Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Target sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 847 records · Page 47Linked to original sources
PubMed1986

Yeast mitochondrial ATPase subunit 8, normally a mitochondrial gene product, expressed in vitro and imported back into the organelle.

Subunit 8 of yeast mitochondrial F1F0-ATPase is a proteolipid made on mitochondrial ribosomes and inserted directly into the inner membrane for assembly with the other F0 membrane-sector components. We have investigated the possibility of expressing this extremely hydrophobic, mitochondrially encoded protein outside the organelle and directing its import back into mitochondria using a suitable N-terminal targeting presequence. This report describes the successful import in vitro of ATPase subunit 8 proteolipid into yeast mitochondria when fused to the targeting sequence derived from the precursor of Neurospora crassa ATPase subunit 9. The predicted cleavage site of matrix protease was correctly recognized in the fusion protein. A targeting sequence from the precursor of yeast cytochrome oxidase subunit VI was unable to direct the subunit 8 proteolipid into mitochondria. The proteolipid subunit 8 exhibited a strong tendency to embed itself in mitochondrial membranes, which interfered with its ability to be properly imported when part of a synthetic precursor.

Biological Evolution↗
PubMed1990

A novel pathway for secretory proteins?

In eukaryotes, most proteins which are transported to the extracellular space, into mitochondria or into chloroplasts are synthesized as precursor polypeptides containing cleavable N-terminal signal or targeting sequences. We have searched the literature for proteins that are exported from the cytosol without being proteolytically processed. Some of these proteins contain uncleaved signal or targeting sequences. However, among secretory proteins there is a class that does not possess hydrophobic signal sequences and appears to leave the cell by a secretory pathway clearly distinct from the classical route through the endoplasmic reticulum and Golgi apparatus.

Acylation↗
PubMed2005

Culture-independent microbial community analysis with terminal restriction fragment length polymorphism.

Terminal restriction fragment length polymorphism is a polymerase chain reaction (PCR)-based technique that has been used to effectively interrogate microbial communities to determine the diversity of both phylogenetic and functional markers. It requires the isolation of community DNA and knowledge of the target sequence. PCR amplification, performed with fluorescently labeled primers, is followed with restriction digestion and size selection on automated sequencing systems. The fluorescent tag identifies the terminal fragment, and the length polymorphism of the terminal fragments reveals a fraction of the phylogenetic diversity within the target sequence. Because the technique has high-throughput capabilities, it performs well in surveys where a large number of samples must be interrogated to ascertain spatial or temporal changes in community structure.

Bacteriolysis↗
PubMed1994

Cointegration of transforming DNAs in Aspergillus nidulans: a model using autonomously-replicating plasmids.

Transforming DNAs form cointegrates in Aspergillus nidulans by homologous and non-homologous recombination as well as by end-to-end ligation of linear fragments. This process has been studied by means of a model in which the linkage of a marker gene to the origin of autonomous replication AMA1 was selected for. Recombinant plasmids were rescued into Escherichia coli and subjected to restriction mapping and sequence analysis. It was shown that circular DNA molecules recombined predominantly within homologous fragments. Linear DNA fragments integrated into circular plasmids by invasion of their ends into random non-homologous sites, but exhibited some bias in choice of a target sequence. Cointegrates of multiple plasmid copies were often observed. In some of the plasmids analysed, short duplications of the target sequence flanking an inserted linear DNA fragment have been revealed.

Aspergillus nidulans↗
PubMed1999

Cooperative approach for the protein fold recognition.

We, four independent predictors, organized a team and tackled blind protein structure predictions using fold recognition methods. We tried to assign the homologous or analogous folds in the protein structure database for a number of target sequences that showed no apparent sequence homology to the proteins of known folds. After primary analyses by conventional softwares, these sequences were threaded through the structural library using three different programs developed by ourselves, which employed different compatibility functions. Collecting the results of our individual analyses, and the available biological knowledge about the target, we held meetings and discussed all plausible structures for the target. For 25 target sequences, we submitted 56 models including NONE: This was the first time the fold was determined. At the time of the meeting (CASP3), 19 protein structures (21 domains) categorized as the threading targets were available. We succeeded in predicting eight out of 18 targets (20 domains) that we submitted; however, alignment accuracies were not satisfactory for some of the models. We often obtained correct answers even if some of us missed the right prediction; therefore it would appear that our threaders compensated each other. When all the information is managed effectively, the prediction gains more accuracy.

