Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Transient Mutator”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 865 records · Page 48Linked to original sources
PubMed2002

The mechanism for regulation of the F-actin binding activity of IQGAP1 by calcium/calmodulin.

IQGAP1 colocalizes with actin filaments in the cell cortex and binds in vitro to F-actin and several signaling proteins, including calmodulin, Cdc42, Rac1, and beta-catenin. It is thought that the F-actin binding activity of IQGAP1 is regulated by its reversible association with these signaling molecules, but the mechanisms have remained obscure. Here we describe the regulatory mechanism for calmodulin. Purified adrenal IQGAP1 was found to consist of two distinct protein pools, one of which bound F-actin and lacked calmodulin, and the other of which did not bind F-actin but was tightly associated with calmodulin. Based on this finding we hypothesized that calmodulin negatively regulates binding of IQGAP1 to F-actin. This hypothesis was tested in vitro using recombinant wild type and mutated IQGAP1s and in live cells that transiently expressed IQGAP1-YFP. In vitro, the affinity of wild type IQGAP1 for F-actin decreased with increasing concentrations of calmodulin, and this effect was dramatically enhanced by Ca(2+) and required the IQ domains of IQGAP1. In addition, we found that calmodulin bound wild type IQGAP1 much more efficiently in the presence of Ca(2+) than EGTA, and all 8 IQ motifs in each IQGAP1 dimer could bind calmodulin simultaneously. In live cells, IQGAP1-YFP localized to the cell cortex, but elevation of intracellular Ca(2+) reversibly induced the fluorescent fusion protein to become diffusely distributed. Taken together, these results support a model in which a rise in free intracellular Ca(2+) promotes binding of calmodulin to IQGAP1, which in turn inhibits IQGAP1 from binding to cortical actin filaments.

3T3 Cells↗
PubMed2003

TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption.

Mg2+ is an essential ion involved in a multitude of physiological and biochemical processes and a major constituent of bone tissue. Mg2+ homeostasis in mammals depends on the equilibrium between intestinal Mg2+ absorption and renal Mg2+ excretion, but little is known about the molecular nature of the proteins involved in the transepithelial transport of Mg2+ in these organs. Recently, it was shown that patients with mutations in TRPM6, a member of the transient receptor potential family of cation channels, suffer from hypomagnesemia with secondary hypocalcemia (HSH) as a result of impaired renal and/or intestinal Mg2+ handling. Here, we show that TRPM6 is specifically localized along the apical membrane of the renal distal convoluted tubule and the brush-border membrane of the small intestine, epithelia particularly associated with active Mg2+ (re)absorption. In kidney, parvalbumin and calbindin-D28K, two divalent-binding proteins, are co-expressed with TRPM6 and might function as intracellular Mg2+ buffers in the distal convoluted tubule. Heterologous expression of wild-type TRPM6 but not TRPM6 mutants identified in HSH patients induces a Mg2+- and Ca2+-permeable cation channel tightly regulated by intracellular Mg2+ levels. The TRPM6-induced channel displays strong outward rectification, has a 5-fold higher affinity for Mg2+ than for Ca2+, and is blocked in a voltage-dependent manner by ruthenium red. Our data indicate that TRPM6 comprises all or part of the apical Mg2+ channel of Mg2+-absorbing epithelia.

Amino Acid Sequence↗
PubMed1993

Ran/TC4: a small nuclear GTP-binding protein that regulates DNA synthesis.

Ran/TC4, first identified as a well-conserved gene distantly related to H-RAS, encodes a protein which has recently been shown in yeast and mammalian systems to interact with RCC1, a protein whose function is required for the normal coupling of the completion of DNA synthesis and the initiation of mitosis. Here, we present data indicating that the nuclear localization of Ran/TC4 requires the presence of RCC1. Transient expression of a Ran/TC4 protein with mutations expected to perturb GTP hydrolysis disrupts host cell DNA synthesis. These results suggest that Ran/TC4 and RCC1 are components of a GTPase switch that monitors the progress of DNA synthesis and couples the completion of DNA synthesis to the onset of mitosis.

