Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “mRNA sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 775 records · Page 43Linked to original sources
PubMed1980

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.

Base Sequence↗
PubMed1995

A reverse transcription-polymerase chain reaction technique to detect feline cytokine genes.

The ability to detect feline cytokine expression would allow further characterization of the feline immune system. Bioassays are currently available for the measurement of feline IL2, IL6 and TNF alpha but not for other biologically important cytokines. To detect the expression of other cytokines, a reverse transcription-polymerase chain reaction (RT-PCR) procedure was developed. Since feline cytokine gene sequences other than TNF alpha were not available, mammalian DNA and mRNA sequences for IL2, IFN gamma, IL4, IL6, IL10, IL12 and beta-actin, obtained from the Genbank database were compared and oligonucleotide primers chosen from consensus sequences. To validate the cytokine and beta-actin primers, peripheral blood mononuclear cells from specific pathogen free (SPF) cats were cultured in the presence of Con A for various periods of time (0-72 h). RNA was collected, reverse transcribed into cDNA, and the cDNA was amplified by PCR with each set of cytokine primer pairs. RT-PCR products were hybridized with specific 32P end-labeled internal oligonucleotide probes and then analyzed with the AMBIS imaging system to determine the kinetics of cytokine mRNA production. The beta-actin signal was used to control for sample to sample variation in the quantity of mRNA and variation in the RT and PCR reactions. Peak mRNA expression for most cytokines was found to occur between 2 to 4 h of Con A stimulation. mRNA expression was correlated with cytokine bioactivity for IL2 and IL6. Peak IL2 bioactivity occurred after 8 h of Con A stimulation, 4 h after the mRNA expression had peaked. Although IL6 mRNA expression peaked between 2 and 4 h of stimulation, bioactivity was not detected until 8 h of stimulation and continued to increase over the next 24-48 h.

Animals↗
PubMed1986

Complementarity of sequences in low molecular weight RNAs to regions of messenger and ribosomal RNAs.

Total low molecular weight nuclear RNAs of mouse ascites cells have been labeled in vitro and used as probes to search for complementary sequences contained in nuclear or cytoplasmic RNA. From a subset of hybridizing lmw RNAs, two major species of 58,000 and 35,000 mol. wt. have been identified as mouse 5 and 5.8S ribosomal RNA. Mouse 5 and 5.8S rRNA hybridize not only to 18 and 28S rRNA, respectively, but also to nuclear and cytoplasmic poly(A+) RNA. Northern blot analysis and oligo-dT cellulose chromatography have confirmed the intermolecular base-pairing of these two small rRNA sequences to total poly(A+) RNA as well as to purified rabbit globin mRNA. 5 and 5.8S rRNA also hybridize with positive (coding) but not negative (noncoding) strands of viral RNA. Temperature melting experiments have demonstrated that their hybrid stability with mRNA sequences is comparable to that observed for the 5S:18S and 5.8S:28S hybrids. The functional significance of 5 and 5.8S rRNA base-pairing with mRNAs and larger rRNAs is unknown, but these interactions could play important coordinating roles in ribosome structure, subunit interaction, and mRNA binding during translation.

Animals↗
PubMed1992

Reduced mRNA and a nonsense mutation in the insulin-receptor gene produce heritable severe insulin resistance.

Leprechaunism is an autosomal recessive syndrome of severe insulin resistance and is characterized by intrauterine growth restriction, acanthosis nigricans, hirsutism, and loss of glucose homeostasis. Here we report a new female patient of Hispanic and Afro-American descent whose fibroblasts and lymphoblasts had markedly impaired insulin binding (less than 10% of that in controls). Insulin binding to lymphoblasts established from both unrelated parents was partially impaired. Insulin-like growth factor-I (IGF-I) and epidermal growth factor (EGF) binding to the patient's fibroblasts were within the normal range. Insulin stimulation of receptor autophosphorylation and kinase activity was markedly reduced in the patient's fibroblasts. The patient's fibroblasts had both a reduced number of immunoreactive insulin receptor (6% of those in controls) and concomitantly reduced amounts of insulin-receptor mRNA, suggesting that both mutations inherited by the patient reduced insulin-receptor mRNA. Sequencing of the insulin-receptor gene and cDNA indicated that the patient was heterozygous for a paternally derived mutation at bp 1333, converting Arg372 to a STOP codon. This nonsense mutation was observed in the insulin-receptor gene, but not in cDNA, indicating reduced amounts of mRNA for the allele containing this mutation. The coding sequence of the maternally inherited insulin-receptor allele was normal. Both the marked reduction in insulin-receptor mRNA in the compound heterozygous fibroblasts of the proband and the partially reduced insulin binding in maternal cells suggest that the maternally derived mutation is located in an insulin-receptor gene sequence that controls cellular mRNA content.

Base Sequence↗
PubMed2003

Transcribed short tandem repeats occur in couples with strongly preferred registers.

Short tandem repeats (STRs) have been widely observed, but most STRs have no recognized organization or function. Here we show that for diverse mRNAs, 84% of (GC)(n) repeats were found unexpectedly coupled with another STR, (GU)(n). These STR couples exhibited preferred polarity and register. In 3(') untranslated mRNA sequences (UTRs) 100% of (GC)(n>6) repeats were tightly coupled with (GU)(n). For (GC)(n), stem folding energy correlated with the length and number of neighboring, non-folding (GU)(n) partners (p=0.014). Approximately 20% of (AU)(n>/=14) repeats were coupled with (GU)(n). The STR couple (AC)(n)(AG)(n) also exhibited polarity and register preferences. The sequence arrangement at STR-couple joints was conserved rigorously, suggesting that these sequences were under selection pressure. Some STR couples may function as mRNA processing landmarks, based on alternative transcript comparisons. These observations suggest that some transcribed STRs may be functional UTR signals with predictable organization and usage patterns.