Algorithms↗
PubMed2006

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Base Sequence↗
PubMed2003

Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level.

Fluorescent labeling of a short sequence of double-stranded DNA (dsDNA) was achieved by ligating a labeled dsDNA fragment to a stem-loop triplex forming oligonucleotide (TFO). After the TFO has wound around the target sequence by ligand-induced triple helix formation, its extremities hybridize to each other, leaving a dangling single-stranded sequence, which is then ligated to a fluorescent dsDNA fragment using T4 DNA ligase. A non-repeated 15 bp sequence present on lambda DNA was labeled and visualized by fluorescence microscopy after DNA combing. The label was found to be attached at a specific position located at 4.2 +/- 0.5 kb from one end of the molecule, in agreement with the location of the target sequence for triple helix formation (4.4 kb from one end). In addition, an alternative combing process was noticed in which a DNA molecule becomes attached to the combing slide from the label rather than from one of its ends. The method described herein provides a new tool for the detection of very short sequences of dsDNA and offers various perspectives in the micromanipulation of single DNA molecules.

Bacteriophage lambda↗
PubMed1992

Sexing of mouse preimplantation embryos by detection of Y chromosome-specific sequences using polymerase chain reaction.

Detection of genes known to be present on the mammalian Y chromosome was adapted for sexing mouse early embryos using the polymerase chain reaction (PCR) method. Sry and Zfy genes located in the sex-determining region of the Y chromosome were chosen for Y-specific target sequences, and DXNds3 sequence on the X chromosome was chosen for control. The two-step PCR method using two pairs of primers for each of the target sequences was employed for detecting the sequences. When DNAs of male and female mice were amplified with these primers, male-specific fragments were detected even in DNAs that were equivalent in amount to two cells. Mouse embryos at the two-cell stage were separated into two individual blastomeres, and one blastomere was karyotyped at the second cleavage. The remaining blastomere was subjected to PCR amplification immediately or after having been cultured for 48 h up to the morula stage. The Sry and Zfy sequences were detected in about half the embryos; detection of the Sry and Zfy sequences corresponded exactly to the presence of the Y chromosome, except in one sample of male morula in which embryos may have been lost before the PCR amplification. It is concluded that the sex of mouse preimplantation embryos can be accurately determined through detection of the Y-specific sequences using the two-step PCR method, even with the single blastomeres separated at the two-cell stage.

Animals↗
PubMed2006

Dealing with repetitions in sequencing by hybridization.

DNA sequencing by hybridization (SBH) induces errors in the biochemical experiment. Some of them are random and disappear when the experiment is repeated. Others are systematic, involving repetitions in the probes of the target sequence. A good method for solving SBH problems must deal with both types of errors. In this work we propose a new hybrid genetic algorithm for isothermic and standard sequencing that incorporates the concept of structured combinations. The algorithm is then compared with other methods designed for handling errors that arise in standard and isothermic SBH approaches. DNA sequences used for testing are taken from GenBank. The set of instances for testing was divided into two groups. The first group consisted of sequences containing positive and negative errors in the spectrum, at a rate of up to 20%, excluding errors coming from repetitions. The second group consisted of sequences containing repeated oligonucleotides, and containing additional errors up to 5% added into the spectra. Our new method outperforms the best alternative procedures for both data sets. Moreover, the method produces solutions exhibiting extremely high degree of similarity to the target sequences in the cases without repetitions, which is an important outcome for biologists. The spectra prepared from the sequences taken from GenBank are available on our website http://bio.cs.put.poznan.pl/.

Algorithms↗
PubMed2002

A chromosomal region 7p11.2 transcript map: its development and application to the study of EGFR amplicons in glioblastoma.