Amino Acid Sequence↗
PubMed1998

A human dynamin-related protein controls the distribution of mitochondria.

Mitochondria exist as a dynamic tubular network with projections that move, break, and reseal in response to local environmental changes. We present evidence that a human dynamin-related protein (Drp1) is specifically required to establish this morphology. Drp1 is a GTPase with a domain structure similar to that of other dynamin family members. To identify the function of Drp1, we transiently transfected cells with mutant Drp1. A mutation in the GTPase domain caused profound alterations in mitochondrial morphology. The tubular projections normally present in wild-type cells were retracted into large perinuclear aggregates in cells expressing mutant Drp1. The morphology of other organelles was unaffected by mutant Drp1. There was also no effect of mutant Drp1 on the transport functions of the secretory and endocytic pathways. By EM, the mitochondrial aggregates found in cells that were transfected with mutant Drp1 appear as clusters of tubules rather than a large mass of coalescing membrane. We propose that Drp1 is important for distributing mitochondrial tubules throughout the cell. The function of this new dynamin-related protein in organelle morphology represents a novel role for a member of the dynamin family of proteins.

Animals↗
PubMed2000

Evidence that stationary-phase hypermutation in the Escherichia coli chromosome is promoted by recombination.

Adaptive (or stationary-phase) mutation is a group of phenomena in which mutations appear to occur more often when selected than when not. They may represent cellular responses to the environment in which the genome is altered to allow survival. The best-characterized assay system and mechanism is reversion of a lac allele on an F' sex plasmid in Escherichia coli, in which the stationary-phase mutability requires homologous recombination functions. A key issue has concerned whether the recombination-dependent mutation mechanism is F' specific or is general. Hypermutation of chromosomal genes occurs in association with adaptive Lac(+) mutation. Here we present evidence that the chromosomal hypermutation is promoted by recombination. Hyperrecombinagenic recD cells show elevated chromosomal hypermutation. Further, recG mutation, which promotes accumulation of recombination intermediates proposed to prime replication and mutation, also stimulates chromosomal hypermutation. The coincident mutations at lac (on the F') and chromosomal genes behave as independent events, whereas coincident mutations at lac and other F-linked sites do not. This implies that transient covalent linkage of F' and chromosomal DNA (Hfr formation) does not underlie chromosomal mutation. The data suggest that recombinational stationary-phase mutation occurs in the bacterial chromosome and thus can be a general strategy for programmed genetic change.

Bacterial Proteins↗
PubMed1994

Spectinomycin interacts specifically with the residues G1064 and C1192 in 16S rRNA, thereby potentially freezing this molecule into an inactive conformation.

The upper stem of helix 34, consisting of the base-paired sequences C1063G1064U1065 and A1191C1192G1193, is suggested to be involved in the binding of spectinomycin. In E. coli 16S rRNA, each of the three mutations at position C1192 confers resistance to spectinomycin. In chloroplast ribosomes from tobacco plants and algae, resistance is conferred by single mutations at positions 1064, 1191, and 1193 (E. coli numbering). Since each of these mutations disrupt any of the three basepairs in the upper stem of helix 34, it has been postulated that spectinomycin can bind to this region and inhibit protein synthesis, only if its nucleotides are basepaired. We have tested this hypothesis by introducing disruptive and compensatory mutations that alter the basepair G1064-C1192. Using the specialized ribosome system, the translational activity of such mutants was determined, in the absence and presence of spectinomycin. We show that any of the three disruptive mutations A1064, C1064, and U1064 confer resistance, in accordance with the model for spectinomycin binding. Compensatory mutations A1064U1192, C1064G1192, and U1064A1192, however, maintained the resistance. This indicates that a basepaired conformation as such is not sufficient for spectinomycin binding, but rather that a G-C pair at positions 1064 and 1192 is required. In addition, we find that the translational activity of specialized ribosomes containing the mutations C1064G1192 is 5-fold lower compared to that of ribosomes containing any of the other mutations introduced, regardless whether spectinomycin is present or not. Since the introduction of C1064G1192 is expected to increase the stability of the upper stem of helix 34, we suggest that these mutations impair ribosome function by preventing the (transient) disruption of the upper stem. By analogy, we speculate that spectinomycin blocks protein synthesis by stabilizing the upper stem. In both cases, the 30S subunit would be frozen into an inactive conformation.

