Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Stop codon”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 847 records · Page 47Linked to original sources

Detection of heterozygous truncating mutations in the BRCA1 and APC genes by using a rapid screening assay in yeast.

The detection of inactivating mutations in tumor suppressor genes is critical to their characterization, as well as to the development of diagnostic testing. Most approaches for mutational screening of germ-line specimens are complicated by the fact that mutations are heterozygous and that missense mutations are difficult to interpret in the absence of information about protein function. We describe a novel method using Saccharomyces cerevisiae for detecting protein-truncating mutations in any gene of interest. The PCR-amplified coding sequence is inserted by homologous recombination into a yeast URA3 fusion protein, and transformants are assayed for growth in the absence of uracil. The high efficiency of homologous recombination in yeast ensures that both alleles are represented among transformants and achieves separation of alleles, which facilitates subsequent nucleotide sequencing of the mutated transcript. The specificity of translational initiation of the URA3 gene leads to minimal enzymatic activity in transformants harboring an inserted stop codon, and hence to reliable distinction between specimens with wild-type alleles and those with a heterozygous truncating mutation. This yeast-based stop codon assay accurately detects heterozygous truncating mutations in the BRCA1 gene in patients with early onset of breast cancer and in the APC gene in patients with familial adenomatous polyposis. This approach offers a rapid and reliable method for genetic diagnosis in individuals at high risk for germ-line mutations in cancer susceptibility genes.

Base Sequence↗

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome.

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.

Animals↗

Human leukocyte antigen class I gene mutations in cervical cancer.

BACKGROUND: Various mechanisms contribute to the loss of human leukocyte antigen (HLA) class I expression that is frequently observed in cancers. Although some single allele losses have been ascribed to mutations in HLA class I genes, direct evidence for this phenomenon in vivo is still lacking. Thus, we investigated whether HLA class I gene mutations could account for the loss of allele-specific expression in cervical carcinomas. METHODS: We used polymerase chain reaction-based techniques, including sequencing, oligonucleotide hybridization, and microsatellite analysis, to identify HLA class I gene defects in two tumor-derived cell lines and to confirm the presence of these defects in the original tumors. RESULTS: In one tumor, in exon 2 of the HLA-B15 gene, a four-nucleotide insertion resulted in a stop codon in exon 3. In the other tumor, in two duplicated copies of the HLA-A24 gene, single-point mutations resulted in stop codons in exons 2 and 5. CONCLUSIONS: To our knowledge, this is the first report of HLA class I gene mutations identified in primary tumors that lead to loss of allelic expression in tumor cells. Such tumor-specific mutations may permit the cell to escape HLA class I-restricted cytotoxic T-cell responses.

Chromosomes, Human, Pair 6↗

Loss of human CR1- and murine Crry-like exons in human CR2 transcripts due to CR2 gene mutations.

Analysis of the coding sequences of the murine Cr2 gene indicated that it contains two distinct regions of homology to the murine Crry, and human CR1 and CR2 genes. The last 15 short consensus repeats (SCR) of Cr2 are very similar to the 15 reported SCR of human CR2. These 15 SCR of Cr2, plus the transmembrane and cytoplasmic domains, make up a protein very similar in organization and sequence to the human CR2 gene product. Another Cr2 transcript contains the sequences encoding the previously described 15 SCR plus those encoding another six amino terminal SCR. These amino terminal SCR are very similar to those of Crry and the first six SCR seen within the CR1 long homologous repeats. Amino acid sequence similarity analysis, however, indicated that the sequences encoding the six amino terminal SCR of Cr2 evolved from a separate lineage of SCR than Crry and CR1, suggesting that the human counterparts to these additional Cr2 SCR had not been identified. Using the cDNA sequences specific for the amino terminal SCR of murine Cr2, the human counterparts were isolated and localized within the human CR2 gene between those nucleotides encoding the signal sequence and those encoding the first SCR of the mature human CR2 protein. Unlike the murine Cr2 gene products, these Crry/CR1-like sequences of the CR2 gene are not maintained in mature CR2 mRNA, and thus represent pseudoexons. DNA sequence analysis of the pseudoexon homologous to that encoding the first SCR of the murine Cr2 gene indicated that a stop codon has been introduced within the human coding sequence but that the 5' and 3' splice recognition sequences appear to be functional. Although the stop codon would block the translation of a transcript with this exon, it would not inhibit the incorporation of the exon within the mature CR2 transcript. Therefore, another mutation must have been introduced within the human CR2 gene such that both this exon and the other CR1/Crry-like exons are removed from mature CR2 transcripts.

