 oligonucleotide, T-13, located at the 5' terminus of the avian sarcoma virus RNA genome. tRNAtrp-initiated DNA transcripts with a length of about 70 nucleotides contain substantially fewer nucleotide sequences complementary to this 5'-terminal oligonucleotide, suggesting that the tRNAtrp primer associated with the avian sarcoma virus RNA is located approximately 100 nucleotides from the 5' end of the RNA. In addition, we present evidence to demonstrate that DNA transcribed from avian sarcoma virus RNA sequences located at the 3' end, immediately adjacent to the poly(A), contains nucleotide sequences that are complementary to the 5'-terminal T1 oligonucleotide T-13. These data indicate that the 5' end of the viral genome contains nucleotide sequences that are repeated at the 3' end of the genome. We conclude that the avian oncornavirus RNA genome is terminally redundant.

Avian Sarcoma Viruses↗
PubMed1979

An MSV-specific subgenomic mRNA in MSV-transformed G8-124 cells.

An intracellular subgenomic RNA species from MSV-transformed G8-124 cells was characterized by electron microscopy of RNA:cDNA heteroduplexes using long cDNAs both MSV and MuLV. This subgenomic RNA, 3.1 kb long, consisted of 5'-derived sequences of about 0.4 kb joined to 2.7 kb of RNA derived from the 3' end of the RNA genome. The 3'-derived sequences included the residual sequences from the MuLV pol region and the acquired cellular sequences of MSV. The genome of MSV was shown to retain approximately 0.13 kb from the 5' end of the MuLV env region, including sequences which span the point in the MuLV env mRNA. No subgenomic MSV RNA could be detected, however, which consisted of a 5'-derived leader sequence spliced to the retained env region sequences. Nor could a subgenomic MSV RNA be detected in which a 5'-derived leader sequence was joined directly to the acquired cellular sequences. Although its translation products are unknown, the subgenomic MSV RNA was present in preparations of poly(A)+ polysomal RNA, consistent with this RNA functioning as a messenger. The structure of this 3.1 kb MSV subgenomic RNA suggests a possible role in the expression of 3'-encoded MSV information, possibly including transformation-specific sequences.

Cell Transformation, Viral↗
PubMed2026

YAP Promotes Microtubule Growth to Facilitate Sarcomere Disassembly in Adult Cardiomyocytes.

BACKGROUND: Mature mammalian cardiomyocytes (CMs) develop compact sarcomeric structures that inhibit proliferation. Consequently, CMs must dedifferentiate to a fetus-like state, which is accompanied by sarcomere disassembly, to enable successful cytokinesis. However, the regulation and coordination of CM dedifferentiation, cell cycle progression, and sarcomere reorganization remain unclear. METHODS: We generated adenovirus and adeno-associated virus (MyoAAV) vectors expressing YAP5SA and YAP5SA-S94A under Xon control for LMI070-inducible protein expression. We also developed MyoAAV-cTnT-Tuba1b-shRNA-miR30 for cardiomyocyte-specific knockdown of Tuba1b. These tools were used to investigate CM dedifferentiation and proliferation and sarcomere disassembly. We also performed Cleavage Under Targets and Release Using Nuclease to map the genome-wide binding sites of YAP5SA and YAP5SA-S94A in combination with RNA sequencing to identify YAP target genes. In addition, time-course live-imaging analysis was used to evaluate microtubule and sarcomere dynamics in adult CMs. RESULTS: We show that microtubule expression and network density decline with cardiac maturation. Overexpression of YAP5SA, a constitutively active YAP mutant, promotes microtubule growth by stabilizing microtubule dynamics, leading to CM dedifferentiation, cell cycle re-entry, and sarcomere disassembly. In contrast, colchicine blocks these processes and significantly attenuates YAP-induced cardiac regeneration. Live imaging reveals a distinct mode of sarcomere disassembly driven by enhanced microtubule polymerization, wherein microtubule plus-ends directly interact with α-actinin and displace α-actinin fragments, thereby facilitating sarcomere breakdown. Furthermore, the YAP5SA-S94A mutation, which disrupts the YAP and TEA domain interaction, significantly reduces YAP5SA-induced microtubule growth, sarcomere disassembly, and cell cycle activity. Mechanistically, cleavage under targets and release using nuclease combined with RNA sequencing identified direct YAP targets, including Ajuba and Tuba1b, which are critical for microtubule growth. CM-specific knockdown of Tuba1b attenuates YAP-driven sarcomere disassembly. CONCLUSIONS: These findings identify microtubule networks as an essential regulator modulating CM dedifferentiation and sarcomere reorganization, which is critical for CM cytokinesis and cardiac regenerative repair.

Animals↗
PubMed2008

Isolation and characterization of Plasmodium falciparum UAP56 homolog: evidence for the coupling of RNA binding and splicing activity by site-directed mutations.

