Structure of a B-DNA dodecamer. II. Influence of base sequence on helix structure.
Explore the source record for details and available documents.
Base Composition↗
SEARCH · Search PubMed
Results for “oligonucleotide composition”
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Characterization of fimbrial subunits from Bordetella species.
Using antisera raised against serotype 2 and 3 fimbrial subunits from Bordetella pertussis, serologically related polypeptides were detected in Bordetella bronchiseptica, Bordetella parapertussis and Bordetella avium strains. The two B. pertussis fimbrial subunits, and three of the serologically related B. bronchiseptica polypeptides, were shown to be very similar in amino acid composition and N-terminal amino acid sequence. Homology was observed between the N-termini of these polypeptides, and fimbrial subunits from Escherichia coli, Haemophilus influenzae and Proteus mirabilis. A synthetic oligonucleotide probe, derived from the N-terminal sequence of the B. pertussis serotype 2 fimbrial subunit, was used to identify fimbrial genes in genomic Southern blots. The results suggested the presence of multiple fimbrial subunit genes in B. pertussis, B. bronchiseptica and B. parapertussis. The DNA probe was used to clone one of the three tentative fimbrial subunit genes detected in B. pertussis.
Amino Acid Sequence↗
The Leptomonas collosoma spliced leader RNA can switch between two alternate structural forms.
We have used a combination of physical and molecular biological techniques to examine the structure of Leptomonas collosoma spliced leader RNA. We confirm the general features of the previously proposed structure for the 3' half of the RNA, in which a single-stranded region is flanked by two stem loops. However, we find that the 5' half of the RNA, which contains the splice site, has two competing secondary structures which differ only slightly in stability and which can interconvert on a fast (<1 s) time scale. In the favored conformation, a stable hairpin helix is augmented by conserved complementarity between the splice site and the 5' end of the SL RNA. This putative helix has anomalous nuclease sensitivity and thermal stability features, suggesting that it is probably coupled by unknown tertiary interactions to other nucleotides in the 5' half-molecule. The structure offers intriguing parallels with RNA-RNA interactions in the mammalian splicing system.
Animals↗
Thermodynamics of DNA duplexes with adjacent G.A mismatches.
The sequence 5'-d(ATGAGCGAAT) forms a very stable self-complementary duplex with four G.A mismatch base pairs (underlined) out of ten total base pairs [Li et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 26-30]. The conformation is in the general B-family and is stabilized by base-pair hydrogen bonding of an unusual type, by favorable base dipole orientations, and by extensive purine-purine stacking at the mismatched sites. We have synthesized 13 decamers with systematic variations in the sequence above to determine how the flanking sequences, the number of G.A mismatches, and the mismatch sequence order (5'-GA-3' or 5'-AG-3') affect the duplex stability. Changing A.T to G.C base pairs in sequences flanking the mismatches stabilizes the duplexes, but only to the extent observed with B-form DNA. The sequence 5'-pyrimidine-GA-purine-3', however, is considerably more stable than 5'-purine-GA-pyrimidine-3'. The most stable sequences with two pairs of adjacent G.A mismatches have thermodynamic parameters for duplex formation that are comparable to those for fully Watson-Crick base-paired duplexes. Similar sequences with single G.A pairs are much less stable than sequences with adjacent G.A mismatches. Reversing the mismatch order from 5'-GA-3' to 5'-AG-3' results in an oligomer that does not form a duplex. These results agree with predictions from the model derived from NMR and molecular mechanics and indicate that the sequence 5'-pyrimidine-GA-purine-3' forms a stable conformational unit that fits quite well into a B-form double helix.(ABSTRACT TRUNCATED AT 250 WORDS)
Adenine↗
A.T and C.C+ base pairs can form simultaneously in a novel multistranded DNA complex.