Base Sequence↗
PubMed2000

Identification of novel polymorphisms in the 5' flanking region of CYP1A2, characterization of interethnic variability, and investigation of their functional significance.

CYP1A2 activity has been demonstrated to be bimodally or trimodally distributed in several populations, consistent with a codominant or recessive functional genetic polymorphism. However, studies aimed at identifying polymorphisms in CYPIA2 have not yet adequately accounted for this distribution pattern. To search for functional polymorphisms, we performed genome-walking, polymerase chain reaction (PCR) sequencing, and cloning, and identified three novel polymorphisms in the 5' flanking region of CYP1A2: a T-3591G substitution, a G-3595T substitution, and a T-3605 insertion. The frequency of the T-3591G substitution was determined by a PCR-restriction fragment length polymorphism assay, and found to be significantly higher (P < 0.0001) in Taiwanese (allele frequency 0.128, n = 125) compared to Caucasians (0.017, n = 87) or African Americans (0.024, n = 104). The functional consequence of the T-3591G and the G-3595T substitutions was determined by site-directed mutagenesis followed by transient transfection experiments. The T-3591G mutation was shown to be nonfunctional, while although the G-3595T mutation appeared to result in an increase in promoter activity, this was only to a small degree and therefore unlikely to be important in vivo. In addition, we report 532 bases of 5' flanking sequence further upstream than that reported to date, and four sequence discrepancies compared to the original published sequence (G-3649C, deltaT-3650, deltaA-4072, and C-4093 ins).

Black or African American↗
PubMed2003

Physical interaction of Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) with human oestrogen-related receptor 1 (hERR1): hERR1 interacts with a conserved domain of EBNA-LP that is critical for EBV-induced B-cell immortalization.

Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) consists of W1W2 repeats and a unique C-terminal Y1Y2 domain and plays a critical role in EBV-induced transformation. To identify the cellular proteins associating with EBNA-LP, we performed a yeast two-hybrid screen using EBNA-LP cDNA containing a single W1W2 domain as bait and an EBV-transformed human peripheral blood lymphocyte cDNA library as the source of cellular genes. Our results were as follows. (i) A cDNA in the positive yeast colony was found to encode a cellular protein, human oestrogen-related receptor 1 (hERR1), which is a constitutive transcriptional activator of the various types of oestrogen response elements. (ii) A purified chimeric protein consisting of glutathione S-transferase (GST) fused to hERR1 specifically formed complexes with EBNA-LPs containing one (EBNA-LPR1), two (EBNA-LPR2) or four W1W2 repeats (EBNA-LPR4) transiently expressed in COS-7 cells. Reciprocally, GST fused to EBNA-LPR1 or EBNA-LPR2 pulled down hERR1 transiently expressed in COS-7 cells. (iii) Mutational analyses of EBNA-LP revealed that the Y2 domain of EBNA-LP is responsible for the interaction with hERR1 and two leucines in the Y2 domain (Leu-78 and -82), which are conserved among a subset of primate gammaherpesviruses, are interactive sites for hERR1. So far, it has been reported that the only domain of EBNA-LP critical for EBV-induced transformation is the Y1Y2 domain. Potential roles of hERR1 in EBV-induced transformation are discussed.

Amino Acid Sequence↗
PubMed1996

The regulator of MAT2 (ROM2) protein binds to early maturation promoters and represses PvALF-activated transcription.

