SEARCH · Search PubMed
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
We present a possibly new multiple congenital anomaly syndrome of craniosynostosis, Poland anomaly, cranio-fronto-nasal "dysplasia," and genital and breast anomalies. A similar pattern of anomalies was observed in two previous cases from the literature; however, some peculiar findings suggest that these cases might represent a new multiple congenital anomaly syndrome.
As Poland sequence (PS) could have a vascular disruptive origin, here we analyzed the possible relationship between maternal smoking during pregnancy and PS, using data from two registries with different methodologies: the Hungarian Congenital Abnormality Registry (HCAR), which is a population-based registry, and the Spanish Collaborative Study of Congenital Malformations (ECEMC), which is a hospital-based and case-control study. The results presented here in a multivariate analysis, although based on a small sample size, suggest that maternal smoking during pregnancy may increase the risk for PS by about 2-fold. This result was similar in the two studied programs with different methodologies and different uncontrolled confounding factors. However, as this is the first time that PS has been associated with maternal smoking during pregnancy, further analyses are needed to confirm our findings.
To identify reasons for the high incidence rates of stomach cancer in Poland, we conducted a population-based case-control study in Warsaw. Cases were residents aged 21 to 79 years who were newly diagnosed with stomach cancer between March 1, 1994, and April 30, 1997. Controls were randomly selected from Warsaw residents registered at the nationwide Polish Electronic System of Residence Evidency, frequency-matched to cases by age and sex. Information on demographic characteristics; consumption of cigarettes, alcohol, tea and coffee; diet; medical history; family history of cancer; occupational history; and living conditions during adolescence was elicited by trained interviewers using a structured questionnaire. Included were 464 cases (90% of eligible) and 480 controls (87% of eligible). Among men, the risk of stomach cancer was significantly elevated among current smokers (OR = 1.7, 95% CI = 1.1-2.7) but not among former smokers. The excess risk was largely confined to long-term and heavy smokers, with significant 2-fold excess risk among men who smoked 40 or more pack-years. Among women, an 80% increase in risk was observed in both current and former smokers but dose-response trends were less consistent than among men. Alcohol consumption was not clearly related to risk, and no association was found for drinking regular coffee or herbal tea or using milk/cream in coffee or tea. A significant reduction in risk was linked to daily tea drinking among women, but not among men. Our findings confirm an association with cigarette smoking, which is estimated to account for approximately 20% of stomach cancers diagnosed among Warsaw residents during the study period.
BACKGROUND: Heavy physical work is still considered one of the most prevalent risk factors of negative pregnancy outcome. The present study was undertaken to evaluate the impact of heavy physical work during pregnancy, based on subjective assessment of workload, on the risk of delivering a small-for-gestational-age (SGA) baby. METHODS: Job characteristics were compiled for 1,064 working women from the Lódź region (8% population sample) based on questionnaire responses. Energy expenditure during daily work was estimated. SGA was diagnosed when the birth weight was below the 10th percentile of the standard curves for central Poland. The SGA group comprised 78 women who delivered SGA babies, while the non-SGA group consisted of 986 women with eutrophic newborns. RESULTS: An excessive risk of SGA was found in the group reporting heavy physical effort at work. The physical effort perceived as heavy by pregnant women appeared to be a better predictor of SGA manifestation than the estimated energy expenditure at work. CONCLUSIONS: The information obtained from a pregnant worker should constitute an essential decisive factor for determining the time of work cessation during pregnancy.
Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.
In South-Eastern region of Poland (near Lublin), where frequency of scab (fusariosis) is much higher than in other parts of the country, during harvest of 1993 kernels of 25 winter wheat cultivars were collected. On the basis of morphological studies Fusarium graminearum was found in 42% of investigated samples while other fungi appeared less frequently: F. nivale and F. poae (35%), F. avenaceum (31%) and F. culmorum (12%). Chemical analysis (by HPLC) revealed that the tested cultivars were contaminated with deoxynivalenol (96% of investigated samples), its acetyl derivatives (48%), nivalenol (76%) and moniliformin (28%). The average levels of the metabolite concentrations were as follows: 104; 16; 97; and 63 micrograms/kg, respectively. Co-occurrence of 2 toxic metabolites was found in the following percentage of the positive samples: deoxynivalenol and nivalenol (72%), deoxynivalenol and moniliformin, as well as nivalenol and moniliformin (24%). Usually (71-83% of contaminated samples) mycotoxins were accumulated in the concentration range > or = 10, < 100 micrograms/kg.