Previous experiments have established that in certain synthetic oligomeric DNA sequences, including mixtures of d(AACC)5 with d(CCTT)5, adenine-thymine (A.T) base pairs form to the exclusion of neighboring protonated cytosine-cytosine (C.C+) base pairs [Edwards, E., Ratliff, R., & Gray, D. (1988) Biochemistry 27, 5166-5174]. In the present work, circular dichroism and other measurements were used to study DNA oligomers that represented two additional classes with respect to the formation of A.T and/or C.C+ base pairs. (1) One class included two sets of repeating pentameric DNA sequences, d(CCAAT)3-6 and d(AATCC)4,5. For both of these sets of oligomers, an increase in the magnitude of the long-wavelength positive CD band centered at about 280 nm occurred as the pH was lowered from 7 to 5 at 0.1 and 0.5 M Na+, indicating that C.C+ base pairs formed. Even though it may have been possible for these oligomers to form duplexes with two antiparallel A.T base pairs per pentamer, no A.T base pairing was detected by monitoring the CD changes at 250 nm. Thus, spectral data showed that as few as 40% C.C+ base pairs were stable in two sets of oligomers in which A.T base pairs did not form adjacent to, or in place of, C.C+ base pairs. (2) Another class of oligomer was represented by d(C4A4T4C4), which was studied by CD, HPLC, and centrifugation experiments. We confirmed previous work that this sequence was able to form both types of base pairs as the pH and temperature were lowered [Gray, D., Cui, T., & Ratliff, R. (1984) Nucleic Acids Res. 12, 7565-7580].(ABSTRACT TRUNCATED AT 250 WORDS)
Adenine↗
Structure, dynamics, and energetics of deoxyguanosine . thymidine wobble base pair formation in the self-complementary d(CGTGAATTCGCG) duplex in solution.
Explore the source record for details and available documents.
Base Composition↗
The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.
The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.
Base Composition↗
Magnesium-mediated conversion of an inactive form of a hammerhead ribozyme to an active complex with its substrate. An investigation by NMR spectroscopy.
The effects of magnesium ions on a 32-mer ribozyme (R32) were examined by high resolution NMR spectroscopy. In solution, R32 (without its substrate) consisted of a GAAA loop, stem II, a non-Watson-Crick 3-base pair duplex and a 4-base pair duplex that included a wobble G:U base pair. When an uncleavable substrate RNA (RdC11) was added to R32 without Mg2+ ions, a complex did not form between R32 and RdC11 because the substrate recognition regions of R32 formed intramolecular base pairs (the recognition arms were closed). By contrast, in the presence of Mg2+ ions, the R32-RdC11 complex was formed. Moreover, titration of mixtures of R32 and RdC11 with Mg2+ ions also induced the ribozyme-substrate interaction. Elevated concentrations (1.0 M) of monovalent Na+ ions could not induce the formation of the R32-RdC11 complex. These data suggest that Mg2+ ions are not only important as the true catalysts in the function of ribozyme-type metalloenzymes, but they also induce the structural change in the R32 hammerhead ribozyme that is necessary for establishment of the active form of the ribozyme-substrate complex.
Base Composition↗
Molecular cloning of the cDNA encoding human deoxyribonuclease II.
A rapid amplification of cDNA ends method, using degenerate oligonucleotides based upon the N-terminal amino acid sequence of human hepatic deoxyribonuclease II (DNase II), allowed a novel cDNA encoding DNase II to be constructed from thyroid gland RNA. The composite nucleotide sequence (1593 bases) included an open reading frame of 1080 bases, which encoded a single polypeptide of 360 amino acids (signal peptide, 16; propeptide, 91; mature protein, 253). Although the sequence of DNase II showed no significant homology to other mammalian proteins, its cDNA structural organization resembled those of the lysosomal cathepsin families. The two parts of the cDNA corresponding to the propeptide and the mature protein were expressed in Escherichia coli, and the recombinant polypeptides thus obtained were strongly stained with an anti-DNase II antibody on Western blotting. DNase II is ubiquitously expressed in human tissues, and the DNase II gene (DNASE2) was assigned to chromosome 19.
Amino Acid Sequence↗
Structural variability of A-DNA in crystals of the octamer d(pCpCpCpGpCpGpGpG)
We have determined the structure of the synthetic DNA octamer d(pCpCpCpGpCpGpGpG) in five different crystal forms by single crystal X-ray diffraction. One crystal belongs to the space group P4(3)2(1)2 with a = b = 41.77, c = 25.15 A, whereas all others have the space group P2(1)2(1)2(1) with progressively decreasing unit cell volumes. In all crystals the octamer forms duplexes of A-DNA and all crystals display a similar packing mode, typical for A-DNA. The structure of the duplex varies from loose to very compact when going from one crystal form to another. The most compact form exhibits a volume of 995 A3 per base pair. Such a high density has never been found in A-DNA, being more characteristic of Z-DNA crystals. A comparison of the most with the least compact forms gives a RMS value of 1.7 A, with the distance between the phosphate centers through the major groove being almost twice shorter in the compact form. The phosphate-phosphate separation across the major groove in the compact form is extremely small, 0.7 A. The helical parameters also vary significantly in the various crystal forms. Differences in the helical twist can reach 13 degrees in the same step of the octamer in different crystal forms. The results prove that A-DNA is structurally very variable and demonstrate that the local structure of the same DNA fragment can strongly depend on the crystal environment.