Amino Acid Sequence↗

Termination of protein synthesis.

One of three mRNA codons--UAA, UAG and UGA--is used to signal to the elongating ribosome that translation should be terminated at this point. Upon the arrival of the stop codon at the ribosomal acceptor(A)-site, a protein release factor (RF) binds to the ribosome resulting in the peptidyl transferase centre of the ribosome switching to a hydrolytic function to remove the completed polypeptide chain from the peptidyl-tRNA bound at the adjacent ribosomal peptidyl(P)-site. In this review recent advances in our understanding of the mechanism of termination in the bacterium Escherichia coli will be summarised, paying particular attention to the roles of 16S ribosomal RNA and the release factors RF-1, RF-2 and RF-3 in stop codon recognition. Our understanding of the translation termination process in eukaryotes is much more rudimentary with the identity of the single eukaryotic release factor (eRF) still remaining elusive. Finally, several examples of how the termination mechanism can be subverted either to expand the genetic code (e.g. selenocysteine insertion at UGA codons) or to regulate the expression of mammalian retroviral or plant viral genomes will be discussed.

Animals↗

Malignant transformation and EGFR activation of immortalized mouse liver epithelial cells caused by HBV enhancer-X from a human hepatocellular carcinoma.

We have previously observed that all human hepatocellular carcinomas (HCCs) from HBV carriers examined had the integrated X region. In this study, HBV DNA was isolated from an integration site in one HCC that had a single, very small integrated viral DNA including the X region, but it had no expression of X gene as poly(A)RNA. It was found that HBV DNA was present between alphoid repetitive sequences, and it included Enhancer and X regions, encompassing the adr sequence from 910 to 1811. Nucleotides for 8 amino acids at the 3' end, a stop codon of X gene and a poly(A) signal downstream of X gene were lost by integration, and nucleotides for 7 amino acids and a stop codon were substituted by a connected alphoid sequence. When this cloned HBV DNA was transfected with an expression vector to an immortalized mouse liver epithelial cell line, MLE-10, malignant transformation occurred. Transformants having expressed poly(A)RNA of the X gene showed anchorage-independent growth in soft agar and tumor formation in the subcutis of nude mice. The mRNA level of EGFR was found to be remarkably enhanced in X-transformed cells, in contrast with the absence of this mRNA in parental and ras-transformed MLE-10. Our data provide evidence that the Enhancer-X region alone is the key contributor to the malignant change of pre-malignant liver cells in HBV carriers through activation of some specific genes, such as EGFR.

Amino Acid Sequence↗

Mutations in the galactose-1-phosphate uridyltransferase gene of two families with mild galactosaemia variants.

Classical galactosaemia, deficiency of galactose-1-phosphate uridyltransferase (GALT), is characterized by acute symptoms of hepatomegaly, jaundice, sepsis, cataracts and growth retardation. Treatment with dietary galactose restriction corrects these complications immediately; however, most of these children develop long-term complications of verbal dyspraxia, mental retardation and ovarian failure. Our previous molecular study showed that the most common mutation of the GALT gene is a missense mutation of Q188R (replacement of glutamine-188 by arginine) in approximately 60-65% of the German galactosaemic population. The coding region of GALT was amplified by the polymerase chain reaction from genomic DNA of classical galactosaemic individuals, who are negative or heterozygous for Q188R, and was further characterized by direct sequencing. Three new disease-causing mutations, two missense and a stop codon mutation, were identified in three patients from two families with mild galactosaemic variants: firstly R67C, replacement of arginine-67 by cysteine and W316X, the stop codon at tryptophan-316 in one male; secondly A330V, replacement of alanine-330 by valine in two female siblings. In the first family the patient was also heterozygous for the polymorphism N314D and in the second family both girls were compound heterozygotes for Q188R and A330V. All three galactosaemic individuals have a considerable amount of the residual GALT activity in RBC and the galactose-1-phosphate (GALP) level decreased much faster on treatment than that of other galactosaemic patients with missense mutations such as Q188R. The clinical and biochemical data of these patients were much more favourable in comparison with those of two female galactosaemic individuals, one homozygous for L195P and the other compound heterozygous for Q188R and L195P. These three missense mutations (R67C, L195P and A330V) also occur in highly conserved regions. These observations suggest that the phenotypic variation in galactosaemic individuals may be due to different molecular aetiologies.

