Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genomic database”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 829 records · Page 46Linked to original sources
PubMed2004

New and emerging pharmacological targets for neuropathic pain.

Increasing knowledge of the molecular consequences of nerve injury and the availability of genome databases has greatly increased the range of potential targets for the pharmacological management of neuropathic pain. Controlling neuronal sensitization and the associated alterations in gene expression, protein modification, and neuronal excitability is the key to managing neuropathic pain. Control of neuronal sensitization can occur through inhibition of nerve injury-associated production of cytokines, activation of glial cells, modulation of potassium channel subtypes, mitogen-activated protein kinases, the ubiquitin-proteasome system, or the protection and amplification of spinal cord dorsal horn inhibitory systems. These new and already established targets promise unparalleled opportunities for the prevention, management, and resolution of persistent pain states following nerve injury.

Cytokines↗
PubMed2026

Identification of a Novel Splice-Site variant in TACR3 (c.888 + 1G > A) Associated with Asthenozoospermia and Hypogonadotropic Hypogonadism in an Iranian Family.

BACKGROUND: TACR3 encodes the receptor for neurokinin B, a key regulator of the hypothalamic-pituitary-gonadal axis. Disruption of this pathway can impair gonadotropin release and male reproductive function. Given the genetic heterogeneity of male infertility, this study aimed to identify novel variants in TACR3 that may underlie asthenozoospermia and related hormonal abnormalities. METHODS: Fifteen infertile men with confirmed asthenozoospermia were enrolled. Whole-exome sequencing (WES) was performed on genomic DNA from peripheral blood, and the candidate variant was validated by Sanger sequencing. Functional predictions were made using PolyPhen-2, SIFT, MutationTaster, and REVEL. TACR3 mRNA expression levels were assessed by real-time PCR in available samples. RESULTS: A novel splice-site variant, TACR3 (NM_001059.3:c.888 + 1G > A), was detected and found to segregate with infertility in one family, appearing homozygously in two infertile brothers and heterozygously in the proband with severe asthenozoospermia. The variant was absent in public and local genomic databases, suggesting its extremely rare frequency. Furthermore, RT-PCR showed a dramatic reduction or complete loss of TACR3 expression in affected individuals, confirming its deleterious effect on splicing and mRNA stability. CONCLUSION: We identified a previously unreported splice-site mutation in TACR3 (c.888 + 1G > A) that likely causes familial infertility by disrupting the neurokinin B/NK3R signaling pathway. While the heterozygous proband exhibited severe asthenozoospermia, the homozygous brothers displayed hormonal profiles typical of hypogonadotropic hypogonadism. These findings extend the mutational landscape of TACR3 and highlight its essential contribution to male reproductive endocrinology.

Humans↗
PubMed1996

FISH digital imaging microscopy in mosquito genomics.

The yellow fever mosquito, Aedes aegypti, transmits pathogens that affect both humans and livestock, and has been the focus of extensive research to identify genetic loci that may be useful in control strategies. Fluorescence in situ hybridization (FISH) and digital imaging microscopy have provided a rapid mechanism to populate the physical map with probes derived from genetic markers, cDNAs and recombinant genomic libraries. When the physical and genetic linkage maps are aligned, map-based cloning will allow the rapid isolation of target genomic sequences. The strategy of FISH mapping and the results of initial hybridization studies are reviewed here by Martin Ferguson, Susan Brown and Dennis Knudson. An Ae. aegypti-specific genomic database, which collates data from mapping studies, sequences, references and other relevant information, is also discussed.

Journal Article↗
PubMed1995

A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis.

Graphical dot-matrix plots can provide the most complete and detailed comparison of two sequences. Presented here is DOTTER2, a dot-plot program for X-windows which can compare DNA or protein sequences, and also DNA versus protein. The main novel feature of DOTTER is that the user can vary the stringency cutoffs interactively, so that the dot-matrix only needs to be calculated once. This is possible thanks to a 'Greyramp tool' that was developed to change the displayed stringency of the matrix by dynamically changing the greyscale rendering of the dots. The Greyramp tool allows the user to interactively change the lower and upper score limit for the greyscale rendering. This allows exploration of the separation between signal and noise, and fine-grained visualisation of different score levels in the dot-matrix. Other useful features are dot-matrix compression, mouse-controlled zooming, sequence alignment display and saving/loading of dot-matrices. Since the matrix only has to be calculated once and since the algorithm is fast and linear in space, DOTTER is practical to use even for sequences as long as cosmids. DOTTER was integrated in the gene-modelling module of the genomic database system ACEDB3. This was done via the homology viewer BLIXEM in a way that also allows segments from the BLAST suite of searching programs to be superimposed on top of the full dot-matrix. This feature can also be used for very quick finding of the strongest matches. As examples, we analyse a Caenorhabditis elegans cosmid with several tandem repeat families, and illustrate how DOTTER can improve gene modelling.