The regulation of maturation (MAT)- and late embryogenesis (LEA)-specific gene expression in dicots involves factors related to ABI3, a seed-specific component of the abscisic acid signal transduction pathways from Arabidopsis. In French bean (Phaseolus vulgaris), the ABI3-like factor, PvALF, activates transcription from MAT promoters of phytohemagglutinin (DLEC2) and beta-phaseolin (PHS beta) genes. We describe the regulator of MAT2 (ROM2) as a basic leucine zipper (bZIP) DNA binding protein that recognizes motifs with symmetric (ACGT) and asymmetric (ACCT) core elements present in both MAT promoters. ROM2 antagonizes trans-activation of the DLEC2 promoter by PvALF in transient expression assays. Repression was abolished by mutations that prevented binding of ROM2 to the DLEC2 seed enhancer region. Moreover, a hybrid protein composed of a PvALF activation domain and the DNA binding and dimerization domain of ROM2 activated gene expression, indicating that ROM2 recognizes the DLEC2 enhancer in vivo; consequently, ROM2 functions as a DNA binding site-dependent repressor. Supershift analysis of nuclear proteins, using a ROM2-specific antibody, revealed an increase in ROM2 DNA binding activity during seed desiccation. A corresponding increase in ROM2 mRNA coincided with the period when DLEC2 mRNA levels declined in embryos. These results demonstrate developmental regulation of the ROM2 repressor and point to a role for this factor in silencing DLEC2 transcription during late embryogenesis.

Abscisic Acid↗
PubMed1995

Promoter region of the transcriptional unit for human alpha 1-chimaerin, a neuron-specific GTPase-activating protein for p21rac.

alpha 1-chimaerin is a neuron-specific GTPase-activating protein for p21rac, a protein involved in morphological events. The mRNA is highly expressed in certain brain regions. It is also detected in cultured neuronal, but not in non-neuronal cells. As a first step towards understanding the mechanisms underlying this regulation, genomic clones containing the 5'-flanking region of the human alpha 1-chimaerin transcriptional unit were isolated and characterised. A cluster of multiple transcription start sites of alpha 1-chimaerin mRNAs was detected by primer-extension and S1-mapping analyses. The cluster was mapped to nucleotides -464 to -434 (relative to nucleotide A in the initiation codon) in genomic DNA. The 5'-proximal region contained no TATA box, initiator motif and Sp1-binding site. A 210-bp fragment with approximately 110 bp 5'-flanking sequence could function as a minimal promoter upon analysis using hybrid chloramphenicol acetyltransferase reporter constructs and transient transfection. Internal deletion and point-mutation experiments revealed that a GGCCAATC sequence located at nucleotides -519 to -512 was essential for alpha 1-chimaerin promoter activity. Mobility-shift assay showed the specific binding of nuclear factor(s) to this region, which was competed by the oligonucleotides corresponding to wild-type but not mutant forms. The data also suggest the existence of possible novel CCAAT-binding factor(s) interacting with the alpha 1-chimaerin CCAAT box binding site. A cell-type-preferred suppressor located in the 5'-distal region was found which may play a role in controlling neuron-specific expression of alpha 1-chimaerin mRNA. These findings of a specific promoter for alpha 1-chimaerin transcription will facilitate further studies on its neuronal-specific expression and function.

Amino Acid Sequence↗
PubMed2004

Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene.

The human adenine nucleotide translocase-2 (ANT2) promoter contains a silencer region that confers partial repression on the heterologous herpes simplex virus thymidine kinase (HSVtk) promoter [Barath, P., Albert-Fournier, B., Luciakova, K., Nelson, B.D. (1999) J. Biol. Chem.274, 3378-3384]. Two sequences in the silencer (Site-2 and Site-3) are protected in the DNase I assay in vitro, and one of these is a repeated GTCCTG element previously shown to act as the active repressor element. We have now purified the DNA binding protein, and identified it using MALDI-TOF MS as a 33-kDa member of the nuclear factor 1 (NF1) family of transcription factors. NF1 purified from rat liver and HeLa cell nuclei bind to both silencer Site-2 and Site-3, resulting in a DNase I footprint identical to that obtained with purified recombinant NF1. Furthermore, transient transfection experiments with reporter constructs containing mutated silencer Site-2 and/or Site-3 show that both sites contribute to repression of the HSVtk promoter. Finally, chromatin immunoprecipitation analysis reveals that NF1 is bound to both elements on the endogenous HeLa cell ANT2 promoter. Our data support the belief that NF1 acts as a repressor when bound to silencing Site-2 and Site-3 of the ANT2 gene.