Adolescent↗

Analbuminemia: three cases resulting from different point mutations in the albumin gene.

Analbuminemia is a very rare recessive disorder in which subjects have little or no circulating albumin, although albumin is normally the most abundant plasma protein and has many functions. Analbuminemia is caused by a variety of mutations in the albumin gene and is exhibited only by subjects homozygous for the defect. Previously the mutation had been identified at the molecular level in only two human cases; in one case it resulted from an exon-splicing defect, and in the other case it was caused by a nucleotide insertion that caused a frameshift and premature stop codon. In this investigation we identified the mutations in three unrelated subjects from different countries. In each instance a single-nucleotide mutation produced a stop codon, but the mutations occurred at three different sites: (i) in an Italian male a C-->T transition at nt 2368 in the genomic sequence of albumin, (ii) a C-->T transition at nt 4446 for an American female, and (iii) a G-->A transition at nt 7708 in a Canadian male. The size of the albumin fragment that might have been produced for the three cases varied from 31- to 213-amino acid residues, but no evidence for a circulating albumin fragment was obtained. The paradox is that analbuminemia is extremely rare (frequency < 1 x 10(6)); yet the virtual absence of albumin is tolerable despite its multiple functions.

Adult↗

A frameshifting mutation in CHRNE unmasks skipping of the preceding exon.

A frameshifting 7 bp deletion (epsilon553del7) in exon 7 of CHRNE encoding the acetylcholine receptor epsilon subunit, observed in seven congenital myasthenic syndrome patients, enhances expression of an aberrantly spliced transcript that skips the preceding 101 bp exon 6. To recapitulate the aberrant splicing, we cloned the entire CHRNE spanning 12 exons and 11 introns and expressed it in COS cells. Scanning mutagenesis revealed that epsilon553del7 does not disrupt an exonic splicing enhancer. Inhibition of protein synthesis and of nonsense-mediated mRNA decay (NMD) by anisomycin shows that even wild-type CHRNE produces an exon 6-skipped transcript, and that even epsilon553del7-CHRNE yields a normally spliced transcript. Both transcripts, however, are degraded by NMD due to a premature stop codon. In contrast, the normally spliced transcript from wild-type CHRNE and the exon 6-skipped transcript from epsilon553del7-CHRNE carry no premature stop codon and hence are immune to NMD. Optimization of splicing signals for exon 6 prevents it being skipped even in the presence of anisomycin and/or epsilon553del7, indicating that inherently weak splicing signals for exon 6 account for its skipping. We suggest that a similar mechanism probably operates in other genes in skipping of remote exons. The presence of weak splicing signals for exon 6 also prompted us to search for mutations in exon 6 that disrupt an exonic splicing enhancer. Indeed, we found that epsilonEF157V and epsilonE154X in exon 6, observed in two other patients, caused aberrant splicing of exon 6.

Adolescent↗

The molecular basis of truncated forms of apolipoprotein B in a kindred with compound heterozygous hypobetalipoproteinemia.

Krul et al. (1) have identified two truncated species of apolipoprotein B-100 in a kindred with familial hypobetalipoproteinemia. Five family members were identified who produce either one or both of two truncated apolipoprotein B-100 proteins estimated to be 40% and 90% the amino-terminal end of apolipoprotein B-100. Low density lipoprotein with the apolipoprotein B-90 binds more strongly to the low density lipoprotein-receptor on cultured fibroblasts. In this present study, we have identified the DNA mutations leading to these truncated apolipoprotein B-100 variants in this kindred. Sequencing of amplified DNA from the proband revealed that deletions of one or two nucleotide bases produced frameshift mutations and generated premature stop codons in both cases. Apolipoprotein B-40 (Val1829----Cys-TERM) is the result of a dinucleotide (TG) deletion in exon 26 that generates a stop codon at position 1830 and produces a protein with a predicted molecular mass of 207.14 kDa. The other truncated apolipoprotein B Glu4034----Arg-Gln-Leu-Leu-Ala-Cys-TERM) is due to a single nucleotide (G) deletion in exon 29. This results in a protein with 4039 amino acids and a predicted molecular mass of 457.6 kDa that is now designated apolipoprotein B-89. Mechanisms by which the removal of the last 497 amino acids might increase the binding of the apoB-89 to the LDL-receptor are discussed.

Apolipoproteins B↗

Replication control of plasmid R1: RepA synthesis is regulated by CopA RNA through inhibition of leader peptide translation.

The replication frequency of plasmid R1 is post-transcriptionally controlled by an antisense RNA, CopA, that binds to the leader region in the RepA mRNA, CopT, and ultimately inhibits the synthesis of the replication initiator protein RepA. We present results demonstrating that CopA controls RepA synthesis indirectly. A reading frame for a 24 amino acid leader peptide (Tap, translational activator peptide) is located in the region between the copA and repA genes. A translational fusion between the tap and lacZ genes was used to demonstrate that tap is translated and controlled by CopA. Stop codons (UAA, UAG and UGA) introduced at three different positions within the tap gene led to a severe decrease in repA expression. Specific suppression of the stop codons reversed the effect. This indicates that tap translation is required for RepA synthesis. Phylogenetic comparisons between IncFII-like plasmids, together with previous in vitro and in vivo results (Ohman and Wagner, 1989, 1991), suggest that a stable RNA stem-loop structure sequesters the repA ribosome binding site irrespective of CopA-CopT duplex formation. The results presented here show that ribosomes translating the tap reading frame have to terminate close to the start codon of repA to permit reinitiation (direct translational coupling), and that transient disruption of the inhibitory RNA stem-loop is insufficient for activation of repA translation. The possibility that direct translational coupling is required because of a suboptimal repA RBS cannot be excluded.(ABSTRACT TRUNCATED AT 250 WORDS)

Bacterial Proteins↗

Recombinant adenoviruses expressing dominant negative insulin-like growth factor-I receptor demonstrate antitumor effects on lung cancer.

The continuous growth of tumors depends on the altered regulation of the cell cycle, which is in turn modulated by signals from growth factors and their receptors. Blockade of insulin-like growth factor (IGF)-I and IGF-IR by antisense or dominant negative plasmid transfection can suppress tumorigenicity and induce regression of established tumors. We have constructed two recombinant adenoviruses: an adenovirus expressing truncated IGF-IR (ad-IGF-IR/950) with an engineered stop codon at amino acid residue 950, and an adenovirus expressing the soluble extracellular domain of IGF-IR (ad-IGF-IR/482) with an engineered stop codon at amino acid residue 482. Ad-IGF-IR/950 produces a defective receptor with an intact alpha subunit and a defective beta subunit lacking the tyrosine kinase domain. Dominant negative inhibition results from competition of the defective receptor with normal IGF-IR subunits, or the competition with normal IGF-IR for ligand by the soluble receptor. We were able to show here that ad-IGF-IR/950 induced the increased expression of IGF-IR on the cell surface and ad-IGF-IR/482 induced the secretion of the soluble fragment of IGF-IR. The transduction of both ad-IGF-IR/950 and ad-IGF-IR/482 could blunt the growth-stimulatory effect of IGF-I on human lung cancer cell lines. Both ad-IGF-IR/950 and ad-IGF-IR/482 effectively blocked IGF-I-induced Akt kinase activation. Intratumoral injection of ad-IGF-IR/482 virus showed significant growth suppression in established lung cancer xenografts. These findings suggest that these ad-IGF-IR/dn (950, 482) have the potential to be effective and practical cancer gene therapy strategies.

