Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “effector”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 793 records · Page 44Linked to original sources
PubMed1982

Immunotherapy of a chemically-induced sarcoma in rats: characterization of the effector T cell subset and nature of suppression.

Chemically-induced sarcomas (BC5), established subcutaneously and growing progressively in BN rats, were completely eliminated by i.v. infusion of syngeneic effector cells. The effector cells were generated from BN spleen cells immune to BC5 in a mixed lymphocyte-tumor cell culture (MLTC). Generation of a high yield of effector cells that were efficacious in eliminating BC5 in vivo necessitated: depletion of macrophages from immune spleen populations, before preparation of MLTC; addition back to MLTC of a small number of macrophages from normal spleens to attain a level of 0.5% of the spleen cells in culture; and addition of T cell growth factor on day 5 of MLTC. With these conditions a subset of T cells was expanded. They were blast cells with surface markers W3/25 and Ia, which exhibited no cytotoxic activity in vitro, and probably functioned as a helper or amplifier element in the tumor-bearing host. Effector cells generated in MLTC with BC5, treated with mitomycin C, were specific for BC5 in vivo and did not affect growth of a viral-induced BN tumor.

Animals↗
PubMed1977

Cytostatic effector cells generated in vivo against M locus determinants.

Cytostatic effector cells against M-locus (Mls) determinants were generated in mice by immunization with Mls incompatible lymphocytes. A post-labelling assay of 14C-labelled uridine uptake by macrophage targets was employed to meaure the inhibitory activity of the effector cells. Using lymphocytes from Mls pseudocongenic mice to immunize donors of effector cells, it was confirmed that the cytostatic effect was via the Mls determinants expressed on the macrophage targets. Cytotoxic effector cells against M-locus (Mls) determinants were not detected by the cell-mediated lympholysis assay (CML) in a five day mixed lymphocyte culture (MLC) between Mls incompatible lymphocytes. Specificity of cytotoxic cells generated by culturing in vivo preimmunized responder cells and Mls incompatible stimulator lymphocytes did not correlate with the Mls determinant of the stimulator lymphocytes.

Animals↗
PubMed1981

The antibody-independent cytotoxic activity of normal circulating human leucocytes. II. Failure to demonstrate effector cell-target cell interaction and target cell specificity of the circulating cytotoxic-enhancing factor.

The naturally-occurring antibody-independent cellular cytotoxic activity (NOCC) of normal circulating human monocytes and neutrophils was investigated employing a number of erythrocytes and the K-562 cell line as target cells simultaneously. The identity of the effector cell(s) was shown to be dependent upon or be a function of the type of target cell selected for the assay system. A number of erythrocyte targets (rabbit, horse, sheep and ox erythrocytes) were lysed to varying degrees by neutrophils and monocytes and not by lymphocytes. Irrespective of the red blood cell (RBC) target, the effector monocyte invariably possessed receptors for both C'3 and the Fc of IgG. In contrast, the cytotoxic cells using the K-562 target cell were lymphocytes. Monocytes and neutrophils were inactive. The cytotoxic-enhancing activity in normal human serum exhibits specific and non-specific properties which suggests that more than one factor is involved. With respect to the monocyte cytotoxic cells, only the rabbit erythrocytes could totally absorb the serum factor in a specific fashion. Absorption of the serum with horse, sheep or ox erythrocytes resulted in a significant loss of potentiating activity with respect to all of the erythrocyte targets but a more marked loss of activity using the absorbing erythrocytes as targets. With respect to the polymorphonuclear leucocyte effector cells, only the rabbit RBC were capable of specifically absorbing out the cytotoxic-enhancing factor present in the normal human serum. Absorption of the serum with sheep, horse or ox RBC resulted in total cross-absorption of the enhancing factor. Chicken and human RBC, which do not serve as targets for the NOCC assay, could not absorb out the cytotoxic-enhancing factor with respect to any of the target erythrocytes. The composition of the soluble serum factor(s) is under current investigation but it is not an immunoglobulin since pure serum albumin can substitute for normal serum in the NOCC assay. The mechanism of erythrocyte lysis by the cytotoxic monocyte was investigated. Mononuclear cells were incubated with target cell monolayers and with target cells under optimal rosetting conditions. No interaction between the effector and target cells could be detected. The monocytes did not adhere to the target cell monolayer nor did they form rosettes with the target cells. Thus, the results fail to corroborate or support the assumption that the cytotoxic activity of the monocyte is dependent upon conventionally-detectable receptors. Erythrophagocytosis was not observed to any significant degree under the assay conditions used. Therefore, the nature of the interaction between the cytotoxic monocyte and the erythroid target cell which results in lysis of the target cell remains to be elucidated.