UAP56 (U2AF65 associated protein) is a member of the DEAD-box helicase family. Helicases are essential enzymes generally involved in the metabolism of nucleic acids. The gene encoding a member of DEAD-box family was cloned and characterized from the human malaria parasite Plasmodium falciparum. PfU52 is homologous to UAP56 and contains the RNA-dependent ATPase, RNA helicase and RNA binding activities. Using the parasite extract we report that PfU52 is involved in splicing reaction. Site-directed mutagenesis studies indicate that the conserved residues glycine 181, isoleucine 182 and arginine 206 are involved in RNA binding and this activity is required for the enzymatic activities of PfU52. PfU52 is expressed in all the intraerythrocytic developmental stages of the parasite. In the present study we have reported the detailed characterization of PfU52 from P. falciparum and these results advance the knowledge regarding the function of UAP56 in general.

Adenosine Triphosphatases↗
PubMed1992

Recognition of the high affinity binding site in rev-response element RNA by the human immunodeficiency virus type-1 rev protein.

The Human Immunodeficiency Virus type-1 rev protein binds with high affinity to a bubble structure located within the rev-response element (RRE) RNA in stemloop II. After this initial interaction, additional rev molecules bind to the RRE RNA in an ordered assembly process which requires a functional bubble structure, since mutations in the bubble sequence that reduce rev affinity block multiple complex formation. We have used synthetic chemistry to characterize the interaction between rev protein and its high affinity binding site. A minimal synthetic duplex RNA (RBC6) carrying the bubble and 12 flanking base pairs is able to bind rev with 1 to 1 stoichiometry and with high affinity. When the bubble structure is inserted into synthetic RNA molecules carrying longer stretches of flanking double-stranded RNA, rev forms additional complexes resembling the multimers observed with the RRE RNA. The ability of rev to bind to RBC6 analogues containing functional group modifications on base and sugar moieties of nucleoside residues was also examined. The results provide strong evidence that the bubble structure contains specific configurations of non-Watson--Crick G:G and G:A base pairs and suggest that high affinity recognition of RRE RNA by rev requires hydrogen bonding to functional groups in the major groove of a distorted RNA structure.

Bacteriophage T7↗
PubMed1992

Mutational analysis of the major homology region of Mason-Pfizer monkey virus by use of saturation mutagenesis.

The major capsid (CA) protein of retroviruses possesses a stretch of 20 amino acids, called the major homology region (MHR), which is evolutionarily conserved and invariant in location within the primary sequence of the protein. The function of this region was investigated by examining the effect of random single-amino-acid substitutions within the central 13 positions of the MHR on the life cycle of Mason-Pfizer monkey virus (M-PMV), an immunosuppressive D-type retrovirus. When these mutants were subcloned into an M-PMV proviral vector and expressed in COS cells, one of two major phenotypes was observed. The first group, containing three mutants bearing drastic amino acid substitutions, was unable to assemble capsids in the cytoplasm of the host cell. The second and more common group of mutants was able to assemble and release virions, but these either displayed greatly reduced levels of infectivity or were completely noninfectious. Included within this second group were two mutants with unusual phenotypes; mutant D158Y exhibited a novel cleavage site for the viral protease that resulted in cleavage of the major capsid protein, p27 (CA), within the MHR, whereas mutant F156L appeared to have lost a major site for antibody recognition within the mature CA protein. The results of this mutagenic analysis suggest that changes in the MHR sequence can interfere with the assembly of viral capsids and block an early stage of the infection cycle of M-PMV.

Amino Acid Sequence↗
PubMed1977

Strandedness of Pichinde virus RNA.

The Pichinde virus RNA did not possess the following characteristics of eucaryotic mRNA: polyadenylic acid sequence, capped methylated structure, and ability to direct protein synthesis in vitro. Polysomal RNA extracted from cells infected with Pichinde virus reannealed with 32P-labeled virus RNA, protecting about 60% of the latter against RNase degestion. The polyadenylic acid-containing polysomal RNA also reannealed to the 32P-labeled virus RNA to approximately the same extent. These indicate that the major part of the genomic RNA of Pichinde virus is negative stranded.

Arenaviruses, New World↗
PubMed1977

Direct evidence that ribosome bound RNA-dependent RNA polymerase does not play a role in globin messenger RNA replication.

The radioactively labelled product of RNA-dependent RNA polymerase+ from ribosomes of immature chicken erythrocytes was tested for the presence of newly replicated globin mRNA using unlabelled globin complementary DNA. No radioactively labelled globin mRNA sequences were found in the product, providing direct confirmation that this RNA-dependent RNA polymerase is not involved in globin mRNA amplification.

Animals↗
PubMed1977

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.

Avian Sarcoma Viruses↗