Amino Acid Sequence↗
PubMed1991

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence↗
PubMedDate not supplied

Knowledge-assisted recognition of cluster boundaries in gene expression data.

BACKGROUND AND MOTIVATION: DNA microarray technology has made it possible to determine the expression levels of thousands of genes in parallel under multiple experimental conditions. Genome-wide analyses using DNA microarrays make a great contribution to the exploration of the dynamic state of genetic networks, and further lead to the development of new disease diagnosis technologies. An important step in the analysis of gene expression data is to classify genes with similar expression patterns into the same groups. To this end, hierarchical clustering algorithms have been widely used. Major advantages of hierarchical clustering algorithms are that investigators do not need to specify the number of clusters in advance and results are presented visually in the form of a dendrogram. However, since traditional hierarchical clustering methods simply provide results on the statistical characteristics of expression data, biological interpretations of the resulting clusters are not easy, and it requires laborious tasks to unveil hidden biological processes regulated by members in the clusters. Therefore, it has been a very difficult routine for experts. OBJECTIVE: Here, we propose a novel algorithm in which cluster boundaries are determined by referring to functional annotations stored in genome databases. MATERIALS AND METHODS: The algorithm first performs hierarchical clustering of gene expression profiles. Then, the cluster boundaries are determined by the Variance Inflation Factor among the Gene Function Vectors, which represents distributions of gene functions in each cluster. Our algorithm automatically specifies a cutoff that leads to functionally independent agglomerations of genes on the dendrogram derived from similarities among gene expression patterns. Finally, each cluster is annotated according to dominant gene functions within the respective cluster. RESULTS AND CONCLUSIONS: In this paper, we apply our algorithm to two gene expression datasets related to cell cycle and cold stress response in budding yeast Saccharomyces cerevisiae. As a result, we show that the algorithm enables us to recognize cluster boundaries characterizing fundamental biological processes such as the Early G1, Late G1, S, G2 and M phases in cell cycles, and also provides novel annotation information that has not been obtained by traditional hierarchical clustering methods. In addition, using formal cluster validity indices, high validity of our algorithm is verified by the comparison through other popular clustering algorithms, K-means, self-organizing map and AutoClass.

Algorithms↗
PubMed2004

Identification and functional analysis of a novel human KRAB/C2H2 zinc finger gene ZNF300.

A novel human zinc finger gene, ZNF300, was isolated from human embryos on the base of the enrichment of C2H2-specific mRNAs. The ZNF300 cDNA is 3104 bp long and encodes a 604-amino acid protein with an amino-terminal KRAB domain, and 12 carboxyl-terminal C2H2 zinc finger motifs. According to the genome database, ZNF300 is assigned to chromosome 5q33.1. Northern blot analysis revealed that the ZNF300 transcripts are expressed mostly in heart, skeletal muscle and brain. ZNF300 is localized to the nucleus and the KRAB domain of ZNF300 protein exhibits transcription repressor activity. These results suggest that ZNF300 is a ubiquitous transcription repressor in the nucleus.

Amino Acid Sequence↗
PubMed2005

Nine new human Rhodopsin family G-protein coupled receptors: identification, sequence characterisation and evolutionary relationship.

We report nine new members of the Rhodopsin family of human G protein-coupled receptors (GPCRs) found by searches in the genome databases. BLAST searches and phylogenetic analyses showed that only four of the receptors are closely related to previously characterised GPCRs, GPR150 and GPR154 to oxytocin/vasopressin receptors, GPR152 to CRTH2/FPRs and GPR165 to GPR72/NPYR. Four of the receptors, GPR139, GPR146, GPR153 and GPR162, have one other orphan GPCRs as close relative while GPR148 lacks close relatives. We have identified in total 37 orthologues for the new receptors, primarily from rat, mouse, chicken, fugu and zebrafish. GPR162 and GPR139 are remarkably well conserved while GPR148 seems to be evolving rapidly. Analyses using expressed sequence tags (ESTs) indicate that all the new receptors except GPR153 have the CNS as a major site of expression.