Cell Line↗
PubMed1977

Antibody-dependent cellular cytotoxicity against murine leukemia viral antigens: studies with human lymphoblastoid cell lines and human peripheral lymphocytes as effector cells comparing rabbit, goat, and mouse antisera.

A thymic lymphoblastoid cell line derived from a New Zealand Black mouse produces murine leukemia virus (MuLV) and was used as a target in model systems for the in vitro study of antibody-dependent cellular cytotoxicity (ADCC). Several human lymphoblastoid cell lines were investigated as potential effector cells. The most promising (Raji cells) bound to antibody-coated target cells but caused only modest levels of ADCC at 25:1 effector-to-target cell ratio with substantial lysis in the absence of antiserum. Human peripheral lymphocytes were active as effector cells in ADCC at a 5:1 ratio and produced no lysis in the absence of antibody. These cells were used to demonstrate that high dilutions of rabbit antisera to MuLV antigens p30, p15, p12, and p10 were capable of mediating lysis of MuLV-producing target cells but not of a virus-negative murine cell line. A murine antiserum to Thy 1.2 and three caprine antisera to MuLV antigens that were active in complement-mediated cytotoxicity functioned poorly in inducing ADCC; however, rabbit antisera to similar antigens were 16- to 512-fold more efficient in cell-mediated than in complement lysis. The inefficiency of goat antisera was not due to shedding of cell surface antigens or generation of blocking factors but rather to lack of lytic interaction of antibody-coated targets with the effector cells.

Animals↗
PubMed1980

Effector cells in avian spontaneous and antibody-dependent cell-mediated cytotoxicity.

Using effector cells from chickens and quails, antibody-dependent and spontaneous cell-mediated cytotoxicity (ADCC and SCMC) were studied in a 51chromium-release microcytotoxicity assay against erythrocytes and several tumor cells as targets. The effector cells mediating both ADCC and SCMC against tumor targets, as well as those active in ADCC against erythrocytes, exhibited similar characteristics: they were adherent cells of high density, which could be removed by treatment with carbonyl iron and magnet. The effector cell concentration was highest in the peripheral blood and lower in the spleen, whereas no activity was found in thymus and bursa. Lysis was detectable after 15 min of incubation, and the reaction was completed after a few hours. A rabbit antiserum was found to be able to induce ADCC against sheep erythrocytes, but it did so less effectively than a chicken antiserum. Studies on the target specificity of SCMC revealed a preferential destruction of xenogeneic lymphoma targets. These findings are discussed with respect to differences between the avian effector cells and the mammalian K and NK cells.

Animals↗
PubMedDate not supplied

[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors].

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.

Alkylation↗
PubMed1994

Evidence for a defect of antibody-dependent cellular cytotoxic (ADCC) effector function and anti-HIV gp120/41-specific ADCC-mediating antibody titres in HIV-infected individuals.