Adenocarcinoma, Bronchiolo-Alveolar↗

Further characterization of 2 types of precore variant hepatitis B virus isolates from Hong Kong.

Two precore variants of hepatitis B virus occur in chronic carriers in the Chinese community in Hong Kong. One variant has a serine at amino acid (aa) 15, and the other has a stop codon at aa 28, which inhibits production of hepatitis B e (HBe) antigen (Ag). The serine 15 strain is shown here to produce antigenically normal amounts of HBeAg. These variants are mutually exclusive, probably due to sequence requirements for encapsidation, and are separate lineages. Sequential core sequences from patients with either variant revealed more aa substitutions in those who have the codon 28 change (P = .02), particularly T helper and B cell epitopes, implying different selection pressures. Most substitutions occurred around the time of selection of the stop codon, implying that complete loss of HBeAg, an immunomodulatory protein, is necessary for immune pressure on core epitopes. Serine 15 strains select small numbers of substitutions throughout the anti-HBe phase, probably because of persistent immunomodulation.

Adult↗

Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the Caucasian population.

ERV-3 is an evolutionarily conserved single-copy human endogenous retrovirus with a coding envelope gene potentially involved in important placental functions. We have investigated the sequence variability of this gene among 150 unrelated Caucasian individuals and found eight polymorphic sites. One of them corresponds to the introduction of a stop codon resulting in the production of a severely truncated ERV-3 envelope protein lacking both the fusion peptide and the immunosuppressive domain of the protein. The stop codon is observed in a homozygous state in approximately 1% of Caucasian individuals without evidence for counterselection, thus precluding the involvement of any essential function of the gene in placental implantation and development. This natural knockout provides a mean to investigate other potential roles for this otherwise highly conserved gene.

Base Sequence↗

A novel AAAS gene mutation (p.R194X) in a patient with triple A syndrome.

OBJECTIVE: The clinical and molecular data of a patient with triple A syndrome are reported. PATIENT: A 21-year-old male who was diagnosed for adrenal insufficiency at the age of 2 years after a severe attack of adrenal crisis. At the age of 4 years, achalasia and alacrima were diagnosed. Puberty started at the age of 17 years. At the same time, symptoms of central, peripheral, and autonomic nervous system dysfunction were noted. Later on, at the age of 20 years, a bone age delay of 6 years and severe osteoporosis was diagnosed. RESULTS: A compound heterozygous AAAS mutation consisting of two mutations was found: a C > T transition in exon 7 resulting in a change of arginine at amino acid position 194 into a stop codon (Arg194X) at one allele, and a C > T transition in exon 12 resulting in a change of glutamine at amino acid position 387 into a stop codon (Gln387X) on the other allele. CONCLUSION: The mutation in exon 7 (p.R194X) of the AAAS gene is a novel mutation which has not been found in any other family so far, whereas the second was already found in some other families. This case adds to the clinical and molecular spectrum of triple A syndrome and may provide a new insight into the functions of AAAS gene.

Adrenal Insufficiency↗

Expression of diverse AML1/MTG8 transcripts is a consistent feature in acute myeloid leukemia with t(8;21) irrespective of disease phase.

The (8;21) chromosomal translocation occurs in 20% of adult patients with AML M2. This translocation interrupts two genes, AML1 on chromosome 21q and MTG8 (ETO) on 8q to form a chimeric gene AML1/MTG8 on the der(8) chromosome. Recent reports have shown the presence of diverse forms of transcript for this chimeric gene. Three alternative out-of-frame transcripts have been previously demonstrated (types II, III, IV) all of which have a stop codon 3' of the runt box encoding a truncated runt polypeptide. We have characterized a novel transcript (V) which is in-frame and has a stop codon 3' to the runt box. We have examined transcript diversity in 10 AML patients with t(8;21) in remission of their disease following chemotherapy or bone marrow transplantation. Specific transcripts detected at presentation in six patients were similarly expressed during remission and at relapse in two patients; thus expression of transcript diversity was unaffected by the disease phase. Alternative transcripts were unhelpful as a marker of remission quality or predictor of relapse. The significance of these diverse transcripts in leukemogenesis remains unknown.

Base Sequence↗

Probabilistic methods of identifying genes in prokaryotic genomes: connections to the HMM theory.

In this paper, we review developments in probabilistic methods of gene recognition in prokaryotic genomes with the emphasis on connections to the general theory of hidden Markov models (HMM). We show that the Bayesian method implemented in GeneMark, a frequently used gene-finding tool, can be augmented and reintroduced as a rigorous forward-backward (FB) algorithm for local posterior decoding described in the HMM theory. Another earlier developed method, prokaryotic GeneMark.hmm, uses a modification of the Viterbi algorithm for HMM with duration to identify the most likely global path through hidden functional states given the DNA sequence. GeneMark and GeneMark.hmm programs are worth using in concert for analysing prokaryotic DNA sequences that arguably do not follow any exact mathematical model. The new extension of GeneMark using the FB algorithm was implemented in the software program GeneMark.fba. Given the DNA sequence, this program determines an a posteriori probability for each nucleotide to belong to coding or non-coding region. Also, for any open reading frame (ORF), it assigns a score defined as a probabilistic measure of all paths through hidden states that traverse the ORF as a coding region. The prediction accuracy of GeneMark.fba determined in our tests was compared favourably to the accuracy of the initial (standard) GeneMark program. Comparison to the prokaryotic GeneMark.hmm has also demonstrated a certain, yet species-specific, degree of improvement in raw gene detection, ie detection of correct reading frame (and stop codon). The accuracy of exact gene prediction, which is concerned about precise prediction of gene start (which in a prokaryotic genome unambiguously defines the reading frame and stop codon, thus, the whole protein product), still remains more accurate in GeneMarkS, which uses more elaborate HMM to specifically address this task.

Algorithms↗

Peripheral blood mononuclear cells express mutated NCCT mRNA in Gitelman's syndrome: evidence for abnormal thiazide-sensitive NaCl cotransport.

Genetic analysis has demonstrated complete linkage between the human thiazide-sensitive sodium chloride cotransporter gene (NCCT or TSC) and Gitelman's syndrome (GS). Several genomic NCCT mutations have been reported. This study was performed to determine whether peripheral blood mononuclear cells (PBMC) express NCCT mRNA and whether defective PBMC NaCl cotransport could be demonstrated in GS. PBMC were isolated from two brothers with GS, their parents, and healthy control subjects. Northern analysis revealed that NCCT mRNA is expressed in PBMC. The sequence of full-length NCCT cDNA amplified from normal PBMC was identical to human renal NCCT cDNA. Two different mutations were detected in the patients' NCCT cDNA (compound heterozygote). In cDNA derived from the patient's maternal allele, exon 24 was deleted, resulting in a premature stop codon (after amino acid 920). cDNA derived from the patient's paternal allele had an additional 119-bp insertion between exons 3 and 4, generating a premature stop codon (after amino acid 187). The patient's genomic DNA had a previously described 5' splice site mutation in intron 24, GGT --> GTT (maternal allele), and a new 3' splice site mutation in intron 3, CAG --> CAA (paternal allele), which resulted in the activation of a nearby cryptic splice site in intron 3. The latter mutation was not present in 300 normal chromosomes. To determine the functional significance of these findings, chlorothiazide-inhibitable 22Na uptake was measured in PBMC from control subjects, the parents, and the patients with GS in the presence of bumetanide. In control PBMC, chlorothiazide inhibited 22Na uptake by approximately 9%. PBMC from the two patients with GS failed to respond to chlorothiazide. These results demonstrate that PBMC can be used for mutational analysis of NCCT mRNA in patients with GS. Furthermore, functional evidence is provided that the underlying cause of GS is defective NCCT NaCl cotransport.

Adult↗