Base Composition↗
Genetic divergence at the SODA locus of six different formae speciales of Pneumocystis carinii.
Genetic divergence at the SODA (manganese-dependent superoxide dismutase, MnSOD) locus were compared in six Pneumocystis carinii formae speciales isolated from mouse, rabbit, human, macaque and pig. A degenerate oligonucleotide primer strategy was designed to amplify 85-90% of the full-length SODA gene from P. carinii genomic DNA isolates. DNA sequence analysis revealed an A/T bias in the nucleotide composition (71-77.2%) and the presence of seven small introns (41-142 bp), interrupting each P. carinii open reading frame (ORF) at the same position. The MnSOD deduced amino acid sequences from all P. carinii isolates shared residues which were conserved within the MnSOD family and which are required for enzymatic activity and binding of the cofactor metal. Phylogenetic analysis including MnSOD sequences from representatives of the fungal phyla Basidiomycota and Ascomycota indicated that the P. carinii formae speciales form a monophyletic group that is related to the budding yeasts (subphylum Saccharomycotina, previously called class Hemiascomycetes) in the Ascomycota. In the whole Pneumocystis group, P. carinii f. sp. hominis, P. carinii f. sp. macacae and P. carinii f. sp. oryctolagi MnSOD sequences clustered together, as did the rat-derived P. carinii and P. carinii f. sp. muris sequences.
Amino Acid Sequence↗
Use of synthetic oligoribonucleotides to probe RNA-protein interactions in the MS2 translational operator complex.
Synthetic oligoribonucleotides have been used to probe the interaction of MS2 coat protein with the translational operator of the MS2 replicase gene. We have investigated the possible formation of a transient covalent bond between the single-stranded uridine residue, at position -5, and a cysteine side-chain on the coat protein, by the incorporation of a chemically modified residue (5-BrU) at this position. This chemically synthesised operator variant has a binding constant of between 10 and 50 times greater than that of the wild type and is therefore comparable with the tight binding variant having a cytidine substituted at the -5 position. Dissociation kinetics show that the complex with the 5-BrU operator is more stable than the -5C variant; a result which is consistent with the formation of a Michael adduct at the -5 position. In addition, a number of other chemical variants of the operator have been analysed. These include operators incorporating deoxyadenine residues at each of the important single-stranded adenine sites. Recently the Michael adduct proposal has been challenged on the basis of mutagenesis of the coat protein cysteine residues. These results are discussed in the light of our data in support of Michael adduct formation.
Base Composition↗
Methylation of slipped duplexes, snapbacks and cruciforms by human DNA(cytosine-5)methyltransferase.
When human DNA(cytosine-5)methyltransferase was used to methylate a series of snapback oligodeoxy-nucleotides of differing stem lengths, each containing a centrally located CG dinucleotide recognition site, the enzyme required a minimum of 22 base pairs in the stem for maximum activity. Extrahelical cytosines in slipped duplexes that were 30 base pairs in length acted as effective methyl acceptors and were more rapidly methylated than cytosines that were Watson-Crick paired. Duplexes containing hairpins of CCG repeats in cruciform structures in which the enzyme recognition sequence was disrupted by a C.C mispair were also more rapidly methylated than control Watson-Crick-paired duplexes. Since enzymes have higher affinities for their transition states than for their substrates, the results with extrahelical and mispaired cytosines suggest that these structures can be viewed as analogs of the transition state intermediates produced during catalysis by methyltransferases.
Base Composition↗
Multiple trans-splicing events are required to produce a mature nad1 transcript in a plant mitochondrion.
The mitochondrial gene encoding NADH dehydrogenase subunit 1 (nad1) in Petunia hybrida is split into five exons, a, b, c, d, and e. With the use of a complete restriction map of the 443-kb Petunia mitochondrial genome, we have cloned these exons and mapped their location. Exon a is located 130 kb away from and in the opposite orientation from exons b and c. Exon d maps 95 kb away and in the opposite orientation from exons b and c. Exons d and e are separated by 190 kb. By performing the polymerase chain reaction on Petunia cDNAs, we have shown that transcripts from these five exons are joined via a series of cis- and trans-splicing events to create a mature nad1 transcript. In addition, we have found 23 C----U RNA edit sites in Petunia nad1. RNA editing changes 19 of the amino acids predicted by the genomic sequence.
Amino Acid Sequence↗
Structure of the gene for rat nucleolar protein B23.