Antibody-dependent cellular cytotoxicity (ADCC) is an important antiviral effector mechanism. However, its role, as well as the functional integrity of the ADCC-effector cells in HIV infections, is not well understood. For studying gp120/41-specific ADCC, we recently developed a virus-free target cell system, using a natural killer (NK) cell activity-resistant human lymphoid cell line of B lineage, which was transfected with the env gene of the human immunodeficiency virus type 1 (HIV-1); gp120/41-expressing cell clones were thus selected. In this study, these gp120/41-expressing cloned cells were used as targets in a gp120/41-specific ADCC assay for (a) examining the functional integrity of ADCC-effector cells from HIV-seropositive individuals, and (b) titrating the sera of these individuals for gp120/41-specific, ADCC-mediating antibodies. Our data indicate for the first time that the percentage of sera positive for ADCC-mediating antibodies to gp120/41 is higher in individuals with CD4 counts < or = 400 and > or = 200/mm3. The individuals with CD4 counts < 200/mm3 were found to have the lowest titers of these antibodies in their sera. The ADCC-effector function of the peripheral blood mononuclear cells (PBMC) of HIV-infected individuals was significantly (p < 0.05) reduced as compared to the PBMC from healthy, HIV-seronegative individuals. Further, human recombinant IL2 and interferon-gamma were found to exert a significant (p < 0.05) enhancing effect on ADCC mediated by PBMC from these HIV-infected individuals.(ABSTRACT TRUNCATED AT 250 WORDS)

Antibodies, Monoclonal↗
PubMed1994

A humanized, bispecific immunoadhesin-antibody that retargets CD3+ effectors to kill HIV-1-infected cells.

HIV infection depletes the immune system of the coordinating functions of CD4+ T cells and APCs, whereas the population of CD8+ CTLs remains largely intact: functional but undirected. We have developed a humanized bispecific immunoadhesin-antibody (BIA) that redirects these remaining T cells to kill HIV-infected cells. This BIA expresses effector cell retargeting via a targeting activity that exploits the natural affinity of CD4 for gp120, and a recruiting activity that employs an anti-CD3 moiety to engage CTLs. The resultant molecule is 97% human in origin. In functional tests, this BIA mediated killing of HIV-infected cells using either pure CTL preparations, or whole PBL fractions that additionally include Fc gamma receptor-bearing large granular lymphocyte effectors. In contrast, a human anti-gp120 Ab induced target lysis via Ab-dependent cellular cytotoxicity (ADCC) only with large granular lymphocyte-containing fractions and not with CTLs. ADCC with this Ab was blocked in human serum, whereas BIA-mediated effector cell retargeting lysis of HIV-infected cells by CTLs was preserved. The affinity of the BIA for HIV-gp120 on infected cells and for CD3 epsilon on CTLs was derived in a flow cytometric Scatchard procedure. Relative to the bivalent parent molecules, CD4/gp120 affinity on cells was unchanged in the BIA (Ka 7 x 10(7) M-1), whereas the anti-CD3 affinity was diminished 50-fold (Ka 2 x 10(6) M-1 vs 1 x 10(8) M-1). Physical association of CD3+ effectors and gp120-expressing targets was confirmed by fluorescence microscopy and was dependent upon the presence of BIA and expression of target gp120. The unimpaired cytocidal activity of the BIA in the presence of serum highlights a potentially important advantage of this type of construct over native Abs for HIV-directed therapy.

Antibodies, Bispecific↗
PubMed1994

Antitumor effector cells: extravasation and control of metastasis.

To develop effective antimetastatic response, effector cells have to reach the tissue site of tumor metastasis. Different lymphocyte subsets vary in their ability to extravasate and reach sites of tissue injury or tumor growth. The ability of lymphoid cells to extravasate is a function of several different parameters, including cellular activation state and ability to release cytokines, proteolytic enzymes or to respond to chemotactic stimuli present in the tumor microenvironment. Adoptively transferred effector cells can only be therapeutically effective if they extravasate, reach the tumor or its microenvironment and interfere with tumor growth or metastasis. A large number of events that might be involved in accumulation of effector cells such as, e.g., A-NK cells in tumor metastases, are illustrated in the schema in Figure 3. The future challenge will be to gain an in-depth understanding of these events, including effector cell migration and extravasation, to assure optimal transfers of these cells to patients with metastatic disease.

Animals↗
PubMed1994

In vitro susceptibility of acute leukemia cells to the cytotoxic activity of allogeneic and autologous lymphokine activated killer (LAK) effectors: correlation with the rate and duration of complete remission and with survival.