Cumulative information available about the organization of amplified chromosomal regions in human tumors suggests that the amplification repeat units, or amplicons, can be of a simple or complex nature. For the former, amplified regions generally retain their native chromosomal configuration and involve a single amplification target sequence. For complex amplicons, amplified DNAs usually undergo substantial reorganization relative to the normal chromosomal regions from which they evolve, and the regions subject to amplification may contain multiple target sequences. Previous efforts to characterize the 7p11.2 epidermal growth factor receptor ) amplicon in glioblastoma have relied primarily on the use of markers positioned by linkage analysis and/or radiation hybrid mapping, both of which are known to have the potential for being inaccurate when attempting to order loci over relatively short (<1 Mb) chromosomal regions. Due to the limited resolution of genetic maps that have been established through the use of these approaches, we have constructed a 2-Mb bacterial and P1-derived artificial chromosome (BAC-PAC) contig for the EGFR region and have applied markers positioned on its associated physical map to the analysis of 7p11.2 amplifications in a series of glioblastomas. Our data indicate that EGFR is the sole amplification target within the mapped region, although there are several additional 7p11.2 genes that can be coamplified and overexpressed with EGFR. Furthermore, these results are consistent with EGFR amplicons retaining the same organization as the native chromosome 7p11.2 region from which they are derived.

Blotting, Northern↗
PubMed1991

An improved method for detection of B-lymphoid clonality by polymerase chain reaction.

Several groups have recently described methods for the detection of clonal immunoglobulin heavy chain (IgH) gene rearrangements in B-cell malignancies by polymerase chain reaction (PCR) gene amplification using variable region-(VH) and joining (JH) region-specific primers. The simplest methods utilize a single VH primer specific for sequences present in most VH regions corresponding to the third framework region (FR3). An alternative approach is to use a panel of VH family-specific primers specific for the first framework regions (FR1). In the course of nucleotide sequence analysis of IgH gene rearrangements amplified using a VH FR1 primer panel, these authors previously observed 3' VH region deletion and/or base mis-matches sufficient to prevent efficient priming from the VH FR3 primer target sequence in a significant minority of cases of B-lineage malignancy. An improved PCR method has therefore been developed by using a panel of seven VH FR1 family-specific primers incorporated in a single reaction. By using this method clonal IgH gene rearrangement is detected in 15 of 16 cases of B-lineage malignancy. Significantly, this series included four cases of B-lymphoma in which previous attempts to detect PCR clonal IgH gene rearrangements using a VH FR3 primer were unsuccessful. In two of these cases, nucleotide sequence analysis of the amplified DNA showed that failure to prime with the VH FR3 primer was likely to be attributable to insufficient homology with the target sequence. The use of the approach described in this paper should significantly improve the reliability of detection of B-lymphoid clonality by PCR.

Base Sequence↗
PubMed1993

An anti-parallel triple helix motif with oligodeoxynucleotides containing 2'-deoxyguanosine and 7-deaza-2'-deoxyxanthosine.

Triple helix formation of oligodeoxynucleotides (ODNs) with a 15 base pair poly-purine DNA target in the HER2 promoter was examined by footprinting analysis. 7-deaza-2'-deoxyxanthosine (dzaX) was identified as a purine analogue of thymidine (T) which forms dzaX:A-T triplets. ODNs containing 2'-deoxyguanosine (G) and dzaX were found to form triple helices in an anti-parallel orientation, with respect to the poly-purine strand of the target DNA. In comparative studies under physiological K+ and Mg++ concentrations and at pH 7.2, the ODNs containing G and dzaX showed high affinity to the target sequence while the ODNs containing G and T were not able to bind. In the absence of added monovalent salts both ODNs showed high affinity to the target sequence. The substitution of 7-deaza-2'-deoxyguanosine for G substantially decreased the capacity of the ODNs to form triple helices under physiological conditions, indicating that dzaX may be unique in its ability to enhance triple helix formation in the anti-parallel motif.

Base Sequence↗
PubMed1998

An endoplasmic reticulum-targeting signal sequence enhances the immunogenicity of an immunorecessive simian virus 40 large T antigen cytotoxic T-lymphocyte epitope.