Adenine Nucleotide Translocator 2↗
PubMed2005

Differential effects of histone deacetylase inhibitors on phorbol ester- and TGF-beta1 induced murine tissue inhibitor of metalloproteinases-1 gene expression.

Expression of the tissue inhibitor of metalloproteinases-1 (Timp-1) gene can be induced by either phorbol myristate acetate (PMA) or transforming growth factor beta1 (TGF-beta1), although the signalling pathways involved are not clearly defined. Canonically, histone deacetylase inhibitors (HDACi) such as trichostatin A (TSA) or sodium butyrate (NaB) increase total cellular histone acetylation and activate expression of susceptible genes. Remarkably, PMA and TGF-beta1 stimulation of Timp-1 show a differential response to TSA or NaB. TSA or NaB potentiate PMA-induced Timp-1 expression but repress TGF-beta1-induced Timp-1 expression. The repression of TGF-beta1-induced Timp-1 by TSA was maximal at 5 ng.mL(-1), while for the superinduction of PMA-induced Timp-1 expression, the maximal dose is > 500 ng x mL(-1) TSA. A further HDACi, valproic acid, did not block TGF-beta1-induced Timp-1 expression, demonstrating that different HDACs impact on the induction of Timp-1. For either PMA or TGF-beta1 to induce Timp-1 expression, new protein synthesis is required, and the induction of AP-1 factors closely precedes that of Timp-1. The effects of the HDACi can be reiterated in transient transfection using Timp-1 promoter constructs. Mutation or deletion of the AP-1 motif (-59/-53) in the Timp-1 promoter diminishes PMA-induction of reporter constructs, however, the further addition of TSA still superinduces the reporter. In c-Jun-/- cells, PMA still stimulates Timp-1 expression, but TSA superinduction is lost. Transfection of a series of Timp-1 promoter constructs identified three regions through which TSA superinduces PMA-induced Timp-1 and we have demonstrated specific protein binding to two of these regions which contain either an avian erythroblastosis virus E26 (v-ets) oncogene homologue (Ets) or Sp1 binding motif.

Animals↗
PubMed2002

Determinants of 4-aminopyridine sensitivity in a human brain kv1.4 k(+) channel: phenylalanine substitutions in leucine heptad repeat region stabilize channel closed state.

The biophysical and pharmacological effects of individual phenylalanine-for-leucine (Phe-for-Leu) substitutions in the leucine heptad repeat region located at the cytosolic surface of the channel pore, on whole-cell K(+) currents, were studied in cloned and mutated human brain Kvl.4 K(+) channels (hKvl.4) transiently transfected into HeLa cells. Although L2 and L5 are not considered part of the 4-aminopyridine (4-AP) binding site, unlike the L4 heptad leucine, Phe substitutions at L2 (L464) or L5 (L485) increase 4-AP sensitivity by 400-fold, as seen previously in the L4F mutant channel. Greater depolarizing shifts manifest in the voltage dependence of activation and inactivation in L2F (20 mV) and L5F (30 mV) than in L4F (10 mV) relative to hKv1.4. L1F (L457) and L3F (L471) increase 4-AP sensitivity by 8- and 150-fold, respectively, and produce depolarizing shifts in activation of approximately 5 mV without affecting inactivation. The apparent free energy differences of 4-AP binding in each mutant suggest enhanced drug-channel interactions (L2F > or = L4F > or = L5F > L3F > L1F). Deactivation kinetics are accelerated in L2F (11-fold), L5F (8-fold), L1F (5-fold), and L3F (2-fold), at -50 mV. All Phe-for-heptad-Leu substitutions produce gating changes suggesting variable stabilization of the channel closed state conformation, with L1F, L2F, and L5F exhibiting the strongest correlations between altered gating and increased 4-AP sensitivity. If 4-AP blocks the open channel by promoting closure of the activation gate (recent Armstrong-Loboda model), then changes in the leucine heptad repeat that stabilize the channel closed state may contribute to increased 4-AP sensitivity by amplifying the mechanism of 4-AP block.

