Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PECTINS”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 811 records · Page 45Linked to original sources

Citrus pectin and cholesterol interact to regulate hepatic cholesterol homeostasis and lipoprotein metabolism: a dose-response study in guinea pigs.

Guinea pigs were fed increasing concentrations of citrus pectin (CP) (0-12.5%, wt/wt) with low (LC, 0.04%) or high (HC, 0.25%) cholesterol. Animals fed LC diets had reduced plasma LDL concentrations with 10% and 12.5% CP and hepatic membrane apolipoprotein B/E receptor expression increased with high dosages of CP. Hepatic 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase activity increased with 12.5% CP whereas hepatic cholesterol concentrations and acyl-CoA:cholesterol acyltransferase (ACAT) activity were not different. In contrast, with HC diets, plasma LDL concentrations were reduced in a dose-response manner by 29%, 30%, and 67% with 7.5%, 10%, and 12.5% CP intake (P < 0.001) and apolipoprotein B/E receptor number was increased and inversely correlated with plasma LDL in the HC group (r = -0.81, P < 0.005). Animals fed HC diets had a dose-dependent decrease in hepatic cholesterol and ACAT activity, with intake of 12.5% CP having the major effect. Hepatic HMG-CoA reductase activity was suppressed by HC diets and only intake of 12.5% CP reversed this suppression. The most significant effects of CP on hepatic cholesterol, enzymes of hepatic cholesterol homeostasis, and the apolipoprotein B/E receptor were in animals fed the HC diets. These metabolic alterations partially explain the reduced plasma LDL of guinea pigs fed large amounts of CP.

Animals↗

Modulation of the lung colonization of B16-F1 melanoma cells by citrus pectin.

CONTEXT: Studies have shown that the galactoside-containing simple sugars and anti-galactoside-binding lectin antibodies may affect experimental tumor cell metastasis. However, the limited number of reagents used thus far necessitate further observations. PURPOSE: Natural citrus pectin (CP) and pH-modified CP (MCP), rich in galactose residues, were used to study the involvement of carbohydrates containing galactoside residues in cellular interaction in vitro and in lung colonization in vivo of B16-F1 melanoma cells. METHODS: B16-F1 melanoma cells were incubated with various concentrations of CP and MCP. Their ability to form homotypic aggregation in vitro and tumor lung colonization in vivo in 8-week-old female C57BL/6 mice was then analyzed. RESULTS: The CP binds to the surface of B16-F1 melanoma cells; this binding can be inhibited by lactose at a concentration of 0.15 M. Intravenous injection of the murine B16-F1 melanoma cells with the natural CP resulted in a significant increase (up to threefold) in the appearance of tumor colonies in the lung and in increased homotypic aggregation properties of the cells, while injection of MCP significantly decreased B16-F1 experimental metastasis (greater than 90%). CONCLUSIONS: Tumor galactoside-binding proteins mediate cellular recognition by linking oligosaccharides with terminal D-galactoside residues on adjacent cells. Successful interference with such a process with MCP may lead to a reduced ability to form tumor cell emboli and metastasis. IMPLICATIONS: These findings imply that the galactose-containing carbohydrate side chains of CP might mimic or compete with the natural ligand(s) of the tumor galactoside-binding protein (gal-lectin) and thus affect cellular interactions relevant for metastasis.

Animals↗

Inhibition of human cancer cell growth and metastasis in nude mice by oral intake of modified citrus pectin.