The study examined the relationship between marital status and the body mass index (BMI) and the prevalence of overweight and obesity in the Polish population. The sample included 2,266 men and 4,122 women, 25-60 years of age, who were occupationally active inhabitants of Wroclaw, in southwestern Poland. Marital status was defined by two categories: never married and presently married, and two groups in each category were established on the basis of educational level: well-educated (12 or more years in school) and poorly educated (less than 12 years in school). The subjects were also divided into four age groups: 25-30, 31-40, 41-50, and 51-60 years. Height and weight were measured and the BMI was calculated. Three categories of the BMI were established: normal, BMI < 25.0 kg/m(2), overweight, BMI > or = 25 < 30 kg/m(2), and obese, BMI > or = 30 kg/m(2). In each age and educational group, married individuals had a higher BMI than those who were never married. With the exception of well-educated males 51-60 years, differences in the BMI between married and never married individuals increased with age. In general, married men and women were more likely to be overweight and obese than never married individuals. The results indicated a significant association (P < 0.001) between marital status and the BMI in both sexes. After age, marital status was the most important predictor of overweight/obesity among men (P < 0.001), whereas educational level did not have a significant role. Among women, age, marital status, and education were significantly (P < 0.001) related to the BMI.
The phenomenon of kin-oriented help, according to inclusive fitness theory, should be of crucial importance with respect to the process of reproduction. This is due to the fact that the devoted time and resources might indirectly contribute to the reproductive performance of a donor. This study aimed at analyzing the kin effects on fertility in order to check whether help received from kinsmen enhance a recipient's reproduction in terms of parity transition risk, completed fertility, and the number of survivors. The data came from reconstitution of church registers from Bejsce parish, Poland. To estimate the kin effect, regression models for count outcomes and techniques of multilevel event history analysis were applied. The analyses have shown that completed fertility and parity-specific transition risks are strongly influenced by various kin groups. Moreover, a multilevel hazard model revealed differences in the patterns of the kin influence among controlled fertility than among natural fertility birth cohorts. Female reproductive outcome is influenced mainly by the presence of siblings and postreproductive helpers (grandparents). However, there is a negative impact of so-called helpers-at-the-nest (older children in the household) on parity transition risks.
A hypothesis is presented to explain the pathogenesis of the Poland, Klippel-Feil, and Möbius anomalies, isolated absence of the pectoralis major with breast hypoplasia, isolated terminal transverse limb defects, and the Sprengel anomaly. We propose that these conditions are the result of an interruption of the early embryonic blood supply in the subclavian arteries, the vertebral arteries and/or their branches, and hypothesize that the occlusions occur at specific locations in these vessels during or around the sixth week of embryologic development and produce predictable patterns of defects. The term subclavian artery supply disruption sequence (SASDS) is suggested for the group of birth defects represented by the above conditions. Possible causes for interruption of embryonic blood supply are discussed.
We describe a female infant with apparent Poland anomaly (PA) and limb body wall defect. Analysis of the defects suggest that a disruption of the lateral embryonic plate mesoderm may have been responsible for the observed lesions. Because of the overlap of this case with PA, we re-examined previous reports of this syndrome. We think that the lesions could be equally well explained as a mesodermal disruption, and point out a previously unrecognised discrepancy between sex and affected side in sporadic PA and inherited PA which supports this view.
The microregion of Ostrów Lednicki in the province of Wielkopolska was the center of the formation of the Polish State in Early Middle Ages. The analysis of skeletal remains and parish records from the region documented the biological status of inhabitants and its changes over a millennium. The study material comprised 424 human skeletons from an Early Medieval burial ground on Lake Lednica, records of 2,704 deaths from the registers of the Roman Catholic parish of Dziekanowice, made between 1818-1903, data on the deaths of 929,192 inhabitants of rural areas all over the province Wielkopolska obtained from Prussian statistical materials for the years 1865-1900, and comparative data from the literature. Assuming both a stationary population model and a stable population model with nonzero natural increase, parameters of life tables and measures of opportunity for natural selection (Crow's index I(m), potential gross reproductive rate R(pot), and the biological state index I(bs)) were calculated for the Early Middle Ages and for the two periods of the 19th century which were characterized by different laws of land ownership and thus different rural economies. In the first period, peasants were tenants, whereas in the second, they were given freehold of the land they cultivated. Causes of death were also analyzed. A distinct increase in longevity from the early Middle Ages to the end of the 19th and the beginning of the 20th century was found. This was related to a higher level of demographic development in the parish of Dziekanowice during the 19th century, which was achieved earlier than in other areas of Poland. This was confirmed by genetic measures: coefficients of exogamy and coefficients of kinship. The reasons were related to the historical prominence of this region and to its proximity to the first two capitals of the Polish state, Gniezno and Poznań.