Acute lymphoblastic leukemia (ALL) and acute myeloblastic leukemia (AML) blasts were studied for their sensitivity to the lytic activity of normal allogeneic interleukin 2 (IL-2) activated killer (LAK) cells, and of autologous LAK effectors generated at the time of complete remission (CR). In 12 of 23 ALL cases (52%), the blasts were susceptible to normal LAK cells (> 15% lysis) and ten of them achieved a CR. Of the remaining 11 LAK-resistant cases, seven obtained a CR. No correlation was found between susceptibility to LAK activity, cytomorphology, immunophenotype, CR duration and survival. Eighteen of the 26 AMLs tested (70%) were susceptible to normal LAK cells, and nine of the 13 cases studied (70%) were also lysed by autologous LAK effectors generated at CR. No clearcut correlation was observed between blast sensitivity to normal LAK cells and morphologic cytotype, though a higher incidence of resistant cases was observed in the M4 subgroup. All AMLs susceptible to normal LAK cells but one achieved a CR, while this occurred only in three of the eight resistant cases (p = 0.004). The median survival and event-free survival duration in the resistant patients were significantly shorter (p = 0.03 and p = 0.02, respectively) compared to those of the susceptible patients. In ten ALL and in six AML, which at presentation displayed less than 10% circulating blasts, the susceptibility of the leukemic population to normal and autologous LAK effectors could be tested, both at diagnosis and at remission. All cases but one were resistant to autologous LAK cells generated at diagnosis, while at CR, seven cases (four ALL and three AML) became susceptible to autologous LAK cells (p = 0.01). The remaining nine were resistant to both allogeneic and autologous LAK effectors. Taken together, these findings suggest that in AML, but not in ALL, the LAK cell compartment may play a role in the clinical course and overall outcome of the disease.

Adolescent↗
PubMed1976

Kinetic analysis of target cell destruction by effector T cells. I. Delineation of parameters related to the frequency and lytic efficiency of killer cells.

Murine cytotoxic T cell activity was evaluated in analogy with the methods used to characterize enzymes. Concordant with this analogy, the relationship between "steady-state" lytic rates and target cell ("substrate") number was described by a hyperbola, the asymptote of which was the maximum rate of lysis ("V") and was directly proportional to the number of killer cells. The number of target cells required to reach a rate of one-half V ("K") was independent of the number of effector cells, but was found to vary with the total cell concentration in the cultures. The kinetic analogy was extended to analyze this variability by studying the inhibition of cytolysis caused by normal syngeneic lymphocytes. A value for K in the absence of non-killer cells ("Kh") was evaluated. This term, which was independent of effector cell frequency, was a measure of lytic efficiency and, as such, was used to compare various effector cell populations. The Kh value for a number of lymphoid cell populations from identically immunized C57BL/6 mice was found to vary considerably, thereby providing direct evidence that effector populations have different lytic efficiencies. Because of this variability, the widely used practice of comparing killer cell populations solely on the basis of their relative lytic activity may often be invalid.

Animals↗
PubMed1978

Regulation of the immune response to tumor antigen. VI. Differential specificities of suppressor T cells or their products and effector T cells.

Suppressor T cells arising during the development of certain murine methylcholanthrene-induced fibrosarcomas have previously been shown capable of limiting only those effector responses generated against the homologous tumor. Thus, S1509a-induced suppressor T cells inhibit immune reactivity only to the S1509a tumor in S1509a immune mice and have no effect on the rejection of SAI tumors in SAI-immune animals. In contrast to this is the cross-reactivity of effector cells in this system, whereby animals rendered immune to either the S1509a or SAI sarcoma are equally capable of rejecting a challenge of the opposite tumor. The specificity of suppression has been further defined in the present study, which demonstrates that S1509a-induced suppressor cells can inhibit responsiveness only to the S1509a sarcoma, even in the simultaneous presence of both the S1509a and SAI tumors. Furthermore, the suppressor factor that is obtainable from suppressor T cells demonstrates a similar precise specificity in its ability to limit selectively reactivity only against the inducing tumor, regardless of the simultaneous expression of antigens on other tumors recognized by cross-reactive effector cells. These results suggest that the antigenic determinants recognized by effector and suppressor T cells are different, and may provide a model for further dissection of suppressor cell function in vivo.