BACKGROUND: The role of dietary components in cancer progression and metastasis is an emerging field of clinical importance. Many stages of cancer progression involve carbohydrate-mediated recognition processes. We therefore studied the effects of high pH- and temperature-modified citrus pectin (MCP), a nondigestible, water-soluble polysaccharide fiber derived from citrus fruit that specifically inhibits the carbohydrate-binding protein galectin-3, on tumor growth and metastasis in vivo and on galectin-3-mediated functions in vitro. METHODS: In vivo tumor growth, angiogenesis, and metastasis were studied in athymic mice that had been fed with MCP in their drinking water and then injected orthotopically with human breast carcinoma cells (MDA-MB-435) into the mammary fat pad region or with human colon carcinoma cells (LSLiM6) into the cecum. Galectin-3-mediated functions during tumor angiogenesis in vitro were studied by assessing the effect of MCP on capillary tube formation by human umbilical vein endothelial cells (HUVECs) in Matrigel. The effects of MCP on galectin-3-induced HUVEC chemotaxis and on HUVEC binding to MDA-MB-435 cells in vitro were studied using Boyden chamber and labeling assays, respectively. The data were analyzed by two-sided Student's t test or Fisher's protected least-significant-difference test. RESULTS: Tumor growth, angiogenesis, and spontaneous metastasis in vivo were statistically significantly reduced in mice fed MCP. In vitro, MCP inhibited HUVEC morphogenesis (capillary tube formation) in a dose-dependent manner. In vitro, MCP inhibited the binding of galectin-3 to HUVECs: At concentrations of 0.1% and 0.25%, MCP inhibited the binding of galectin-3 (10 micro g/mL) to HUVECs by 72.1% (P =.038) and 95.8% (P =.025), respectively, and at a concentration of 0.25% it inhibited the binding of galectin-3 (1 micro g/mL) to HUVECs by 100% (P =.032). MCP blocked chemotaxis of HUVECs toward galectin-3 in a dose-dependent manner, reducing it by 68% at 0.005% (P<.001) and inhibiting it completely at 0.1% (P<.001). Finally, MCP also inhibited adhesion of MDA-MB-435 cells, which express galectin-3, to HUVECs in a dose-dependent manner. CONCLUSIONS: MCP, given orally, inhibits carbohydrate-mediated tumor growth, angiogenesis, and metastasis in vivo, presumably via its effects on galectin-3 function. These data stress the importance of dietary carbohydrate compounds as agents for the prevention and/or treatment of cancer.

Adenocarcinoma↗

Efficacy of a pectin-based anti-reflux agent on acid reflux and recurrence of symptoms and oesophagitis in gastro-oesophageal reflux disease.

OBJECTIVE: Gastro-oesophageal reflux disease may be treated with a drug forming a floating neutral raft in the stomach. The pectin-based raft-forming anti-reflux agent Aflurax (Idoflux) was examined, first regarding reduction of oesophageal acid exposure, and next as to its efficacy as maintenance treatment in patients with healed oesophagitis. DESIGN: Double-blind, placebo-controlled randomized clinical trials. SETTING: Open access endoscopy unit. PARTICIPANTS: Fourteen patients with erosive oesophagitis had measurement of acid exposure. Eighty-eight patients with healed erosive/ulcerative oesophagitis and relief of heartburn after pre-treatment with omeprazole received maintenance treatment. INTERVENTIONS: Crossover 12-h oesophageal pH monitoring during Aflurax/placebo treatment. Maintenance treatment for up to 6 months with two tablets of Aflurax 1200 mg or placebo four times daily. MAIN OUTCOME MEASURES: Percentage time pH less than 4 in 6 plus 6 h (upright + supine). Time to recurrence of moderate or severe heartburn (life table analysis). RESULTS: The median (interquartile range) acid exposure times in the upright position were: 3.1% (1.6-13.0%) on Aflurax versus 6.7% (2.5-14.9%) on placebo (P = 0.10). In the supine position no difference was found (Aflurax 13.7%, placebo 13.2%). The time to recurrence of heartburn with Aflurax treatment was prolonged significantly; after 6 months the life table estimates were 48% of patients in remission on Aflurax versus 8% on placebo (P = 0.01). Following treatment, erosive oesophagitis was found in 17/34 on Aflurax versus 28/38 on placebo (P < 0.05). CONCLUSION: Aflurax significantly delays recurrence of moderate or severe heartburn and erosive oesophagitis, when used as maintenance treatment. The acid exposure was not significantly reduced with pH monitoring.