An immunological hierarchy among three H-2Db-restricted cytotoxic T lymphocyte (CTL) determinants in simian virus 40 (SV40) large T antigen (Tag) was described previously: determinants I and II/III are immunodominant, whereas determinant V is immunorecessive. To assess the immunogenicity of each determinant individually and define mechanisms that contribute to the immunorecessive nature of determinant V, we constructed a panel of recombinant vaccinia viruses (rVVs) expressing minigenes encoding these determinants in various polypeptide contexts. We found the following. (i) Immunization of mice with an rVV encoding full-length SV40 Tag resulted in priming for CTL responses to determinants I and II/III but not determinant V. (ii) rVVs encoding peptide I or II/III in the cytosol or targeted to the endoplasmic reticulum (ER) were highly antigenic and immunogenic. (iii) rVVs encoding peptide V minigenes were antigenic and immunogenic if the peptide was targeted to the ER, expressed in the cytosol with short flanking sequences, or expressed from within a self-protein, murine dihydrofolate reductase. (iv) Presentation of the nonflanked peptide V (preceded by a Met codon only) could be enhanced by using a potent inhibitor of the proteasome. (v) H-2Db-epitope V peptide complexes decayed more rapidly than complexes containing epitope I or II/III peptides. In brefeldin A blocking experiments, functional epitope V complexes were detected longer on targets expressing ER-targeted epitope V than on targets expressing forms of epitope V dependent on the transporter associated with antigen processing. Therefore, limited formation of relatively unstable cell surface H-2Db complexes most likely contributes to the immunorecessive nature of epitope V within SV40 Tag. Increasing the delivery of epitope V peptide to the major histocompatibility complex class I presentation pathway by ER targeting dramatically enhanced the immunogenicity of epitope V.

Animals↗
PubMed1994

Mutagenesis of the paracrystalline surface protein array of Aeromonas salmonicida by endogenous insertion elements.

The tetragonal paracrystalline surface protein array (A-layer) of the fish pathogenic bacterium Aeromonas salmonicida is a virulence factor and bacteria which are unable to produce A-layer are attenuated in their ability to kill fish. Ten independent mutants of Aeromonas salmonicida which were unable to produce A-layer were isolated by growth at 30 degrees C. These mutants displayed either reduced synthesis of the A-layer subunit, synthesis of a truncated subunit, or complete loss of the ability to produce the subunit protein. Restriction mapping and analysis by polymerase chain reaction showed that the mutations had resulted from insertion of two different insertion sequence (IS) elements into different sites in the A-layer subunit gene (vapA) and its promoter. Sequence comparisons indicated that ISAS1 is unique among reported IS elements. It is 1223 bp long with imperfect terminal inverted repeats of 22 bp and insertion resulted in a duplicated 8 bp target sequence in vapA. ISAS1 expressed a 42,000 molecular weight (M(r)) protein in mini-cells. ISAS2 was 1084 bp long, expressed proteins of M(r) 38,000 and 39,000 in vitro, had imperfect 29 bp terminal inverted repeats and had duplicated a 3 bp target sequence. Sequence comparisons indicated that ISAS2 was also unique to A. salmonicida; however, the proteins encoded by ISAS2 showed strong homology to the putative transposases encoded by the IS30 family of IS elements. Southern analyses showed that both ISAS1 and ISAS2 were restricted to A. salmonicida strains A449 and A450 where they were present in low copy number. The ability of these two IS elements to mutate the ability of A. salmonicida to produce its paracrystalline surface array provides a novel method for the attenuation of virulence.

Aeromonas↗
PubMed2005

Stable transmission of targeted gene modification using single-stranded oligonucleotides with flanking LNAs.