Clinical examination of the teeth and the mouth was carried out on a group of 133 "Old Believers," 54 males and 79 females, and a control group of 138 Poles living in the same area of Augostova in northeast Poland, 63 males and 75 females. Studying the frequency of Carabelli's cusp, shovel-shaped incisors, missing teeth, microdonita, supernumerary teeth, and torus palatinus in both groups, it was found that Carabelli's cusp and torus palatinus are more frequent among Poles. Such differences could be attributed to differences in ethnic origin of the two groups.
The purpose of this paper is to document and interpret urban-rural differences in mortality in the past. To this end, we used data on mortality in Wielkopolska, Poland, in the 19th century and at the beginning of the 20th century. The data on mortality in rural areas (N = 1,173,910 deceased), small towns (N = 573,903 deceased), and Poznań, the capital of the Wielkopolska region (N = 86,352 deceased), were gathered from original Prussian statistical yearbooks (Preussische Statistik). Causes of death were also analyzed (rural areas, N = 449,576 deceased; small towns, N = 238,365 deceased; Poznań, N = 61,512 deceased). Mortality measures such as crude death rate (CDR), infant death rate (IDR), and neonatal and postneonatal death rates were calculated. Life tables were constructed for both stationary and stable population models and measures of the opportunity for natural selection calculated (Crow's index I(m), potential gross reproduction rate R(pot), and biological state index I(bs)). Relative frequencies of leading causes of death were computed. Stratification depending on the place of residence was evident in all mortality measures as well as in the values of the life tables and the measures of the opportunity for natural selection, but it was reverse of what is observed today in developed countries. In Poznań (a large industrial city), the mortality situation was the least favorable. It was caused by large population density, lack of water supply and sewage systems (up to 1896), and bad working conditions. The values of CDR ranged between 26.89-31.46, and IDR between 190.6-280.5. Newborn life expectancy (for a stable population model) was 31.6 years, I(m) = 0.79, R(pot) = 0.85, and I(bs) = 0.47. The most common causes of death were tuberculosis, other diseases of the respiratory and circulatory systems, dysentery and diarrhea, and cancer. These diseases were less common in rural areas, so they had the most favorable values of mortality measures (CDR between 22.87-27.32, IDR between 181.8-219.4, life expectancy of newborn e(0) = 42.12, I(m) = 0.55, R(pot) = 0.93, I(bs) = 0.60). Infectious diseases (other than tuberculosis), frailty at birth, and frailty in old age were the most frequent causes of death in rural areas. Small towns (population <20,000) had a mortality intermediate between city and rural areas.
The paper deals with living systems at the social and individual levels of analysis. We examine the individual's perception of membership in an ethnically defined social group, in particular the hypotheses regarding the implicit definitions of one's own social group elicited from the negatives of perceived differences from members of other groups. The specific hypotheses concern the relationship between the perceived differences and the geographical distance to the group. These hypotheses were tested on the material collected from evaluations of Lithuanian folk songs from various regions by Lithuanian minority in Poland. In addition to the results being generalizable to other ethnic groups, and to perception not restricted to songs but also concerning other aspects of culture (allowing mostly categorical judgments), the results are of interest because of the statistical methodology used, which involves resampling techniques for categorical data.