Aged↗

Rhamnogalacturonan alpha-L-rhamnopyranohydrolase. A novel enzyme specific for the terminal nonreducing rhamnosyl unit in rhamnogalacturonan regions of pectin.

Two alpha-L-rhamnohydrolases with different substrate specificities were isolated from a commercial preparation produced by Aspergillus aculeatus. The first rhamnohydrolase was active toward p-nitrophenyl-alpha-L- rhamnopyranoside, naringin, and hesperidin and was termed p-nitrophenyl-alpha-L-rhamnopyranohydrolase (pnp-rhamnohydrolase). From the data collected, the enzyme seemed specific for the alpha-1,2- or alpha-1,6-linkage to beta-D-glucose. The pnp-rhamnohydrolase had a molecular mass of 87 kD (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), a pH optimum of 5.5 to 6, a temperature optimum of 60 degrees C, and a specific activity toward pnp-alpha-L-rhamnopyranoside (pnp-Rha) of 13 units mg-1 protein. The second rhamnohydrolase, on the contrary, was active toward rhamnogalacturonan (RG) fragments, releasing Rha, and was therefore termed RG-rhamnohydrolase. The RG-rhamnohydrolase had a molecular mass of 84 kD, a pH optimum of 4, a temperature optimum of 60 degrees C, and a specific activity toward RG oligomers of 60 units mg-1 protein. The RG-rhamnohydrolase liberated Rha from the nonreducing end of the RG chain and appeared specific for the alpha-1,4-linkage to alpha-D-galacturonic acid. The enzyme was hindered when this terminal Rha residue was substituted at the 4-position by a beta-D-galactose. The results so far obtained did not indicate particular preference of the enzyme for low or high molecular mass RG fragments. From the results it can be concluded that a new enzyme, an RG alpha-L-rhamnopyranohydrolase, has been isolated with high specificity toward RG regions of pectin.

Aspergillus↗

Solubilization and partial characterization of extensin fragments from cell walls of cotton suspension cultures. Evidence for a covalent cross-link between extensin and pectin.

Extensin, a major hydroxyproline (Hyp)-rich glycoprotein in walls of cultured cells of dicotyledonous plants, is very difficult to solubilize. To learn about the nature of the insolubilization, we have tested the ability of a variety of selective hydrolytic methods, and combinations of them, to liberate extensin or fragments of extensin from suspension-culture cell walls. After the complete deglycosylation of cotton (Gossypium hirsutum L.) walls, trypsinization solubilized 80% of the Hyp. The sequences of three abundant peptides were: (a) serine-Hyp-Hyp-Hyp-Hyp-Hyp-Hyp-serine-Hyp-Hyp-lysine, (b) serine-Hyp-Hyp-Hyp-Hyp-valine-lysine, and (c) serine-Hyp-Hyp-serine-alanine-Hyp-lysine. After a sequential treatment of walls with endopolygalacturonase, cellulase, -73 degrees C anhydrous hydrogen fluoride solvolysis, and ammonium bicarbonate extraction, only sugars indicative of rhamnogalacturonan I and protein remained insoluble. Trypsin treatment of this residue liberated 50% of the Hyp. A significant proportion of rhamnogalacturonan-associated sugars co-solubilized and co-purified along with the extensin fragments following the trypsinization. By sodium dodecyl sulfate gel electrophoresis and gel filtration, the glycopeptides fell into two classes. One class contained distinctly sized molecules with relative molecular weights in the range of 4,000 to 24,000. The other class did not enter the resolving gel and was hetero-disperse. After complete deglycosylation by a 0 degrees C anhydrous hydrogen fluoride treatment, the first class was little affected in its electrophoretic mobility, whereas the larger heterogeneous material mostly entered the separating gel. After further trypsinization of the deglycosylated peptides and analysis by capillary zone electrophoresis, the peptides in both size classes were shown to contain the sequences described above. From our observations we suggest that cotton extensin becomes insolubilized into cell walls in part by pectin-protein cross-links in addition to the protein-protein (or protein-phenolic-protein) cross-links that have been repeatedly suggested.