Expressed Sequence Tags↗
PubMed2004

Connexin phosphorylation as a regulatory event linked to gap junction channel assembly.

Gap junctions, composed of proteins from the connexin family, allow for intercellular communication between cells and are important in development and maintenance of cell homeostasis. Phosphorylation has been implicated in the regulation of gap junctional communication at several stages of the cell cycle and the connexin "lifecycle", such as trafficking, assembly/disassembly, degradation, as well as in the gating of "hemi" channels or intact gap junction channels. This review focuses on how phosphorylation can regulate the early stages of the connexin life cycle through assembly of functional gap junctional channels. The availability of sequences from the human genome databases has indicated that the number of connexins in the gene family is approximately 20, but we know mostly about how connexin43 (Cx43) is regulated. Recent technologies and investigations of interacting proteins have shown that activation of several kinases including protein kinase A, protein kinase C (PKC), p34(cdc2)/cyclin B kinase, casein kinase 1 (CK1), mitogen-activated protein kinase (MAPK) and pp60(src) kinase can lead to phosphorylation of the majority of the 21 serine and two of the tyrosine residues in the C-terminal region of Cx43. While many studies have correlated changes in kinase activity with changes in gap junctional communication, further research is needed to directly link specific phosphorylation events with changes in connexin oligomerization and gap junction assembly.

Amino Acid Sequence↗
PubMed2005

Alkaline pH homeostasis in bacteria: new insights.

The capacity of bacteria to survive and grow at alkaline pH values is of widespread importance in the epidemiology of pathogenic bacteria, in remediation and industrial settings, as well as in marine, plant-associated and extremely alkaline ecological niches. Alkali-tolerance and alkaliphily, in turn, strongly depend upon mechanisms for alkaline pH homeostasis, as shown in pH shift experiments and growth experiments in chemostats at different external pH values. Transcriptome and proteome analyses have recently complemented physiological and genetic studies, revealing numerous adaptations that contribute to alkaline pH homeostasis. These include elevated levels of transporters and enzymes that promote proton capture and retention (e.g., the ATP synthase and monovalent cation/proton antiporters), metabolic changes that lead to increased acid production, and changes in the cell surface layers that contribute to cytoplasmic proton retention. Targeted studies over the past decade have followed up the long-recognized importance of monovalent cations in active pH homeostasis. These studies show the centrality of monovalent cation/proton antiporters in this process while microbial genomics provides information about the constellation of such antiporters in individual strains. A comprehensive phylogenetic analysis of both eukaryotic and prokaryotic genome databases has identified orthologs from bacteria to humans that allow better understanding of the specific functions and physiological roles of the antiporters. Detailed information about the properties of multiple antiporters in individual strains is starting to explain how specific monovalent cation/proton antiporters play dominant roles in alkaline pH homeostasis in cells that have several additional antiporters catalyzing ostensibly similar reactions. New insights into the pH-dependent Na(+)/H(+) antiporter NhaA that plays an important role in Escherichia coli have recently emerged from the determination of the structure of NhaA. This review highlights the approaches, major findings and unresolved problems in alkaline pH homeostasis, focusing on the small number of well-characterized alkali-tolerant and extremely alkaliphilic bacteria.

Alkalies↗
PubMed2005

The first archaeal agmatinase from anaerobic hyperthermophilic archaeon Pyrococcus horikoshii: cloning, expression, and characterization.

Agmatinase is one of the key enzymes in the biosynthesis of polyamines such as putrescine and sperimidine from arginine in microorganisms. The gene (PH0083) encoding the putative agmatinase of hyperthermophilic archaeon Pyrococcus horikoshii was identified based on the genome database. The gene was cloned and expressed, and the product was mainly obtained as inactive inclusion body in Escherichia coli. The inclusion body was dissolved in 6 M guanidine-HCl and successively refolded to active enzyme by the dilution of the denaturant. The enzyme exclusively catalyzed the hydrolysis of agmatine, but not arginine. This indicates that PH0083 codes agmatinase. The enzyme required divalent cations such as Co(2+), Ca(2+) and Mn(2+) for the activity. The highest activity was observed under fairly alkaline conditions, like pH 11. The purified recombinant enzyme consisted of four identical subunits with a molecular mass of 110-145 kDa. The enzyme was extremely thermostable: the full activity was retained on heating at 80 degrees C for 10 min, and a half of the activity was retained by incubation at 90 degrees C for 10 min. From a typical Michaelis-Menten type kinetics, an apparent K(m) value for agmatine was determined to be 0.53 mM. Phylogenic analysis revealed that the agmatinase from P. horikoshii does not belong to any clusters of enzymes found in bacteria and eukarya. This is the first description of the presence of archaeal agmatinase and its characteristics.