Protein B23 is an abundant RNA-associated nucleolar phosphoprotein involved in the ribosome assembly process. Previous studies showed that two forms of the protein (B23.1 and B23.2) are generated from a single gene via alternative splicing of 3' exons at the mRNA level (Chang, J. H., and Olson, M. O. J. (1989) J. Biol. Chem. 264, 11732-11737). We now report the structure of the complete B23 gene which spans 11-kilobases of DNA and contains 12 exons coding for the 294 amino acid residues. B23.1 mRNA is encoded by exons 1-9, 11, and 12, whereas exons 1-10 code for the B23.2 mRNA. Each exon codes for a relatively short segment of the protein (2-40 amino acid residues). The exons, which are distributed unevenly over the length of the gene, are separated by introns varying in size between 122 base pairs and 2.2 kilobases. Southern blot analyses using a probe derived from the untranslated segment of exon 10 suggests that a single expressed gene is present in the rat genome. Additional genomic clones contained apparent processed pseudogenes for protein B23. Primer extension studies and comparison with a processed pseudogene reveal a probable transcription initiation site at position -96 from the first ATG. The 5' region of the gene contains several possible regulatory elements. Three GC boxes which are potential binding sites for transcription factor Sp1 were found, including one within the first intron. A segment of about 1500 base pairs in the 5' region is unusually rich in the dinucleotide CpG. Although no CCAAT box was found a well-defined TATA box is present at position -126. The latter feature suggests that the B23 gene has some properties of tissue-specific genes in addition to the predominant characteristics of housekeeping genes.
Amino Acid Sequence↗
Dynamics of DNA duplexes containing internal G.T, G.A, A.C, and T.C pairs: hydrogen exchange at and adjacent to mismatch sites.
We have undertaken high-resolution NMR studies to elucidate the conformation and dynamics of the d(C1-G2-C3-G4-A5-A6-T6-T5-C4-G3-C2-G1) 12-mer duplex and its analogs where the symmetrically related dG.dC base pairs in position 3 are replaced by dG.dT, dG.dA, dA.dC, and dT.dC mismatch pairs. The pairing schemes for the dG.dA and dA.dC mismatch interactions have been elucidated from intra- and inter-base pair nuclear Overhauser effect measurements. The replacement of two dG.dC pairs by two dG.dA or two dG.dT pairs results in an approximately 20 C destabilization of the 12-mer; replacement by two dA.dC or two dT.dC pairs results in an approximately 30 C destabilization of the 12-mer. The hydrogen exchange kinetics of the resolved and assigned imino protons in the 12-mer duplex and its mismatch analogs in 0.1 M phosphate have been monitored by saturation recovery measurements. We observe kinetic destabilization at dG.dC base pair 4 adjacent to the mismatch site, which increases in the order 12-mer less than 12-mer GT less than 12-mer GA less than 12-mer AC less than 12-mer TC. By contrast, the kinetic destabilization at dA.dT base pairs 5 and 6 increases in the order 12-mer approximately 12-mer GT approximately 12-mer GA less than 12-mer AC less than 12-mer TC. These results demonstrate that the introduction of dG.dT and dG.dA mismatches results in dynamic perturbations that are localized at the adjacent base pairs, whereas introduction of dA.dC and dT.dC mismatches results in perturbations that extend several base pairs into the duplex. Both base pair opening and preequilibrium pathways contribute to the imino proton hydrogen exchange rates in the 12-mer GA, 12-mer AC, and 12-mer TC duplexes, which is in contrast to earlier studies that demonstrated that the imino proton hydrogen exchange rates were a direct measure of the base pair opening rates in the 12-mer and 12-mer GT duplexes.
Base Composition↗
Chemical-enzymatic synthesis of biologically active DNA fragments.
In this communication we report our recent investigations concerned the design and construction of synthetic functionally active DNA fragments: the structural gene for pentapeptide Leu-enkephalin and the double-stranded 93 base pairs long polynucleotide representing the promoter region of bacteriophage fd DNA. The ways for synthesis of modified promoter analogs carrying photosensitive residues of 5-bromodeoxyuridine in different positions of the chain are also considered.
Base Composition↗
Single-mismatch detection using gold-quenched fluorescent oligonucleotides.
Here we describe a hybrid material composed of a single-stranded DNA (ssDNA) molecule, a 1.4 nm diameter gold nanoparticle, and a fluorophore that is highly quenched by the nanoparticle through a distance-dependent process. The fluorescence of this hybrid molecule increases by a factor of as much as several thousand as it binds to a complementary ssDNA. We show that this composite molecule is a different type of molecular beacon with a sensitivity enhanced up to 100-fold. In competitive hybridization assays, the ability to detect single mismatch is eightfold greater with this probe than with other molecular beacons.
Base Pair Mismatch↗