Amino Acid Sequence↗

The catalytic site of the pectin biosynthetic enzyme alpha-1,4-galacturonosyltransferase is located in the lumen of the Golgi.

Alpha-1,4-galacturonosyltransferase (GalAT) is an enzyme required for the biosynthesis of the plant cell wall pectic polysaccharide homogalacturonan (HGA). GalAT activity in homogenates from pea (Pisum sativum L. var. Alaska) stem internodes co-localized in linear and discontinuous sucrose gradients with latent UDPase activity, an enzyme marker specific for Golgi membranes. GalAT activity was separated from antimycin A-insensitive NADH:cytochrome c reductase and cytochrome c oxidase activities, enzyme markers for the endoplasmic reticulum and the mitochondria, respectively. GalAT and latent UDPase activities were separated from the majority (80%) of callose synthase activity, a marker for the plasma membrane, suggesting that little or no GalAT is present in the plasma membrane. GalAT activities in proteinase K-treated and untreated Golgi vesicles were similar, whereas no GalAT activity was detected after treating Golgi vesicles with proteinase K in the presence of Triton X-100. These results demonstrate that the catalytic site of GalAT resides within the lumen of the Golgi. The products generated by Golgi-localized GalAT were converted by endopolygalacturonase treatment to mono- and di-galacturonic acid, thereby showing that GalAT synthesizes 1-->4-linked alpha-D-galacturonan. Our data provide the first enzymatic evidence that a glycosyltransferase involved in HGA synthesis is present in the Golgi apparatus. Together with prior results of in vivo labeling and immunocytochemical studies, these results show that pectin biosynthesis occurs in the Golgi. A model for the biosynthesis of the pectic polysaccharide HGA is proposed.

Catalysis↗

A lily stylar pectin is necessary for pollen tube adhesion to an in vitro stylar matrix.

Pollen tube cells adhere to the wall surface of the stylar transmitting tract epidermis in lily. This adhesion has been proposed as essential for the proper delivery of the sperm cells to the ovule. An in vitro adhesion bioassay has been used to isolate two stylar molecules required for lily pollen tube adhesion. The first molecule was determined to be a small, cysteine-rich protein with some sequence similarity to lipid transfer proteins and now called stigma/stylar cysteine-rich adhesin (SCA). The second, larger, molecule has now been purified from style fragments and characterized. Chemical composition, specific enzyme degradations, and immunolabeling data support the idea that this molecule required for pollen tube adhesion is a pectic polysaccharide. In vitro binding assays revealed that this lily stylar adhesive pectin and SCA are able to bind to each other in a pH-dependent manner.

Dose-Response Relationship, Drug↗

Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation.

Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls. The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases. The E. chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion. The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals. KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli. Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR-binding site. The 25 bp oligonucleotide AAAAAAGAAACATTGTTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene. This construct functioned as an operator for binding of the KdgR protein in vivo.

Amino Acid Sequence↗

The intercellular biotrophic leaf pathogen Cymadothea trifolii locally degrades pectins, but not cellulose or xyloglucan in cell walls of Trifolium repens.

The intercellular ascomycetous pathogen Cymadothea trifolii, causing sooty blotch of clover, proliferates within leaves of Trifolium spp. and produces a complex structure called interaction apparatus (IA) in its own hyphae. Opposite the IA the plant plasmalemma invaginates to form a bubble. Both structures are connected by a tube with an electron-dense sheath. Using immunocytochemistry on high-pressure frozen and freeze-substituted samples, we examined several plant and fungal cell wall components, including those in new host wall appositions at the interaction site, as well as a fungal polygalacturonase. Within the tube linking IA and host bubble, labelling was obtained for cellulose and xyloglucan but not for rhamnogalacturonan-I and homogalacturonans. The IA labelled for chitin and beta-1,3-glucans, and for a fungal polygalacturonase. Plant wall appositions reacted with antibodies against callose, xyloglucans and rhamnogalacturonan-I. Cymadothea trifolii partly degrades the host cell wall. Structural elements remain intact, but the pectin matrix is dissolved. A fungal polygalacturonase detected in the IA is probably a key factor in this process. Owing to the presence of chitin and beta-1,3-glucans, the IA itself is considered an apoplastic compartment.