Animals↗
PubMedDate not supplied

[Structural elements of molecules of GTP-binding proteins and effectors mediating coupling between them].

Data available in literature on molecular mechanisms of the functional coupling of heterotrimeric G-proteins and small GTP-binding proteins (Ras-type) to effectors are analyzed. The segments of G-protein alpha-subunits which participate in formation of the effector-binding site are discussed. The induction of interaction between activated alpha-subunit and effector, following change of alpha-subunit nucleotide-binding site conformation as a result of GDP/GTP exchange is shown. The analysis of effector molecular determinants responsible for coupling to G-proteins are analyzed. The determinants are preferentially of the polycationic nature.

3',5'-Cyclic-GMP Phosphodiesterases↗
PubMed1998

Abstract and effector-specific representations of motor sequences identified with PET.

Positron emission tomography was used to identify neural systems involved in the acquisition and expression of sequential movements produced by different effectors. Subjects were tested on the serial reaction time task under implicit learning conditions. In the initial acquisition phase, subjects responded to the stimuli with keypresses using the four fingers of the right hand. During this phase, the stimuli followed a fixed sequence for one group of subjects (group A) and were randomly selected for another group (group B). In the transfer phase, arm movements were used to press keys on a substantially larger keyboard, and for both groups, the stimuli followed the sequence. Behavioral indices provided clear evidence of learning during the acquisition phase for group A and transfer when switched to the large keyboard. Sequence acquisition was associated with learning-related increases in regional cerebral blood flow (rCBF) in a network of areas in the contralateral left hemisphere, including sensorimotor cortex, supplementary motor area, and rostral inferior parietal cortex. After transfer, activity in inferior parietal cortex remained high, suggesting that this area had encoded the sequence at an abstract level independent of the particular effectors used to perform the task. In contrast, activity in sensorimotor cortex shifted to a more dorsal locus, consistent with motor cortex somatotopy. Thus, activity here was effector-specific. An increase in rCBF was also observed in the cingulate motor area at transfer, suggesting a role linking the abstract sequential representations with the task-relevant effector system. These results highlight a network of areas involved in sequence encoding and retrieval.

Adult↗
PubMed2002

The xanthomonas type III effector protein AvrBs3 modulates plant gene expression and induces cell hypertrophy in the susceptible host.

Xanthomonas campestris pv. vesicatoria bacteria expressing the type III effector protein AvrBs3 induce a hypersensitive response in pepper plants carrying the resistance gene Bs3. Here, we report that infection of susceptible pepper and tomato plants leads to an AvrBs3-dependent hypertrophy of the mesophyll tissue. Agrobacterium-mediated transient expression of the avrBs3 gene in tobacco and potato plants resulted in a similar phenotype. Induction of hypertrophy was shown to depend on the repeat region, nuclear localization signals, and acidic transcription activation domain (AAD) of AvrBs3, suggesting that the effector modulates the host's transcriptome. To search for host genes regulated by AvrBs3 in an AAD-dependent manner, we performed a cDNA-amplified fragment length polymorphism analysis of pepper mRNA populations. Thirteen AvrBs3-induced transcripts were identified and confirmed by reverse transcriptase-polymerase chain reaction. Sequence analysis revealed homologies to auxin-induced and expansinlike genes, which play a role in cell enlargement. These results suggest that some of the AvrBs3-induced genes may be involved in hypertrophy development and that xanthomonads possess type III effectors that steer host gene expression.

Bacterial Proteins↗
PubMed2007

In planta horizontal transfer of a major pathogenicity effector gene.