Targeted mutagenesis directed by oligonucleotides (ONs) is a promising method for manipulating the genome in higher eukaryotes. In this study, we have compared gene editing by different ONs on two new target sequences, the eBFP and the rd1 mutant photoreceptor betaPDE cDNAs, which were integrated as single copy transgenes at the same genomic site in 293T cells. Interestingly, antisense ONs were superior to sense ONs for one target only, showing that target sequence can by itself impart strand-bias in gene editing. The most efficient ONs were short 25 nt ONs with flanking locked nucleic acids (LNAs), a chemistry that had only been tested for targeted nucleotide mutagenesis in yeast, and 25 nt ONs with phosphorothioate linkages. We showed that LNA-modified ONs mediate dose-dependent target modification and analyzed the importance of LNA position and content. Importantly, when using ONs with flanking LNAs, targeted gene modification was stably transmitted during cell division, which allowed reliable cloning of modified cells, a feature essential for further applications in functional genomics and gene therapy. Finally, we showed that ONs with flanking LNAs aimed at correcting the rd1 stop mutation could promote survival of photoreceptors in retinas of rd1 mutant mice, suggesting that they are also active in vivo.

3',5'-Cyclic-GMP Phosphodiesterases↗
PubMed1993

Molecular cloning of two new interferon-induced, highly related nuclear phosphoproteins.

During the molecular cloning of the human dsRNA activated-p68 kinase (PKR), polyclonal antibodies against PKR selected, in addition to cDNAs corresponding to PKR, another cDNA presenting only slight homology with PKR cDNA. This cDNA recognized an mRNA species of 2 kilobases induced by both alpha- and gamma-interferons. Its transcription did not require protein synthesis. On further library screening, it selected two highly related cDNAs, referred to as 75 and 41, displaying perfect homology over 612 base pairs and divergent at both ends. In addition, cDNA 75 presents an insertion of 150 base pairs highly homologous to a region common to both sequences. The 75 and 41 peptidic sequences are very hydrophilic, rich in basic amino acid residues, and contain several potential phosphorylation sites for different serine/threonine kinases. Furthermore, they present two protamine- and histone-like nuclear targeting sequences as well as some homology with helix-loop-helix motifs of some DNA-binding proteins. The 75-encoded product, which resolved as a 52-kDa protein after in vitro expression in rabbit reticulocyte lysates, was found to migrate as a 65-67-kDa protein after in vivo expression in insect cells. In accord with sequence data, this 65-67-kDa protein was found to be phosphorylated in vivo in the insect cells and was recovered from the membrane/nuclear pellet. In contrast, the 41-encoded product (30-kDa protein in reticulocyte lysates) could not be expressed in vivo, as it provoked a rapid and severe shut-off of protein synthesis in insect cells. The function of the 75 and 41 proteins and their relation to PKR remains to be determined. However, the presence of nuclear targeting sequences, phosphorylation sites, and helix-loop-helix motif is consistent with a role of these proteins in the mechanism of transduction of the interferon action.

Amino Acid Sequence↗
PubMed1994

Hypertransposing derivatives of the streptomycete insertion sequence IS493.

Transposons derived from the Streptomyces lividans insertion sequence IS493 are useful for the genetic analysis and manipulation of a number of Streptomyces spp. Tn5099-10, an IS493 derivative that contains a spontaneous deletion terminating in the left inverted repeat (IR-L), transposed at a 1000-fold higher frequency in Streptomyces griseofuscus, and at a tenfold higher frequency in Streptomyces fradiae, than the IS493 derivatives, Tn5096 and Tn5099. The IR-L from Tn5099-10 was used to construct a cassette which hypertransposes from plasmids containing the transposon genes, ORFA and ORFB, outside of the inverted repeats. The target sequences of two Tn5099-10 insertions conformed to the consensus target sequence of the other IS493 derivatives, gNCaNTgNNy (where lower-case letters indicate that other nt have been observed at this position and N is any nt). Transposition mutant libraries of S. griseofuscus and S. fradiae can be easily prepared in broth culture by using the hypertransposing elements and a temperature-sensitive delivery plasmid.

Base Sequence↗
PubMed1994

Gene transfer using purified retroviral integrase.

We present a new method of gene transfer into cultured cells using a purified retroviral integrase protein with liposomes. The acceleration rate of transfection by the integrase was increased by a few to ten times. The integrase target sequence containing the 3' end of LTR on the introduced plasmid was necessary for the acceleration, and the orientation of this sequence determined the level of acceleration activity. The analyses of the chromosomal DNAs of each transfectant demonstrated the integration of the introduced plasmid DNA within the integrase-target sequence.

Animals↗