Ascomycota↗

Pectins and pectic-oligosaccharides inhibit Escherichia coli O157:H7 Shiga toxin as directed towards the human colonic cell line HT29.

Pectins and pectic-oligosaccharides, as derived by controlled enzymatic hydrolysis, were evaluated for their ability to interfere with the toxicity of Shiga-like toxins from Escherichia coli O157:H7. Both types of material resulted in some degree of protection but this was significantly higher (P>0.01) with the oligosaccharide fractions (giving 90-100% cell survival, compared to 70-80% with the polymer). An effect of methylation on the protective effect was detected with lower degrees being more active. The pectic-oligosaccharides and galabiose, the minimum toxin receptor analogue, were shown to inhibit toxicity and were both protective at 10 mg x ml(-1), but not at lower concentrations.

Escherichia coli Infections↗

Chloride methylation by plant pectin: an efficient environmentally significant process.

Atmospheric chloromethane (CH3Cl) plays an important role in stratospheric ozone destruction, but many uncertainties exist regarding the strengths of its sources and sinks and particularly regarding the processes generating this naturally occurring gas. Evidence is presented here that CH3Cl is produced in many terrestrial environments by a common mechanism. Abiotic conversion of chloride to CH3Cl occurs readily in plant material, with the widespread plant component pectin acting as a methyl donor. Significant CH3Cl emissions from senescent and dead leaves were observed at ambient temperatures; those emissions rose dramatically when temperatures increased. This ubiquitous process acting in terrestrial ecosystems and during biomass burning could contribute the bulk of atmospheric CH3Cl.

Atmosphere↗

Synthesis and immunological properties of Vi and di-O-acetyl pectin protein conjugates with adipic acid dihydrazide as the linker.

The Vi capsular polysaccharide of Salmonella typhi, a licensed vaccine for typhoid fever in individuals > or = 5 years old, induces low and short-lived antibodies in children, and reinjection does not elicit booster responses at any age. Its immunogenicity was improved by binding Vi to proteins by using N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) as a linker. Similar findings were observed with the structurally related, di-O-acetyl derivative of pectin [poly-alpha(1-->4)-D-GalpA] designated OAcP. Protein conjugates of Vi and OAcP were synthesized by carbodiimide-mediated synthesis with adipic acid dihydrazide (ADH) as the linker. Hydrazide groups were introduced into proteins (bovine serum albumin or recombinant Pseudomonas aeruginosa exoprotein A) by treatment with ADH and 1-ethyl-3(3-dimethylaminopropyl carbodiimide (EDC). The resultant adipic acid hydrazide derivatives (AH-proteins), containing 2.3 to 3.4% AH, had antigenic and physicochemical properties similar to those of the native proteins. The AH-proteins were bound to Vi and OAcP by treatment with EDC. The immunogenicity of Vi or OAcP, alone or as protein conjugates, was evaluated in young outbred mice and guinea pigs by subcutaneous injection of 2.5 and 5.0 microg, respectively, of polysaccharide, and antibodies were measured by enzyme-linked immunosorbent assay. All conjugates were significantly more immunogenic than Vi or OAcP alone and induced booster responses with 5- to 25-fold increases of antibodies. Vi conjugates were significantly more immunogenic than their OAcP analogs. A carboxymethyl derivative of yeast beta-glucan enhanced the anti-Vi response elicited by an OAcP conjugate but had no effect on the immunogenicity of Vi or of OAcP alone. Vi and OAcP conjugates synthesized by this scheme will be evaluated clinically.

Adipates↗

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis.

Aldose-Ketose Isomerases↗

Treatment of gastric ulceration in 10 standardbred racehorses with a pectin-lecithin complex.