4-Aminopyridine↗
PubMed1988

Methylation of the promoter for an immediate-early frog virus 3 gene does not inhibit transcription.

Methylation of critical sites within the promoter region of eucaryotic genes has been shown to inhibit transcription by RNA polymerase II. However, although the large DNA virus frog virus 3 (FV3) has a highly methylated genome, it uses host RNA polymerase II for at least the immediate-early stage of transcription. We have previously shown that an FV3-induced trans-acting protein allows transcription from adenovirus promoters inactivated by methylation. Since FV3 immediate-early genes are transcribed in the absence of de novo protein synthesis, it appears that the virus-induced trans-acting protein that allows transcription from methylated templates is not required for transcription of the immediate-early FV3 genes, possibly because they are not methylated in critical regulatory sequences. In this study, we used site-directed mutagenesis to alter the three CpG dinucleotide sequences in the promoter region of an immediate-early FV3 gene and thereby created sites recognized by bacterial methylases. Transient-expression assays demonstrated that neither the mutations nor methylation of the mutated sites inhibited transcription from the FV3 promoter in FV3-infected cells. These findings support the hypothesis that the immediate-early genes of FV3 do not contain methylatable sites in regions critical for transcription. The function of the virus-induced trans-acting protein that can override the inhibitory effect of methylation may therefore be to facilitate the transcription of methylated delayed-early or late FV3 genes.

Animals↗
PubMed1988

Regulation of human papillomavirus type 11 enhancer and E6 promoter by activating and repressing proteins from the E2 open reading frame: functional and biochemical studies.

E2-C, a protein consisting mainly of the carboxy-terminal 45% of the human papillomavirus type 11 (HPV-11) E2 protein, was expressed from the Rous sarcoma virus long terminal repeat in mammalian cells. It competitively repressed the stimulatory action of the full-length E2 protein on the HPV-11 enhancer located in the upstream regulatory region, as assayed by the expression of a reporter gene from the simian virus 40 (SV40) early promoter in transiently transfected monkey CV-1 cells. A mutation in the initiation codon for E2-C protein eliminated repression. In the human cervical carcinoma cell line C-33A, which apparently lacks endogenous HPV DNA, the HPV-11 enhancer-SV40 promoter and the HPV-11 enhancer in its normal association with the E6 promoter had high constitutive activity. In these cells, E2 proteins had little or no stimulatory effect on the transcriptional activity of the HPV-11 enhancer-SV40 promoter. In contrast, the HPV-11 enhancer-E6 promoter was stimulated by the HPV-11 E2 protein but repressed by the bovine papillomavirus type 1 E2 protein, an effect due either to a quantitative difference in E2 expression levels or to a qualitative difference in the trans-activating abilities of the two E2 proteins. In this cell line, the HPV-11 E2-C protein suppressed both the constitutive activity and the HPV-11 E2 trans activation. The E2-C protein was also produced from an expression vector in Escherichia coli. The E2-C protein present in crude E. coli lysates or purified by DNA affinity chromatography associated in vitro with a specific sequence, ACCN6GGT, in filter-binding assays. Moreover, the protein generated DNase I footprints spanning this motif identical to those of bacterially expressed full-length E2 proteins. This DNA sequence motif is necessary and sufficient for E2 binding in vitro and enhancer trans activation in vivo (H. Hirochika, R. Hirochika, T. R. Broker, and L. T. Chow, Genes Dev. 2:54-67, 1988). Mutations in this sequence that abolished interactions with E2 also precluded binding to the E2-C protein. These data strongly suggest that the full-length E2 protein consists of two functional domains: the amino-terminal half for trans activation and the carboxy-terminal half for DNA binding. The mechanism by which E2-C represses E2-dependent enhancer activity most likely involves competition with E2 for binding to a common transcriptional regulatory site.(ABSTRACT TRUNCATED AT 400 WORDS)

Cloning, Molecular↗
PubMed2004

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter.

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.

Animals↗
PubMed1996

Transcription of the dominant-negative helix-loop-helix protein Id1 is regulated by a protein complex containing the immediate-early response gene Egr-1.

The expression of Id1, a helix-loop-helix protein which inhibits the activity of basic helix-loop-helix transcription factors, is down-regulated during cellular differentiation and cell cycle withdrawal both in tissue culture models and in mouse embryos. In order to study the mechanism of control of Idl expression, we have isolated a 210-bp enhancer element in the upstream region of the Id1 gene whose activity recapitulates Id1 expression in C2C12 muscle cells and C3H10T1/2 fibroblasts: i.e., this element is active in proliferating cells in the presence of serum and completely inactivated upon mitogen depletion, cell cycle withdrawal, and (in the case of C2C12) induced myoblast differentiation. Using linker-scanning mutations and site-directed mutagenesis in transient transfection experiments, we have identified two functional elements within the 210-bp enhancer which are required for proper serum responsiveness. One element (A) contains a consensus Egr-1 binding site and additional flanking sequences required for optimal activity, and the other element (B) fits no known consensus. Gel shift experiments demonstrate that the protein complex binding to the A site contains Egr-1 and other proteins. This complex as well as a protein complex that binds to the B site is lost within 24 h of serum depletion, correlating with the down-regulation of Id1 expression. On the basis of these findings, we propose that the regulation of the Id1 response to serum is mediated in part by the early response gene Egr-1 and as such provides a signaling link between the early-growth-response transcription factors and dominant-negative helix-loop-helix proteins.

Animals↗
PubMed1996

Identification of sequences in c-myc mRNA that regulate its steady-state levels.

The level of cellular myc proto-oncogene expression is rapidly regulated in response to environmental signals and influences cell proliferation and differentiation. Regulation is dependent on the fast turnover of c-myc mRNA, which enables cells to rapidly alter c-myc mRNA levels. Efforts to identify elements in myc mRNA responsible for its instability have used a variety of approaches, all of which require manipulations that perturb normal cell metabolism. These various approaches have implicated different regions of the mRNA and have led to a lack of consensus over which regions actually dictate rapid turnover and low steady-state levels of c-myc mRNA. To identify these regions by an approach that does not perturb cell metabolism acutely and that directly assesses the effect of a c-myc mRNA region on the steady-state levels of c-myc mRNA, we developed an assay using reverse transcription and PCR to compare the steady-state levels of human myc mRNAs transcribed from two similarly constructed myc genes transiently cotransfected into proliferating C2C12 myoblasts. Deletion mutations were introduced into myc genes, and the levels of their mRNAs were compared with that of a near-normal, reference myc mRNA. Deletion of most of the myc 3' untranslated region (UTR) raised myc mRNA levels, while deletion of sequences in the myc 5' UTR (most of exon 1), exon 2, or the protein-coding region of exon 3 did not, thus demonstrating that the 3' UTR is responsible for keeping myc mRNA levels low. Using a similar reverse transcription-PCR assay for comparing the steady-state levels of two beta-globin-myc fusion mRNAs, we showed that fusion of the myc 3' UTR lowers globin mRNA levels by destabilizing beta-globin mRNA. Surprisingly, fusion of the protein-coding region of myc exon 3 also lowered globin mRNA steady-state levels. Investigating the possibility that exon 3 coding sequences may play some other role in regulating c-myc mRNA turnover, we demonstrated that these sequences, but not myc 3' UTR sequences, are necessary for the normal posttranscriptional downregulation of c-myc mRNA during myoblast differentiation. We conclude that, while two elements within c-myc mRNA can act as instability determinants in a heterologous context, only the instability element in the 3' UTR regulates its steady-state levels in proliferating C2C12 cells.

Animals↗