Amino Acid Sequence↗
PubMed2005

4-Pyridoxolactonase from a symbiotic nitrogen-fixing bacterium Mesorhizobium loti: cloning, expression, and characterization.

4-Pyridoxolactonase is involved in the degradation pathway for pyridoxine, a free form of vitamin B6. The gene (mlr6805) encoding the putative 4-pyridoxolactonase of nitrogen fixing symbiotic microorganism Mesorhizobium loti MAFF303099 has been identified based on the genome database. The gene was cloned and overexpressed in a cotransformant Escherichia coli cell. The recombinant enzyme was dimeric protein and contained one mole of Zn2+ per mole of subunit. The enzyme showed about 30% identity with various N-acylhomoserine lactone lactonases and metallo-beta-lactamases. The phylogram made with ClustalW shows that 4-pyridoxolactonase makes a cluster with Agrobacterium tumefaciens acyl-homoserine lactone lactonase. The alignment of amino acid sequences suggests that 4-pyridoxolactonase has three histidine residues probably involved in binding of Zn2+.

Agrobacterium tumefaciens↗
PubMed2005

Protein kinases as targets for antimalarial intervention: Kinomics, structure-based design, transmission-blockade, and targeting host cell enzymes.

The surge of interest in protein kinases as targets for chemotherapeutic intervention in a number of diseases such as cancer and neurodegenerative disorders has stimulated research aimed at determining whether enzymes of this class might also be considered as targets in the context of diseases caused by parasitic protists. Here, we present an overview of recent developments in this field, concentrating (i) on the benefits gained from the availability of genomic databases for a number of parasitic protozoa, (ii) on the emerging field of structure-aided design of inhibitors targeting protein kinases of parasitic protists, (iii) on the concept known as transmission-blockade, whereby kinases implicated in the development of the parasite in their arthropod vector might be targeted to interfere with disease transmission, and (iv) on the possibility of controlling parasitic diseases through the inhibition of host cell protein kinases that are required for the establishment of infection by the parasites.

Animals↗
PubMed2003

Identification of a SNARE protein required for vacuolar protein transport in Schizosaccharomyces pombe.

Intracellular vesicle trafficking is mediated by a set of SNARE proteins in eukaryotic cells. Several SNARE proteins are required for vacuolar protein transport and vacuolar biogenesis in Saccharomyces cerevisiae. A search of the Schizosaccharomyces pombe genome database revealed a total of 17 SNARE-related genes. Although no homologs of Vam3p, Nyv1p, and Vam7p have been found in S. pombe, we identified one SNARE-like protein that is homologous to S. cerevisiae Pep12p. However, the disruptants transport vacuolar hydrolase CPY (SpCPY) to the vacuole normally, suggesting that the Pep12 homolog is not required for vacuolar protein transport in S. pombe cells. To identify the SNARE protein(s) involved in Golgi-to-vacuole protein transport, we have deleted four SNARE homolog genes in S. pombe. SpCPY was significantly missorted to the cell surface on deletion of one of the SNARE proteins, Fsv1p (SPAC6F12.03c), with no apparent S. cerevisiae ortholog. In addition, sporulation, endocytosis, and in vivo vacuolar fusion appear to be normal in fsv1Delta cells. These results showed that Fsv1p is mainly involved in vesicle-mediated protein transport between the Golgi and vacuole in S. pombe cells.

Amino Acid Sequence↗
PubMed2004

The instantly released Drosophila immune proteome is infection-specific.