Nucleic acid testing (NAT) for hepatitis B virus (HBV) has been performed in Poland since 2005 on samples seronegative for hepatitis B surface antigen (HBsAg), anti-hepatitis C virus (anti-HCV), and anti-human immunodeficiency virus (anti-HIV). Tools included 24-donation pool testing (PT) using Cobas Amplicor or in individual donations (ID) by Procleix Ultrio. Seven of 761,666 (1:108,800) and 21/250,191 (1:11,900) HBV DNA-positive donations were identified and confirmed by alternative methods. HBV DNA load ranged between 11.6 and 4.6 x 10(4) IU/mL in 11 samples and could not be quantified in 17 samples. HBV genotypes A (56%) and D (4%) were found. The analysis of combined results from index, follow-up, and look-back samples identified four groups: (1) Two cases tested HBsAg positive with alternative, more sensitive, assays; (2) Four cases were in the pre-seroconversion window period; (3) Eight cases had a fluctuating pattern of HBV DNA and anti-HBs detection (recovered infection); and (4) twelve cases carried anti-HBc without anti-HBs, which might correspond to either chronic or recovered "occult" HBV infection. One donor with no HBV markers in the follow-up was excluded, and another was in the window period preceding anti-HBs. HBV NAT identified more confirmed positive donors than HCV or HIV NAT, and 1:250,000 could not be detected by anti-HBc screening. Serological and molecular studies on follow-up and look-back samples are important to classify donors. In conclusion, further studies are needed to determine whether the considerably higher yield of HBV DNA detection obtained with individual donation screening improves blood safety compared with anti-HBc screening.
The right to a free health service is identified as one of the founding rules of socialism; yet other sources of funding, both public and private, should not be neglected. This article reviews the major sources of financing health services in Poland. In particular, a description is made of the size and composition of funding from non-governmental sources including: quasi-budget funds, other funds, and out-of-pocket payments; and some proposals are made for change. Further work is needed in developing the criteria by which policy choices can be made, and in developing the information base; at the same time, political and social criteria will still be very important, not least on the issue of user charges.
There is increasing evidence that hereditary factors play a greater role in ovarian cancer than in any of the other common cancers of adulthood. This is attributable, to a large extent, to a high frequency of mutations in the BRCA1 or BRCA2 genes. In Poland, 3 common founder mutations in BRCA1 account for the majority of families with identified BRCA mutations. Our study was conducted in order to estimate the prevalence of any of 3 founder BRCA1 mutations (5382insC, C61G and 4153delA) in 364 unselected women with ovarian cancer, and among 177 women with ovarian cancer and a family history of breast or ovarian cancer. A mutation was identified in 49 out of 364 unselected women with ovarian cancer (13.5%) and in 58 of 177 women with familial ovarian cancer (32.8%). The majority of women with ovarian cancer and a BRCA1 mutation have no family history of breast or ovarian cancer. The high frequency of BRCA1 mutations in Polish women with ovarian cancer supports the recommendation that all Polish women with ovarian cancer should be offered testing for genetic susceptibility, and that counseling services be made available to them and to their relatives. It is important that mutation surveys be conducted in other countries prior to the introduction of national genetic screening programs.
It has been suggested based on familial data that Nijmegen breakage syndrome (NBS) heterozygotes have an increased risk of malignant tumors. We found 15 carriers of the 657del5 mutation and 8 carriers of the R215W molecular variant of the NBS1 gene among 1,289 consecutive patients from Central Poland with various cancers and only 10 and 4 such carriers, respectively, in 1,620 controls from this region. Most of the 657del5 mutation carriers were found among patients with melanoma (4/105), non-Hodgkin lymphoma (2/42) and breast cancer (4/224) and of the 234 patients with colorectal carcinoma 3 carried the 657del5 mutation and 3 others the R215W molecular variant. The frequencies of 657del5 mutation carriers among patients with melanoma and non-Hodgkin lymphoma and of R215W carriers in patients with colorectal cancer were significantly higher than in controls (p < 0.01, < 0.05 and < 0.05 respectively). The pooled frequencies of 657del5 and R215W mutations in all cancer patients were also significantly higher than in controls (p < 0.05). Two carriers of the 657del5 mutation had second primary tumors. Malignant tumors among parents and siblings of 657del5 mutation carriers (14/77) were twice more frequent than in population controls. Three carriers of this mutation (2 probands with melanoma) reported melanoma in relatives. These results suggest strongly that NBS1 heterozygosity may be associated with elevated risk of some cancers. Larger studies are needed to evaluate the impact of the high frequency of germline NBS1 mutations on the cancer burden in the Slav populations.