Xanthomonas citri pv. citri is a clonal group of strains that causes citrus canker disease and appears to have originated in Asia. A phylogenetically distinct clonal group that causes identical disease symptoms on susceptible citrus, X. citri pv. aurantifolii, arose more recently in South America. Genomes of X. citri pv. aurantifolii strains carry two DNA fragments that hybridize to pthA, an X. citri pv. citri gene which encodes a major type III pathogenicity effector protein that is absolutely required to cause citrus canker. Marker interruption mutagenesis and complementation revealed that X. citri pv. aurantifolii strain B69 carried one functional pthA homolog, designated pthB, that was required to cause cankers on citrus. Gene pthB was found among 38 open reading frames on a 37,106-bp plasmid, designated pXcB, which was sequenced and annotated. No additional pathogenicity effectors were found on pXcB, but 11 out of 38 open reading frames appeared to encode a type IV transfer system. pXcB transferred horizontally in planta, without added selection, from B69 to a nonpathogenic X. citri pv. citri (pthA::Tn5) mutant strain, fully restoring canker. In planta transfer efficiencies were very high (>0.1%/recipient) and equivalent to those observed for agar medium with antibiotic selection, indicating that pthB conferred a strong selective advantage to the recipient strain. A single pathogenicity effector that can confer a distinct selective advantage in planta may both facilitate plasmid survival following horizontal gene transfer and account for the origination of phylogenetically distinct groups of strains causing identical disease symptoms.

Bacterial Proteins↗
PubMed2026

From Sequential Gland Replacement to Recurrent Gland Coordination: A Comparative Framework for Subventral and Dorsal Oesophageal Gland Effectors Across Plant-Parasitic Nematode Lifestyles.

Plant-parasitic nematodes manipulate host tissues through stylet-secreted gene products synthesised principally in two subventral and one dorsal oesophageal gland. Earlier reviews have catalogued effector repertoires, described feeding-site formation, and explained how individual effectors modify host defence, development, and metabolism. However, the temporal coordination of the gland cells themselves has not been comparatively synthesised across parasitic lifestyles. This review therefore advances a gland-centred, lifestyle-dependent framework. In sedentary endoparasites, available evidence supports a pronounced developmental transition: subventral gland products dominate penetration and migration, whereas dorsal gland products become increasingly important during feeding-site initiation and maintenance. Migratory endoparasites repeatedly penetrate, migrate, and feed without establishing permanent feeding cells; their gland activity is consequently predicted to be recurrent and overlapping rather than a one-way replacement. Ectoparasites likewise require behaviour-dependent coordination during repeated probing and external feeding, although direct gland localisation evidence remains limited. We integrate gland origin, secretion chemistry, infection stage, and parasitic behaviour across root-knot, cyst, citrus, false root-knot, lesion, burrowing, and ectoparasitic nematodes. The synthesis distinguishes experimentally demonstrated gland localisation from evidence-weighted inference and formulates testable predictions for comparative gland transcriptomics, spatial expression, and functional silencing. This framework also identifies gland activation, secretion, and stage-critical products as targets for RNA interference, genome editing, resistance breeding, and sustainable nematode management. The principal novelty is therefore not another catalogue of nematode effectors, but a comparative model explaining when and why subventral and dorsal glands exchange, retain, or alternate their functions across contrasting parasitic lifestyles.

dorsal gland↗
PubMed1991

Enhancing effect of interleukin 1 alpha administration on antitumor effector T-cell development.

Antitumor effector T cells can be generated from tumor-draining lymph node cells by activation with anti-CD3 monoclonal antibody and interleukin 2. Fresh tumor-draining lymph node cells do not have antitumor activity, but after anti-CD3 monoclonal antibody-interleukin 2 activation, these cells mediate immunologically specific tumor regression in vivo. We examined the effect of interleukin 1 alpha administration on the development of effector T cells derived from tumor-draining lymph nodes. Mice were inoculated with tumor cells, and interleukin 1 alpha (180 to 720 ng) was administered on days 0, 2, and 4. Tumor-draining lymph nodes harvested 10 to 14 days later were activated in anti-CD3 monoclonal antibody for 2 days followed by expansion in interleukin 2 for 3 days. Antitumor efficacy of the activated cells was assessed in the adoptive immunotherapy of lung micrometastases. Administration of interleukin 1 alpha enhanced the antitumor reactivity of effector cells derived from tumor-draining lymph nodes without changing the immunologic specificity of the cells. Administration of interleukin 1 alpha did not alter the phenotype of fresh or activated tumor-draining lymph node cells. Interleukin 1 alpha deserves further investigation as an immune adjuvant in adoptive immunotherapy.

Animals↗