Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “stability”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 829 records · Page 46Linked to original sources
PubMed1995

Origins of the large differences in stability of DNA and RNA helices: C-5 methyl and 2'-hydroxyl effects.

Recent studies have shown that there can be large differences in the stability of double and triple helical nucleic acid complexes, depending on whether RNA or DNA strands are involved. These differences have been attributed to structural differences in the sugar-phosphate backbone of these two polymers. However, since there are in fact two structural features which distinguish DNA from RNA (the 2'-hydroxyl and C-5 methyl groups), the stability differences may arise from either or both of these factors. We have separated effects of the 2'-hydroxyl and C-5 methyl groups by synthesizing nucleic acid strands which contain all possible combinations with and without these groups. Studies of the stabilities of double and triple helices involving these strands show that in fact the C-5 methyl group of thymine and the 2'-OH group of ribose have equally large effects on stability. The two effects vary with secondary structure and can be reinforcing or even opposing in their influence on stability. Three types of complexes are specifically examined: bimolecular pyrimidine.purine duplexes, termolecular pyrimidine.purine.pyrimidine triplexes, and bimolecular triplexes formed from circular pyrimidine oligonucleotides with purine target strands. It is found in general that the two types of substitutional effects are independent of one another and that C-5 methyl groups are in all cases stabilizing, while 2'-OH groups can be stabilizing or destabilizing, depending on the type of complex. In addition, studies with partially methylated duplexes lend evidence that the largest contribution to stabilization by the methyl group arises from increased base stacking ability rather than from a favorable hydrophobic methyl-methyl contact.(ABSTRACT TRUNCATED AT 250 WORDS)

Amides↗
PubMed1995

Assessment of stability differences in the protein G B1 and B2 domains from hydrogen-deuterium exchange: comparison with calorimetric data.

Hydrogen-deuterium (H-D) exchange experiments have been used to measure exchange rates for almost all of the main-chain amide protons (NHs) in the B1 and B2 IgG-binding domains of protein G. For H-bonded NHs, exchange rates were also measured as a function of temperature from 25 to 65 degrees C for B1 and from 25 to 60 degrees C for B2. A number of NHs exchange by a mechanism consistent with global unfolding. For these residues, the free energy required for transient opening of a H-bonded NH (delta Gop) from H-D exchange approximates the extrapolated free energy of thermal unfolding (delta Gu) from calorimetry in B1 and B2. The difference in exchange rates between B1 and B2 for these residues reflects the 1 kcal mol-1 difference in stability from calorimetry. The more stable B1 domain appears to have a slightly larger core of residues which exchange by global unfolding than B2. The delta Gop values for slow exchange H-bonded NHs and calorimetric delta Gu provide highly complementary information on the delta G versus temperature stability profiles of B1 and B2. Furthermore, NH exchange rates provide a very sensitive measure of local stability differences between B1 and B2. In both domains, the beta 2-strand is the least stable of the beta-sheet although it is more stable in B1 than B2. The largest local stability differences occur at residues Y3 and T18 which exchange 40-fold and 100-fold slower in B1, respectively. These residues form a H-bond donor-acceptor pair at one end of the beta 1-beta 2 region. Local stability differences are also evident near the beta 1-beta 2 turn. These stability differences are, at least in part, due to subtle differences in hydrophobic packing effects. They are not obvious from inspection of the B1 and B2 structures but are manifested as readily measurable changes in NH exchange rates for individual residues. Knowledge of these local stability differences in the beta 1-beta 2 region provides potential approaches for designing new stability mutants in protein G. Most non-H-bonded NHs have exchange rates that are < 15 times slower than their intrinsic rates. In marked contrast, the NHs of K10, T11, and L12 in the beta 1-beta 2 turn and V21 have exchange rates which are five to > or = 24 times faster than their intrinsic rates, probably due to local electrostatic effects.(ABSTRACT TRUNCATED AT 400 WORDS)

Bacterial Proteins↗
PubMed2005

Communication of stabilizing energy between substructures of a protein.