3' Untranslated Regions↗
PubMed1998

In vivo transfer of barley stripe mosaic hordeivirus ribonucleotides to the 5' terminus of maize stripe tenuivirus RNAs.

The Tenuivirus maize stripe virus (MStV) shares many properties with viruses in the genus Phlebovirus of the family Bunyaviridae. Besides genome organization and gene expression strategies, one property shared by these plant- and vertebrate-infecting viruses is that transcription gives rise to virus-specific mRNAs containing nonviral 5'-terminal nucleotide sequences. The 5'-terminal nucleotides are believed to be derived from host mRNA sequences as a result of "cap-snatching." We investigated whether specific nucleotide sequences could serve as primer donors for cap-snatching in vivo. Barley (Hordeum vulgare) plants were singly and doubly infected with MStV and the Hordeivirus barley stripe mosaic virus (BSMV). A reverse transcription-PCR assay was used to identify chimeric BSMV/MStV RNAs. Specific reverse transcription-PCR products were detected from doubly infected plants by using one PCR primer corresponding to the 5' termini of the BSMV RNAs (alpha, beta, and gamma) and a second primer complementary to MStV RNA 4. The resulting cDNAs were cloned, and nucleotide sequence analysis showed them to be chimeric, containing BSMV 5'-terminal sequences as well as MStV RNA 4 sequences. All clones contained the BSMV RNA 5' primer nucleotide sequence, but they also showed characteristics common to Tenuivirus mRNAs. More than 80% of the clones contained BSMV RNA nucleotides not present on the PCR primer. Several lacked the exact 5' terminus of MStV RNA 4, a feature also seen for viruses in the Bunyaviridae. These data show that heterologous virus RNAs (BSMV) can serve as primer donors for MStV mRNA capped RNA-primed transcription in doubly infected plants.

DNA Primers↗
PubMed1977

HeLa cell poly(A)- mRNA codes for a subset of poly(A)+ mRNA-directed proteins with an actin as a major product.

Poly(A)+ and poly(A)- mRNA from HeLa cells were separated and translated in heterologous messenger-dependent protein synthesizing systems. Two-dimensional electrophoretic analysis revealed three classes of polypeptides. At the level of detectability in the electropherograms, a small number (about 10) of proteins were detected only among the poly(A)- mRNA products, a larger number (about 40) were produced by both poly(A)- and poly(A)+ mRNA, and a large number of polypeptides were found exclusively in the poly(A)+ mRNA products. The major product of both poly(A)+ and poly(A)- mRNA was shown to be the beta form of actin.Previous cross hybridization measurements suggested little homology between poly(A)+ and poly(A)- mRNA populations. In view of the apparent identity of many poly(A)- products with those of poly(A)+, the homology between poly(A)+ and poly(A)- mRNA sequences was examined in greater detail. cDNA complementary to only the most abundant poly(A)+ message sequences was prepared. About 10% of this cDNA hybridized to abundant sequences in the poly(A)- fraction. This corresponded to only 2% of the total mass of poly(A)+ mRNA and accounted for the failure to detect cross hybridization in previous experiments. Thus, a small number of poly(A)+ sequences appear to be present in relatively high concentration in poly(A)- mRNA as evidenced by both the translation products and the cross hybridization results.

Actins↗
PubMed1978

Enrichment of special Novikoff hepatoma and regenerating liver mRNA by hybridization to cDNA-cellulose.

Total polysomal poly(A)+ RNA of Novikoff hepatoma and of 18-hr regenerating rat liver were compared by analysis of their in vitro translational products on two-dimensional isofocusing/sodium dodecyl sulfate gels. This technique resolved the translated proteins sufficiently to permit detection of quantitative and some qualitative differences between the two mRNA populations. Excess cDNA from regenerating liver or Novikoff hepatoma, covalently linked to cellulose, was used to adsorb the complementary mRNA sequences from Novikoff hepatoma or regenerating liver. As shown by two-dimensional gel electrophoresis, the translated products of the bound mRNA fractions contained proteins common to both tissues. Novikoff hepatoma mRNA which did not bind to regenerating liver cDNA was enriched in sequences encoding for proteins 11/5.1, 15/6.8, 40/8.2, and 65/5.1 (shown as molecular weight/pI). These polypeptides were not detectable in the translational products of regenerating liver mRNA. Regenerating liver mRNA that was not bound to Novikoff hepatoma cDNA was enriched in sequences coding for proteins 12.5/4.9, 13.5/7.4, 17/8.2, 24/5.5, and 46/6.4; these proteins were not found in the translational pattern from Novikoff hepatoma. These results show that adsorption of mRNA to solid-phase cDNA provides a valuable technique for differentiating mRNA species in related tissues and for corresponding enrichment of these specific mRNAs.

Animals↗
PubMed1985

Evaluation of rat insulin messenger RNA in pancreatic and extrapancreatic tissues.

The purpose of these studies was to determine whether insulin detected immunochemically in extrapancreatic tissues of the adult rat is synthesized in situ by quantitating mRNA in these tissues. A blot hybridization assay was utilized with cloned 32P-proinsulin cDNA. The lower limit of detection was estimated to be 3pg. Proinsulin mRNA concentration was found to be 1000-1500 micrograms in isolated pancreatic islets and was easily detected in total pancreatic RNA at 10-15 pg/micrograms. