Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “pathogen isolation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 847 records · Page 47Linked to original sources
PubMed1998

The ability of enteric diarrhoeal pathogens to ferment starch to short-chain fatty acids in vitro.

BACKGROUND: Short-chain fatty acids (SCFA), produced in the normal colon by bacterial fermentation, are decreased in acute diarrhoea. This may have deleterious effects on epithelial function in the colon. METHODS: The ability of several diarrhoeal pathogens to produce SCFA when incubated with starch in vitro was studied. Isolated pathogens were incubated for 24 h with either no added substrate, glucose, or starch under anaerobic conditions, and SCFA were quantitated by gas-liquid chromatography. RESULTS: Unlike the normal colonic flora, the pathogens produced acetate but not propionate or butyrate. D-Lactate was also produced by all the pathogens studied. When the pathogens were incubated in anaerobic medium containing starch, significantly greater amounts of acetate and significantly lesser amounts of lactate were produced. CONCLUSIONS: The inability of enteric pathogens to produce butyrate may impair epithelial cell function, whereas production of D-lactate may enhance mucosal damage in diarrhoeal disease. The presence of luminal starch may be helpful in shifting the fermentation profile to a more favourable pattern.

Butyrates↗
PubMedDate not supplied

Therapy for lower respiratory tract infections with imipenem/cilastatin: a review of worldwide experience.

The worldwide experience with imipenem/cilastatin as of November 7, 1983, in the intravenous therapy for severe and moderately severe infections of the lower respiratory tract is reviewed. Of 204 assessable patients treated in 77 studies conducted by 70 investigative groups (43 in the United States, 27 in other countries), 173 (85%) were cured of their infections or showed improvement. Imipenem was tested against 289 of 303 bacterial pathogens isolated before therapy, and 284 (98%) were found to be susceptible. Principal pathogens were Pseudomonas aeruginosa, Streptococcus pneumoniae, Klebsiella species, Haemophilus influenzae, Escherichia coli, and Staphylococcus aureus. A total of 76% of infecting pathogens were eradicated during therapy. Of 54 imipenem-susceptible infecting strains of P. aeruginosa, however, 57% were eradicated, 19% acquired resistance to imipenem, and 17% were replaced by new resistant strains of P. aeruginosa. Higher doses of imipenem/cilastatin and/or combined therapy with an aminoglycoside may improve these results. Imipenem/cilastatin compares well with the most active agents available for therapy for lower respiratory tract infections.

Adolescent↗
PubMed1983

Ceftazidime in clinical practice.

In an open trial, the efficacy of intravenously administered ceftazidime was evaluated in 106 adult patients with urinary or respiratory tract infections, soft tissue infections, osteitis and septicaemia. The most commonly isolated pathogens were Escherichia coli, Pseudomonas spp. and Staphylococcus aureus. Of 85 organisms isolated before treatment, 79% were cleared and 15% were cleared but later relapsed often because of the underlying conditions. Clinical cure was achieved in 70%, improvement occurred in 25% of the patients and 6% failed to respond. Marked increases in serum creatinine occurred in three patients with pre-existing renal impairment treated with ceftazidime in unmodified dosage. Exanthema, diarrhoea or local thrombophlebitis was noted in 13 patients.

Adult↗
PubMed2006

The impact of endoscopic cultures on care in rhinosinusitis.

OBJECTIVES: The objectives of this retrospective, observational study were primarily to analyze endoscopically guided culture results (EGCRs) from an office setting in patients with subclassifications of chronic rhinosinusitis (CRS) and to determine the frequency EGCR-altered patient management; and secondarily to determine whether purulent secretions are more likely to be positive for a bacterial pathogen. METHODS: Consecutive symptomatic patients with nasal secretions not currently on antibiotics were cultured endoscopically. Patients were classified as chronic rhinosinusitis (CRS; n = 41) or acute exacerbation of chronic rhinosinusitis (AECRS; n = 27). Initial therapy was individualized and 32 of 68 (47%) had an antibiotic initiated before availability of the EGCR. Patients were reassessed 2 to 4 days later, and therapy was continued or altered based on clinical course and EGCR. RESULTS: EGCRs were positive in 41 of 68 (60.2%) of all patients. Incidence of positive cultures was not statistically different between CRS (21 of 41 [51%]) and AECRS (20 of 27 [74%]) patients. Initial therapy was changed in 45 of 68 (66%) patients. In 35 of 68 (51.4%), the change was directed by EGCR; in 11 of 77 (14.2%), the change was unsubstantiated by EGCR, and in no cases was an antibiotic initiated inappropriate to EGCR. The frequency of pathogens in the subgroups of CRS and AECRS, respectively, were Staphylococcus aureus (9 of 41 [22%]; 9 of 27 [33%]), acute pathogens (6 of 41 [14.6%], 7 of 27 [25.9%]), and Pseudomonas aeruginosa (5 of 41 [12%], 5 of 27 [18.5%]) and were not statistically different between subgroups. Purulent cultures were not significantly more likely to be Gram stain-positive than nonpurulent cultures (12 of 34 [35%] compared with 6 of 34 [17.6%], respectively; P = .1). Purulent cultures were more likely to be culture-positive (25 of 34 [73.5%]) compared with nonpurulent secretions (17 of 34 [50%]; P < .05). AECRS was significantly more likely to be purulent (21 of 27 cases) compared with CRS (13 of 41 cases, P < .001). CONCLUSION: EGCR directed a change in therapy in 35 of 68 (51.4%) patients with CRS. The pathogens isolated from CRS and AECRS were similar and predominately S. aureus, acute pathogens, and P. aeruginosa. Purulent secretions are more frequently bacteriologically positive than nonpurulent secretions and more common in AECRS than CRS.

Adult↗
PubMed1999

Enteric pathogens and their isolation at a cancer hospital in Pakistan.

Diarrhoeal diseases remain a major cause of mortality and morbidity in developing countries. However, due to lack of funds, supply problems and some inexperience, some laboratories have difficulty identifying a causative agent in stool samples. In the year following the opening of the Shaukat Khanum Memorial Cancer Hospital and Research Centre in Lahore, Pakistan, the microbiology department had not isolated a single enteric pathogen. From January 1996, new culture techniques were introduced, with a resulting increase (10%) in identification of these pathogens. In addition, the introduction of formol-ether concentration made a significant contribution to the number of intestinal parasites seen. This report demonstrates how simple microbiology methods made a difference to the running of the department and, ultimately, to the patients.

Developing Countries↗
PubMed1990

[Investigation of pathogens in the foci of pulmonary and osteo-articular tuberculosis].

The tubercle bacilli detection rate was determined by direct bacterioscopy and the culture plate method immediately in the disease foci in 123 patients with pulmonary tuberculosis and 78 patients with tuberculosis of bones and joints. The culture plate method was shown to have significant advantages over bacterioscopy. However, in some cases with negative responses to the culture plate test, bacterioscopy was the only procedure that detected the pathogen in resected lung tissues. Parallel use of 2 different media in the culture plate test provided higher frequency of the pathogen isolation. Cultures isolated from the lung foci were showed drug resistance in 1/4 of the cases. Cultures from the bone foci were in all the cases but one sensitive to all the drugs used. By their biological properties, all the isolates belonged to human tubercle bacilli. The necessity of microbiological investigation of pathogenes in tuberculosis foci is grounded.

Antitubercular Agents↗
PubMed1995

Multidrug-resistant enterococci: a threat to the surgical patient.

The enterococcus has become an important nosocomial pathogen, reported by the National Nosocomial Infections Surveillance System as the third most common pathogen associated with blood-stream infections and the second most commonly isolated pathogen overall. It is now more frequently recognized as a cause of superinfection in the surgical patient, as the possible result of the frequent use of ineffective antimicrobials for prophylaxis and treatment. Both of these findings are due, in part, to the intrinsic antimicrobial resistance of the enterococci. Of greater concern is the ready ability of this organism to acquire resistance traits. During the past 5 years, the appearance and rapid dissemination of strains with high-level resistance to vancomycin, ampicillin, gentamicin, and streptomycin have been reported; in some cases, no effective antimicrobial therapy was available to patients infected with these strains. Enterococci, in addition to their intrinsic and acquired tolerance to beta-lactams, have acquired the ability to inactivate penicillin and ampicillin via beta-lactamase production. Prompt recognition of such multiresistant enterococci, the implementation of effective infection control precautions, and rational use of antimicrobials may limit or even prevent the spread of such strains in the hospital setting.

Anti-Bacterial Agents↗
PubMed2003

Pathogen frequency and resistance patterns in Brazilian hospitals: summary of results from three years of the SENTRY Antimicrobial Surveillance Program.

BACKGROUND: Pathogen frequency and resistance patterns may vary significantly from country to country and also in different hospitals within a country. Thus, regional surveillance programs are essential to guide empirical therapy and infection control measures. METHODS: Rank order of occurrence and antimicrobial susceptibility of pathogenic species causing bloodstream infections (BSI), lower respiratory tract infections (LRTI), wound or skin and soft tissue infections (WSSTI), and urinary tract infections (UTI) in hospitalized patients were determined by collecting consecutive isolates over a specified period of time, as part of the SENTRY Antimicrobial Resistance Surveillance Program (SENTRY). All isolates were tested by reference broth microdilution. RESULTS AND CONCLUSIONS: A total of 3,728 bacterial strains were obtained from January, 1997, to December, 1999, from 12 Brazilian hospitals located in 4 states. The largest number of isolates were obtained from patients with BSI (2,008), followed by LRTI (822 cases), UTI (468 cases), and WSSTI (430 cases). Staphylococcus aureus was the most frequently isolated pathogen in general (22.8% - 852 isolates), followed by E. coli (13.8% - 516 cases) and Pseudomonas aeruginosa (13.3% - 496 cases). Staphylococcus aureus was also the most common species isolated from BSI (23.6%) and WSSTI (45.8%), and P. aeruginosa was the most frequent species isolated from patients with LRTI (29.4%). The main bacterial resistance problems found in this study were: imipenem resistance among P. aeruginosa (69.8% susceptibility) and Acinetobacter spp. (88.1% susceptibility); ESBL production among K. pneumoniae (48.4%) and E. coli (8.9%); resistance to third generation cephalosporins among Enterobacter spp. (68.1% susceptible to ceftazidime) and oxacillin resistance among S. aureus (34.0%) and coagulase negative staphylococci (80.1%). Only the carbapenems (88.1% to 89.3% susceptibility) showed reasonable activity against the Acinetobacter spp. isolates evaluated.

Anti-Bacterial Agents↗
PubMed1981

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Base Sequence↗
PubMed1984

Parasitic, bacterial, and viral enteric pathogens associated with diarrhea in the Central African Republic.

A total of 1,197 diarrheic children less than 15 years old were investigated for parasitic, bacterial, and viral enteropathogens from March 1981 through February 1982 in the Central African Republic. One or more pathogens were identified from 49.4% of the patients. Rotavirus was the most frequently identified pathogen among children less than 18 months old. Enteropathogenic Escherichia coli was the second most frequently isolated pathogen (12.1%) in children less than 2 years of age. Campylobacter jejuni was also isolated frequently from diarrheic children less than 5 years of age (10.9%). Entamoeba histolytica was identified in very young children and was found to be the most frequent enteropathogen associated with diarrhea in children over the age of 2 years. Enterotoxigenic Escherichia coli was rarely isolated (ca. 2%). There was a peak in the incidence of rotavirus during the dry season and in the incidence of Campylobacter jejuni during the rainy season.

Adolescent↗
PubMed2006

DNA fingerprinting of a multi-resistant coagulase-negative staphylococci isolated from biomaterials in dialysis services.

BACKGROUND: Coagulase-negative staphylococci (CoNS) have emerged as an important opportunistic pathogen isolated in hospital. Several species of CoNS have been implicated in human infections and disease especially in patients with poor health status. METHODS: A total of 71 clinical strains of CoNS were isolated from dialysis fluid and needles in a dialysis unit and characterized. Susceptibility to antibiotics, biofilm production and molecular typing by pulsed-field gel electrophoresis (PFGE) were achieved. RESULTS: The main isolated CoNS strains were Staphylococcus epidermidis (45%), Staphylococcus hominis (14%) and Staphylococcus haemolyticus (12.7%). The susceptibility profile of all strains revealed high resistance level to penicillin and oxacillin. PCR detection of oxacillin resistance gene (mecA gene) revealed a higher percentage of positive strains than the classic test (ATB Staph). Slime production test was positive in 60.6% of CoNS strains. PFGE analysis showed the presence of 69 restriction profiles clustered in 56 patterns. CONCLUSIONS: Profiles of all isolates were generally heterogeneous, suggesting independent circulation with some evidence of cross-transmission.

Biocompatible Materials↗
PubMed2005

AmpC beta-lactamase producing bacterial isolates from Kolkata hospital.

BACKGROUND AND OBJECTIVE: The widespread use of beta-lactam antibiotics has lead to the development of resistance to this group of antibiotics in bacterial pathogens due to beta-lactamase production. Information on such pathogens is not available from eastern region of India. This study was undertaken to determine the AmpC beta-lactamase production in pathogens isolated from hospitalized patients in Kolkata. METHODS: Non-repeat clinical isolates (284) from pus, urine, sputum and other clinical specimens of hospitalized patients were taken. Disk agar diffusion (DAD) and minimum inhibitory concentration (MIC) with different beta-lactam antibiotics, and double disc synergy test (DDST) with clavulanic acid and sulbactam were done. Disk antagonism test (DAT) and three-dimensional extract test (TDET) were conducted for phenotypic confirmation of AmpC and inducible AmpC beta-lactamase production. Nitrocefin spot test and microiodometric assay of beta-lactamase were also performed. RESULTS: Twenty seven isolates were found to be resistant to cefoxitin, a alpha-methoxy-beta-lactam. Of these, 19 were observed to be AmpC beta-lactamase producers and 4 were inducible AmpC beta- lactamase producers by DDST, DAT and TDET. Remaining 4 were non AmpC beta-lactamase producers. Of the 23 AmpC beta-lactamase producers, the distribution of different species was as follows: Escherichia coli 11 (47.8%), Pseudomonas aeruginosa 4 (17.3%) Klebsiella pneumoniae 3 (13%), and Klebsiella aeruginosa 1 (4.3%). INTERPRETATION AND CONCLUSION: Our finding showed 6.7 per cent AmpC beta-lactamase and 1.4 per cent inducible AmpC beta-lactamase producing clinical isolates from Kolkata. AmpC beta-lactamase producing bacterial pathogens may cause a major therapeutic failure if not detected and reported in time.

Anti-Bacterial Agents↗
PubMed2005

Identification of two novel genes for blackleg resistance in Brassica napus.

Blackleg, caused by Leptosphaeria maculans, is a major disease of Brassica napus. Two populations of B. napus DH lines, DHP95 and DHP96, with resistance introgressed from B. rapa subsp. sylvestris, were genetically mapped for resistance to blackleg disease with restriction fragment length polymorphism markers. Examination of the DHP95 population indicated that a locus on linkage group N2, named LepR1, was associated with blackleg resistance. In the DHP96 population, a second locus on linkage group N10, designated LepR2, was associated with resistance. We developed BC1 and F2 populations, to study the inheritance of resistance controlled by the genes. Genetic analysis indicated that LepR1 was a dominant nuclear allele, while LepR2 was an incompletely dominant nuclear resistance allele. LepR1 and LepR2 cotyledon resistance was further evaluated by testing 30 isolates from Canada, Australia, Europe, and Mexico. The isolates were from B. napus, B. juncea, and B. oleracea and represented different pathogenicity groups of L. maculans. Results indicated that LepR1 generally conferred a higher level of cotyledon resistance than LepR2. Both genes exhibited race-specific interactions with pathogen isolates; virulence on LepR1 was observed with one isolate, pl87-41, and two isolates, Lifolle 5, and Lifolle 6, were virulent on LepR2. LepR1 prevented hyphal penetration, while LepR2 reduced hyphal growth and inhibited sporulation. Callose deposition was associated with resistance for both loci.

Ascomycota↗
PubMed2003

A 7-year study of severe hospital-acquired pneumonia requiring ICU admission.

OBJECTIVE: To examine the characteristics, prognostic factors, and outcome of patients with severe hospital-acquired pneumonia admitted to the ICU. DESIGN AND SETTING: Prospective observational clinical study in two medical-surgical ICUs with 16 and 20 beds PATIENTS AND PARTICIPANTS: During a 7-year period all hospitalized patients requiring admission to either ICU for hospital-acquired pneumonia were followed up. MEASUREMENTS AND RESULTS: We diagnosed 96 episodes of severe hospital-acquired pneumonia, and in 67 cases a causal diagnosis was made. Most episodes were late-onset pneumonia. Gram-negative micro-organisms were isolated in 51% of episodes diagnosed, and Pseudomonas aeruginosa was the most frequent pathogen isolated (24%). Clearly significant variations happened between hospitals, particularly affecting the incidence of Aspergillus spp. and Legionella pneumophila. Forty-nine patients developed septic shock (51%). Fifty-one patients died (53%). Aspergillosis and pneumonia due to P. aeruginosa were associated with the highest mortality. Septic shock (OR: 14.27) and chronic obstructive pulmonary disease (OR: 6.11) were independently associated with a poor prognosis. CONCLUSIONS: Patients with severe hospital-acquired pneumonia admitted to the ICU present high mortality. The presence of septic shock and chronic obstructive pulmonary disease in conjunction with specific microorganisms are associated with a poor prognosis. Local epidemiological data combined with a patient-based approach may allow a more accurate therapy decision making.

APACHE↗
PubMed2000

Bacteroides, Prevotella, and Porphyromonas species: a review of antibiotic resistance and therapeutic options.

Recent basic and clinical research efforts have shed more light on the taxonomy, microbiology, epidemiology, antimicrobial susceptibility and treatment of Bacteroides, Prevotella, and Porphyromonas species. Of all anaerobic bacteria, Bacteroides is the most frequently isolated pathogen from clinical specimens, including blood. Bacteroides, Prevotella and/or Porphyromonas species have been isolated from clinical specimens in cases of infection from almost all anatomic sites. Several multicentre surveys have documented an alarming gradual increase of resistance rates of Bacteroides, Prevotella and Porphyromonas species worldwide. Antimicrobial agents active against >99% of clinical isolates of Bacteroides are metronidazole, chloramphenicol and carbapenems. Agents active against 95-99% of Bacteroides fragilis isolates are the beta-lactam/beta-lactamase inhibitor combinations. B. fragilis group species other than B. fragilis are more likely to be resistant to beta-lactam/beta-lactamase inhibitor combinations than B. fragilis.

Anti-Bacterial Agents↗
PubMed1997

Growth patterns of Candida albicans in relation to radicular dentin.

UNLABELLED: Candida albicans is the most common fungal pathogen isolated from the oral cavity. The role of this organism as an endodontic pathogen is poorly understood. OBJECTIVES: The aim of this study was to observe the interaction of C. albicans with root canal walls and the growth patterns of this microorganism in relation to radicular dentin. STUDY DESIGN: Fifteen root sections were infected with C. albicans grown in calf serum and incubated for various periods. The sections were fixed in glutaraldehyde, split into two halves, and evaluated by scanning electron microscopy. RESULTS: Blastospores and hyphal structures were observed on the root canal walls of all specimens. Filamentous hyphal form was dominant in 5-day specimens. Most of the hyphae and blastospores showed penetration into dentinal tubules. The body of germinating mother cells and hyphae demonstrated collapsed cell walls as a result of vacuole formation. CONCLUSIONS: With this invasive affinity to dentinal structures, C. albicans may be considered a dentinophilic microorganism.

Candida albicans↗
PubMed2004

Epidemiology of rabbit haemorrhagic disease virus in the United Kingdom: evidence for seasonal transmission by both virulent and avirulent modes of infection.

Rabbit haemorrhagic disease virus (RHDV) has killed many millions of wild rabbits in Europe and Australia, but has had little impact in the United Kingdom, despite outbreaks having occurred since 1994. High seroprevalence detected in the absence of associated mortality had suggested the presence of an endemic non-pathogenic strain which may be 'protecting' UK populations. Following the first detailed field study of RHDV epidemiology in the United Kingdom, using mark-recapture with serum sampling, we report that RHDV caused highly prevalent persistent infection in seropositive rabbits in the absence of associated mortality. Furthermore the virus strains responsible could not be distinguished phylogenetically from known pathogenic isolates, and were clearly very different from the only previously identified non-pathogenic strain of RHDV. These findings suggest that many--perhaps most--strains of RHDV may be propagated through both 'pathogenic' and 'non-pathogenic' modes of behaviour. Transmission occurred predominantly during and just after the breeding season.

Animals↗