Thermodynamic communication between protein substructures has been investigated by determining the stabilizing effect of mutations at position 52 in the least stable, N-yellow, substructure of cytochrome c on the second least stable, Red, and most stable, Blue, substructures of the protein. A Lys 73 --> His (H73) variant of iso-1-cytochrome c, containing these mutations was used to measure the stability of the Red substructure of cytochrome c through the pH and guanidine hydrochloride (gdnHCl) dependence of the His 73-mediated alkaline conformational transition. The stability of the Blue substructure was measured by global unfolding with gdnHCl and increased by 1 to 3.5 kcal/mol versus the H73 variant. The data demonstrate that the increase in stability of the Red substructure is similar to the increase in global stability, consistent with upward propagation of stabilizing energy from less (N-yellow) to more stable (Red and Blue) protein substructures. The result also supports sequential rather than independent unfolding of the N-yellow and Red substructures of cytochrome c. The data indicate that a leucine at position 52 alters the nature of partial unfolding of the Red substructure, a surprising effect for a single-site mutation. For all variants, the thermodynamics of formation of the Lys 79 alkaline state, which does not unfold the entire Red substructure, shows less stabilization of the portion of the protein unfolded relative to the stabilization of the Blue substructure, indicating that propagation of energy between substructures is somewhat disrupted when unfolding does not correspond to a natural substructure.

Amino Acid Substitution↗
PubMed2004

Kinetic stability of Cu/Zn superoxide dismutase is dependent on its metal ligands: implications for ALS.

Over 100 mutants of the enzyme Cu/Zn superoxide dismutase (SOD) have been implicated in the neurodegenerative disease familial amyotrophic lateral sclerosis (FALS). Growing evidence suggests that the aggregation of SOD mutants may play a causative role in FALS and that aberrant copper chemistry, decreased thermodynamic stability, and decreased affinity for metals may contribute independently or synergistically to this process. Since the loss of the copper and zinc ions significantly decreases the thermodynamic stability of SOD, it is expected that this would also decrease its kinetic stability, thereby facilitating partial or global unfolding transitions that may lead to misfolding and aggregation. Here we used wild-type (WT) SOD and five FALS-related mutants (G37R, H46R, G85R, D90A, and L144F) to show that the metals contribute significantly to the kinetic stability of the protein, with demetalated (apo) SOD showing acid-induced unfolding rates about 60-fold greater than the metalated (holo) protein. However, the unfolding rates of SOD WT and mutants were similar to each other in both the holo and apo states, indicating that regardless of the effect of mutation on thermodynamic stability, the kinetic barrier toward SOD unfolding is dependent on the presence of metals. Thus, these results suggest that pathogenic SOD mutations that do not significantly alter the stability of the protein may still lead to SOD aggregation by compromising its ability to bind or retain its metals and thereby decrease its kinetic stability. Furthermore, the mutant-like decrease in the kinetic stability of apo WT SOD raises the possibility that the loss of metals in WT SOD may be involved in nonfamilial forms of ALS.

Amyotrophic Lateral Sclerosis↗
PubMed2006

Protein stability and surface electrostatics: a charged relationship.

Engineering proteins to withstand a broad range of conditions continues to be a coveted objective, holding the potential to advance biomedicine, industry, and our understanding of disease. One way of achieving this goal lies in elucidating the underlying interactions that define protein stability. It has been shown that the hydrophobic effect, hydrogen bonding, and packing interactions between residues in the protein interior are dominant factors that define protein stability. The role of surface residues in protein stability has received much less attention. It has been believed that surface residues are not important for protein stability particularly because their interactions with the solvent should be similar in the native and unfolded states. In the case of surface charged residues, it was sometimes argued that solvent exposure meant that the high dielectric of the solvent will further decrease the strength of the charge-charge interactions. In this paper, we challenge the notion that the surface charged residues are not important for protein stability. We computationally redesigned sequences of five different proteins to optimize the surface charge-charge interactions. All redesigned proteins exhibited a significant increase in stability relative to their parent proteins, as experimentally determined by circular dichroism spectroscopy and differential scanning calorimetry. These results suggest that surface charge-charge interactions are important for protein stability and that rational optimization of charge-charge interactions on the protein surface can be a viable strategy for enhancing protein stability.

Acid Anhydride Hydrolases↗
PubMed1998

His...Asp catalytic dyad of ribonuclease A: conformational stability of the wild-type, D121N, D121A, and H119A enzymes.

Residue His119 acts as an acid/base during the cleavage/hydrolysis reactions catalyzed by bovine pancreatic ribonuclease A (RNase A). In the native enzyme, His119 forms a hydrogen bond with Asp121. This His...Asp dyad is conserved in all homologous pancreatic ribonucleases of known sequence. Yet, replacing Asp121 with an asparagine or alanine residue does not have a substantial effect on either structure or function [Schultz, L. W., Quirk, D. J., and Raines, R. T. (1998) Biochemistry 37, 8886-8898]. Here, the pH dependencies of the conformational stabilities of wild-type RNase A and the D121N, D121A, and H119A variants were determined by monitoring thermal stability over the pH range 1.2-6.0. Replacing Asp121 with an asparagine or alanine residue results in a loss of conformational stability at pH 6.0 of deltadeltaG(o) = 2.0 kcal/mol, from a total of 9.0 kcal/mol. The magnitude of this loss is similar to that to transition-state binding during catalysis. As the pH decreases, the aspartate residue becomes protonated and deltadeltaG(o) decreases. D121N RNase A and D121A RNase A are approximately equivalent in conformational stability. This equivalence arises from compensating changes to enthalpy and entropy. A general analytical method was developed to determine the value of the pKa of a residue in the native and denatured states of a protein by comparing the pH-stability profile of the wild-type protein with that of a variant in which the ionizable residue is replaced with a nonionizable one. Accordingly, Asp121 was found to have pKa values of approximately 2.4 and 3.4 in the native and denatured states, respectively, of wild-type RNase A. This change in pKa can account fully for the differential effects of pH on the conformational stabilities of the wild-type and variant proteins. We conclude that the His...Asp catalytic dyad in pancreatic ribonucleases has two significant roles: (1) to position the proper tautomer of His119 for catalysis and (2) to enhance the conformational stability of the native enzyme. Most enzymic residues contribute to catalysis or stability (or neither). Asp121 of RNase A is a rare example of a residue that contributes equally to both.

Alanine↗
PubMedDate not supplied

Use of physicochemical tools to determine the choice of optimal enzyme: stabilization of D-amino acid oxidase.

An evaluation of the stability of several forms (including soluble and two immobilized preparations) of d-amino acid oxidases from Trigonopsis variabilis (TvDAAO) and Rhodotorula gracilis (RgDAAO) is presented here. Initially, both soluble enzymes become inactivated via subunit dissociation, and the most thermostable enzyme seemed to be TvDAAO, which was 3-4 times more stable than RgDAAO at a protein concentration of 30 microg/mL. Immobilization on poorly activated supports was unable to stabilize the enzyme, while highly activated supports improved the enzyme stability. Better results were obtained when using highly activated glyoxyl agarose supports than when glutaraldehyde was used. Thus, multisubunit immobilization on highly activated glyoxyl agarose dramatically improved the stability of RgDAAO (by ca. 15,000-fold) while only marginally improving the stability of TvDAAO (by 15-20-fold), at a protein concentration of 6.7 microg/mL. Therefore, the optimal immobilized RgDAAO was much more stable than the optimal immobilized TvDAAO at this enzyme concentration. The lower stabilization effect on TvDAAO was associated with the inactivation of this enzyme by FAD dissociation that was not prevented by immobilization. Finally, nonstabilized RgDAAO was marginally more stable in the presence of H(2)O(2) than TvDAAO, but after stabilization by multisubunit immobilization, its stability became 10 times higher than that of TvDAAO. Therefore, the most stable DAAO preparation and the optimal choice for an industrial application seems to be RgDAAO immobilized on glyoxyl agarose.

D-Amino-Acid Oxidase↗
PubMed2004

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding.

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.

Base Sequence↗
PubMed1996

Stabilization of recombinant human keratinocyte growth factor by osmolytes and salts.

Keratinocyte growth factor (KGF) has limited stability in aqueous media, as it undergoes denaturation followed by aggregation at 37 degrees C. Heparin and anionic polymers have been shown to increase the denaturation temperatures and extend the half-life of the monomeric, native form of KGF during storage. These polymers, however, bind more than one protein molecule with high affinity, and such tight complex formation may cause problems for clinical use. In this study, we have tested low molecular weight additives, such as osmolytes and salts, for their effects on the stability of KGF against thermal denaturation and high-temperature storage. Salts such as NaCl, sodium phosphate, ammonium sulfate, and sodium citrate were highly effective in increasing both the denaturation temperature and storage stability. The fact that the same additives stabilize KGF against both stresses is consistent with the idea that the storage stability is determined by denaturation followed by aggregation. Among the osmolytes tested, N,N'-dimethylglycine, trehalose, and sucrose were also effective stabilizers. However, quantitative comparison of the osmolytes tested indicated that their effectiveness on the thermal denaturation and the storage stability is not exactly parallel, suggesting that other factors also contribute to the storage stability.

Drug Stability↗
PubMed1991

The effects of formulation variables on the stability of freeze-dried human growth hormone.

Formulation often has a dramatic effect on degradation of proteins during the freeze-drying process as well as impacting on the "shelf-life" stability of the freeze-dried product. This research presents the results of a formulation optimization study of the "in-process" and shelf-life stability of freeze-dried human growth hormone (hGH). Chemical decomposition via methionine oxidation and deamidation of asparagine residues as well as irreversible aggregation were characterized by HPLC assay methodology. In-process degradation and stability of low moisture freeze-dried solids were studied at 25 and 40 degrees C in a nominal nitrogen headspace (approximately 0.5% O2). Formulation variables included pH, level of salts, and the nature of the lyoprotectant. Studies of the effect of shear on aggregation in solutions indicated that shear comparable to that experienced during filtration does not induce aggregation. Irreversible changes in hGH during the freeze-drying process were minimal, but chemical decomposition via methionine oxidation and asparagine deamidation and aggregation did occur on storage of the freeze-dried solid. Decomposition via methionine oxidation was significant. A combination of mannitol and glycine, where the glycine remains amorphous, provided the greatest protection against decomposition and aggregation. It is postulated that an excipient system that remains at least partially amorphous is necessary for stabilization. However, the observation that dextran 40 formulations showed poor stability toward aggregation demonstrates that an amorphous excipient system is not a sufficient condition for stability. Stability of the solid was optimal when produced from solutions in the pH range, 7-7.5, with severe aggregation being observed at high pH. The level of sodium phosphate buffer affected stability of the solid, although this relationship was complex. Freeze-drying in the presence of NaCl produced severe aggregation and precipitation during the freeze-drying process as well as acceleration of oxidation and/or deamidation.

Buffers↗
PubMed2000

Solution stability of salmon calcitonin at high concentration for delivery in an implantable system.

Salmon calcitonin solutions (50 mg/mL and 100 mg/mL) were placed on stability at 37 degrees C for 1 year in a variety of solvent systems including water, ethanol, glycerol, propylene glycol (PG) and dimethyl sulfoxide (DMSO). Calcitonin degradation was monitored by RP-HPLC and size-exclusion chromatography. DMSO and pH 3.3 solutions provided optimum stability. Conformational stability was also monitored by FTIR over the 1 year time course and compared with chemical and physical stability. After 12 months at 37 degrees C, four major conformations were observed: a beta-sheet conformation (pH 3.3, pH 5.0, 70% DMSO and 70% glycerol), an aggregate conformation (pH 7.0 water), a strong alpha-helical conformation (70% EtOH, 70% PG) and a weak alpha-helical conformation (100% DMSO). No correlation between structure and chemical stability was observed in which both the beta-sheet structure (pH 3.3, water) and a loose alpha-helical structure (100% DMSO) demonstrated good stability. However, some correlation was observed between structure and physical stability, where co-solvents inducing an alpha-helical structure resulted in a decrease in gelation. These two structural states associated with improved stability and minimal gelation, indicated that gelation can be reduced or eliminated by the use of pharmaceutically acceptable co-solvents. Finally, salmon calcitonin (50 mg/mL) was formulated in 100% DMSO and delivered from a DUROS implant over 4 months. Delivery at a target dose of 18 microg/day calcitonin at 37 degrees C was confirmed.

Amino Acid Sequence↗
PubMed1973

Effect of alcohols and neutral salt on the thermal stability of soluble and precipitated acid-soluble collagen.

The effects of mono- and poly-hydric alcohols in the presence of KCl on the intrinsic stability of collagen molecules in dilute acid solution were compared with corresponding solvent and salt effects on the increased stability of the aggregated molecules in salt-precipitated fibrils. Salt addition decreased solubility and increased the thermal stability of fibrils, but progressively decreased the stability of collagen molecules in solution. In contrast, the alcohols enhanced solubility and decreased fibril stability, the effects increasing with solvent hydrocarbon chain length and with decreasing hydroxyl/methylene-group ratio. Molar destabilization of dissolved collagen by alcohols was lower than for fibrils, and at low salt concentration, both ethylene glycol and glycerol were structural stabilizers. Electron-micrograph studies indicated that salt-precipitated fibrils tended to adopt the native aggregation mode, and qualitatively similar solvent effects were observed in insoluble collagens. Implications of the experimental findings are discussed in terms of a model in which electrostatic and apolar interactions mainly govern the excess of stability in collagen fibrils whereas intrinsic stability of single molecules is a function of polar interactions and polypeptide-chain rigidity.

1-Propanol↗
PubMed2002

Stabilized viral nucleic acids in plasma as an alternative shipping method for NAT.

BACKGROUND: Preservation of the integrity of viral nucleic acids in blood specimens during shipping and handling is crucial for NAT and viral load monitoring. An economical and convenient method is described for nucleic acid stabilization by using an RNA stabilizing solution (RNAlater, Ambion) in plasma that is designed for the shipment of samples to tropical countries. STUDY DESIGN AND METHODS: HCV, HIV, and HBV FFP were compared with RNAlater-treated plasma and dried plasma spots (DPSs) after incubation at 37 degrees C, which was chosen as an upper limit of ambient shipping temperature, for up to 28 days. HCV-infected chimpanzee plasma was shipped at either room temperature after RNAlater treatment or as frozen plasma in liquid nitrogen from Liberia to New York City. They were then compared for HCV RNA levels. The nucleic acid stabilities were determined by quantitative PCR by using a molecular beacon assay on a sequence detection system (ABI 7700, PE-Biosystems) and by visualizing the PCR components on an acrylamide gel. RESULTS: Quantitative PCR data showed that a 60:40 or greater ratio of RNAlater:plasma volume successfully stabilized HCV RNA and HIV RNA in plasma for up to 28 days at 37 degrees C. HBV DNA in plasma was stable for up to 14 days at 37 degrees C without any stabilizing solution. DPSs on filter paper stabilized viral nucleic acids, but the recoveries were 3 to 10 times less than those with frozen plasma. The integrity of the 5' UTR region of HCV RNA in RNA later-treated chimpanzee plasma was intact when its PCR component was viewed on an acrylamide gel. CONCLUSION: The DPS method stabilized nucleic acids, at least with the extraction method used, was less sensitive than use of RNAlater, and required tedious manual handling. RNAlater provides a convenient way of stabilizing viral nucleic acid in plasma at ambient temperature during sample transportation.