In this study, we analyzed the hemolymph proteome of Drosophila third instar larvae, which were induced with a suspension of Gram-positive bacteria or yeast. Profiling of the hemolymph proteins of infected versus non-infected larvae was performed by two-dimensional difference gel electrophoresis. Infection with Micrococcus luteus or Saccharomyces cerevisiae induced, respectively, 20 and 19 differential protein spots. The majority of the spots are specifically regulated by one pathogen, whereas only a few spots correspond to proteins altered in all cases of challenging (including after challenge with lipopolysaccharides). All of the upregulated proteins can be assigned to specific aspects of the immune system, as they did not increase in the hemolymph of sterile pricked larvae. Next to known immune proteins, unannotated proteins were identified such as CG4306 protein, which has homologues with unknown function in all metazoan genome databases available today.

Animals↗
PubMed2004

Orotate phosphoribosyltransferase and orotidine 5'-monophosphate decarboxylase exist as multienzyme complex in human malaria parasite Plasmodium falciparum.

Plasmodium falciparum, the causative agent of the most lethal form of human malaria, totally depends on de novo pyrimidine biosynthetic pathway. Orotate phosphoribosyltransferase (OPRT) and orotidine 5'-monophosphate decarboxylase (OMPDC), the fifth and sixth enzymes in the pathway catalyzing formation of uridine 5'-monophosphate (UMP), remain largely uncharacterized in the protozoan parasite. In this study, we achieved purification of OPRT and OMPDC to near homogeneity from P. falciparum cultivated in vitro. The OPRT and OMPDC activities were co-eluted in all chromatographic columns during purification, suggesting the purified proteins exist as a multienzyme complex with a molecular mass of 140+/-8 kDa and contain two subunits each of OPRT and OMPDC. Monomeric forms of OPRT and OMPDC had molecular masses of 32+/-3 and 38+/-3 kDa, respectively, in agreement with those of proteins predicted from P. falciparum genome database. Interestingly, kinetic parameters and inhibitory constants of both OPRT and OMPDC activities were found to be different to those of the bifunctional human red cell UMP synthase. Our evidence provides the first example of OPRT and OMPDC existing as a multienzyme complex.

Amino Acid Sequence↗
PubMed2005

Characterization of O-mannosyltransferase family in Schizosaccharomyces pombe.

Protein O-glycosylation is an essential protein modification in eukaryotic cells. In Saccharomyces cerevisiae, O-mannosylation is initiated in the lumen of the endoplasmic reticulum by O-mannosyltransferase gene products (Pmt1p-7p). A search of the Schizosaccharomyces pombe genome database revealed a total of three O-glycoside mannosyltransferase homologs (ogm1+, ogm2+, and ogm4+), closely related to Saccharomyces cerevisiae PMT1, PMT2, and PMT4. Although individual ogm genes were not found to be essential, ogm1Delta and ogm4Delta mutants exhibited aberrant morphology and failed to agglutinate during mating. The phenotypes of the ogm4Delta mutant were not complemented by overexpression of ogm1+ or ogm2+, suggesting that each of the Ogm proteins does not have overlapping functions. Heterologous expression of a chitinase from S. cerevisiae in the ogm mutants revealed that O-glycosylation of chitinase had decreased in ogm1Delta cells. A GFP-tagged Fus1p from S. cerevisiae was specifically not glycosylated and accumulated in the Golgi in ogm4Delta cells. These results indicate that O-glycosylation initiated by Ogm proteins plays crucial physiological roles and can serve as a sorting determinant for protein transport of membrane glycoproteins in S. pombe.

Animals↗
PubMed2005

The new vertebrate CYP1C family: cloning of new subfamily members and phylogenetic analysis.

Two novel CYP1 genes from teleost fish constituting a new subfamily have been cloned. These paralogous sequences are designated CYP1C1 and CYP1C2. Both genes were initially obtained from untreated scup Stenotomus chrysops tissues by RT-PCR and RACE. Scup CYP1C1 and CYP1C2 code for 524 and 525 amino acids, respectively, and share 80-81% identity at the nucleotide and amino acid levels. Orthologues of CYP1C1 and CYP1C2 were identified in genome databases for other fish species, and both CYP1B1 and CYP1C1 were cloned from zebrafish (Danio rerio). Phylogenetic analysis shows that CYP1Cs and CYP1Bs constitute a sister clade to the CYP1As. Analysis of sequence domains likely to have functional significance suggests that the two CYP1Cs in scup may have catalytic functions and/or substrate specificity that differ from each other and from those of mammalian CYP1Bs or CYP1As. RT-PCR results indicate that CYP1C1 and CYP1C2 are variously expressed in several scup organs.

Amino Acid Sequence↗