The severity of the erosive and ulcerative lesions of the squamous gastric mucosa in 10 standardbred racehorses in training was classified according to a standard scoring system. Each horse was then treated orally for 30 days with 50 g/100 kg bodyweight daily of a pectin-lecithin complex mixed into the feed. At the end of the period of treatment, the gastric lesions were re-evaluated gastroscopically and the scores were compared with those assigned at the previous evaluation. In three of the horses the gastric ulcerations had healed completely, and in six others the lesions had improved significantly.

Animals↗

Inhibitory effect of apple pectin and culture condensate of Bifidobacterium longum on colorectal tumors induced by 1,2-dimethylhydrazine in transgenic mice harboring human prototype c-Ha-ras genes.

The number and tumor score of colorectal tumors induced by 1,2-dymethylhydrazine in transgenic (Tg) mice carrying human c-Ha-ras genes were significantly reduced by ingestion of apple pectin (AP) or a culture condensate of Bifidobacterium longum (MB) when compared with a control diet. There was no statistical difference in the incidence of colorectal tumors in Tg mice between the AP or MB diet and the control diet. This study demonstrated that Tg mice are a useful tool for screening inhibition of colorectal tumors by functional foods.

1,2-Dimethylhydrazine↗

The effect of a pectin-lecithin complex on prevention of gastric mucosal lesions induced by feed deprivation in ponies.

This study examined whether a product containing a pectinlecithin complex (Pronutrin) (1) could prevent gastric lesions induced in the equine gastric squamous epithelial mucosa using a protocol of intermittent feed deprivation that resulted in prolonged increased gastric acidity (Murray and Eichorn 1996). Eight ponies were used and served as their own controls in 2 trials in which there were 72 h cumulative deprivation (alternating 24 h with no feed, then 24 h free choice hay), with a 4-week interval between trials. Ponies were assigned randomly to receive either 250 g Pronutrin plus 200 g pelleted feed, or 450 g pelleted feed only. Ponies were conditioned to each treatment for 7 days and received Pronutrin and pellets or only pellets once daily during the feed deprivation protocol. Gastroscopy was performed at the beginning and conclusion of the feed deprivation protocol. The endoscopist (MJ.M.) was blinded as to treatments, and lesion severity was scored on a scale of 0-5. Gastroscopy revealed normal-appearing gastric mucosa at the beginning of feed deprivation, with the exception of 2 ponies which had focal squamous mucosal erosion and 1 pony with focal glandular mucosal erosion. After 72 h cumulative feed deprivation, each pony, except 1 pony in one of the trials, developed erosions or ulcers in the gastric squamous mucosa. There was no difference (P = 0.6) in the presence or severity of gastric lesions between treatments. Lesions did not develop in the gastric glandular mucosa as a result of the intermittent feed deprivation with either treatment. In this study, the pectin-lecithin complex in Pronutrin failed to prevent lesions in the gastric squamous mucosa induced by intermittent feed deprivation.

Animals↗

The efficacy of a pectin-based raft-forming anti-reflux agent in endoscopy-negative reflux disease.

BACKGROUND: Patients with heartburn as their main complaint but normal oesophageal mucosa at endoscopy are classified as having endoscopy-negative gastro-oesophageal reflux disease (GORD). They have mainly postprandial reflux and low total acid exposure and could possibly be managed with a non-systemic drug. In such patients we examined the effect of a pectin-based raft-forming anti-reflux agent (Aflurax (Idoflux)) on the severity of heartburn. METHODS: Patients with heartburn but with normal/erythematous oesophageal mucosa (n = 65) were randomized to double-blind treatment with two 1200-mg tablets of Aflurax or two placebo tablets four times daily for 4 weeks. The main outcome measure was heartburn severity on day 15 and day 29. RESULTS: The number of patients scoring heartburn severity on day 15 as none, mild, moderate, and severe were 6, 14, 8, and 3, respectively, with Aflurax versus 2, 6, 13, and 11 with placebo (P < 0.05). No further treatment effect was found on day 29. CONCLUSION: Aflurax reduces heartburn in patients with endoscopy-negative GORD.

Adult↗