5' Untranslated Regions↗
PubMed1999

Structural distribution of stability in a thermophilic enzyme.

Stability parameters for individual residues in Thermus thermophilus cysteine-free RNase H were determined by native state hydrogen exchange, thus providing a unique comparison of regional thermodynamics between thermophilic and mesophilic homologues. The general distribution of stability in the thermophilic protein is similar to that of its mesophilic homologue, with a proportional increase in stability for almost all residues. As a consequence, the residue-specific stabilities of the two proteins are remarkably similar under conditions where their global stabilities are the same. These results indicate that T. thermophilus RNase H is stabilized in a delocalized fashion, preserving a finely tuned balance of stabilizing interactions throughout the structure. Therefore, although protein stability can be altered by single amino acid substitution, evolution for optimal function may require more subtle and delocalized mechanisms.

Deuterium↗
PubMed1995

Effects of the neutral lipid content of high density lipoprotein on apolipoprotein A-I structure and particle stability.

Alterations in high density lipoprotein (HDL) composition that occur in dyslipidemic states may modulate a number of events involved in cholesterol homeostasis. To elucidate the details of how HDL-core composition can affect the molecular structure of different kinds of HDL particles, the conformation and stability of apoA-I have been investigated in homogeneous recombinant HDL particles (LpA-I) containing palmitoyloleoyl phosphatidylcholine (POPC), triolein (TG), and/or cholesteryl linoleate (CE). In a discoidal particle containing two molecules of apoA-I and 85 molecules of POPC, apoA-I exhibits an alpha-helix content of 70% and a free energy of stability of its alpha-helical segments (delta G0D) of 2.2 kcal/mol. Inclusion of eight molecules of TG into the complex significantly reduces the alpha-helix content and stability of apoA-I, whereas inclusion of four molecules of CE into the complex has an opposite effect in that the alpha-helix content is significantly reduced and the stability of the remaining alpha-helical structure of apoA-I is increased. Neutral lipids have a different effect on apoA-I conformation in spherical LpA-I particles. In a sonicated-spherical LpA-I particle containing two molecules of apoA-I and 70 molecules of POPC, apoA-I exhibits an alpha-helix content of about 60% and a delta G0D of 1.2 kcal/mol apoA-I. Inclusion of either 10 molecules of TG or six molecules of CE into such a particle increases both the alpha-helix content and stability of apoA-I. Increasing the CE/TG ratio in LpA-I particles that contain both neutral lipids enhances the stability of the alpha-helical segments. ApoA-I molecules tend to dissociate and cause particle instability when delta G0D for the lipid-bound alpha-helices is less than that for helices in the lipid-free state. The stabilities of both discoidal and spherical LpA-I particles are relatively low when the only neutral lipid present is TG but the particle stability is enhanced by the presence of CE molecules. Such dissociation of apoA-I molecules from LpA-I particles that have a low CE/TG ratio would be promoted in the hypertriglyceridemic state in vivo.

Apolipoprotein A-I↗
PubMed2000

Stabilization of proteins by enhancement of inter-residue hydrophobic contacts: lessons of T4 lysozyme and barnase.

Although the hydrophobic interactions are considered as the main contributors to the protein stability, not much examples of protein stabilization by rational increasing of this type of interactions still can be found in literature. This is partly due to the lack of proper theoretical "measure" of hydrophobic interactions and their changes upon mutations. In the present paper the molecular hydrophobicity potential approach is used to assess how the changes in type and the strength of inter-residue contacts upon single amino acid mutations are correlated with the changes in thermodynamic stability of T4 lysozyme and barnase mutants, and which factors affect these correlations. Mutations changing unfavorable hydrophilic-to-hydrophobic contacts into favorable hydrophobic were found to enhance the thermodynamic stability in more than 81 % of cases, if these mutations do not create steric bumps and do not involve proline residues and hydrogen-bonded side-chains. Mutations increasing hydrophobic contributions (according to molecular hydrophobicity potential formalism) lead to increase of thermodynamic stability in more than 94% of cases for certain type of mutations (i.e., mutations not involving charged residues, Pro and residues with side-chain hydrogen bonds, when these mutations do not introduce steric bumps and do not involve strongly exposed residues and residues situated at helix N- and C-cap positions). For this type of mutations the correlation was found between the change in hydrophobic contributions of mutated residues deltaCphob and thermodynamic parameters deltaTm (change in melting temperature) and deltadeltaG (change in free energy of unfolding). Although the correlation coefficients were larger if the experimental structures of mutants were used for the calculations (correlation coefficients r(exp) deltaC,deltaT = .85 and r(exp) deltaC,deltadeltaG = 0.87) than if the modeled structures were used instead (r(mod) deltaC,deltaT = 0.74 and r(mod)deltaC,deltadeltaG = 0.76), the modelled structures of mutants in the vast majority of cases can be used for qualitative predictition of the protein stabilization. Basing on the analysis of mutations increasing hydrophobic contributions in T4 lysozyme the substitution matrix was derived, which can be used to decide which new residue should be put instead the old one to increase the stability of protein. The estimation shows that the number of potential mutation sites for enhancement of hydrophobic interactions in T4 lysozyme is quite large, and only approximately 10 per cent of them were studied thus far. Basing on the current analysis of T4 lysozyme and barnase mutations the algorithm for increasing of protein stability via increasing of hydrophobic interactions for the proteins with known spatial structure is proposed.

Algorithms↗
PubMed2001

Role of medium- and long-range interactions to the stability of the mutants of T4 lysozyme.

Inter-residue interactions play an important role to the folding and stability of protein molecules. In this work, we analyze the role of medium- and long-range interactions to the stability of T4 lysozyme mutants. We found that, in buried mutations, the increase in long-range contacts upon mutations destabilizes the protein, whereas, in surface mutations, the increase in long-range contacts increases the stability, indicating the importance of surrounding polar residues to the stability of surface mutations. Further, the increase in medium-range contacts decreases the stability of buried and surface mutations and a direct relationship is observed between the increase of medium-range contacts and increase in stability for partially buried/exposed mutations. Moreover, the relationship between amino acid properties and stability of T4 lysozyme mutants at positions Ile3, Phe53, and Leu99 showed that the effect of medium- and long-range contacts is less for buried mutations and the inter-residue contacts have significant correlation with the stability of partially buried mutations.

Bacteriophage T4↗
PubMed1999

The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism.

Stabilization of mRNAs contributes to the strong and rapid induction of genes in the inflammatory response. The signaling mechanisms involved were investigated using a tetracycline-controlled expression system to determine the half-lives of interleukin (IL)-6 and IL-8 mRNAs. Transcript stability was low in untreated HeLa cells, but increased in cells expressing a constitutively active form of the MAP kinase kinase kinase MEKK1. Destabilization and signal-induced stabilization was transferred to the stable beta-globin mRNA by a 161-nucleotide fragment of IL-8 mRNA which contains an AU-rich region, as well as by defined AU-rich elements (AREs) of the c-fos and GM-CSF mRNAs. Of the different MEKK1-activated signaling pathways, no significant effects on mRNA degradation were observed for the SAPK/JNK, extracellular regulated kinase and NF-kappaB pathways. Selective activation of the p38 MAP kinase (=SAPK2) pathway by MAP kinase kinase 6 induced mRNA stabilization. A dominant-negative mutant of p38 MAP kinase interfered with MEKK1 and also IL-1-induced stabilization. Furthermore, an active form of the p38 MAP kinase-activated protein kinase (MAPKAP K2 or MK2) induced mRNA stabilization, whereas a negative interfering MK2 mutant interfered with MAP kinase kinase 6-induced stabilization. These findings indicate that the p38 MAP kinase pathway contributes to cytokine/stress-induced gene expression by stabilizing mRNAs through an MK2-dependent, ARE-targeted mechanism.

3' Untranslated Regions↗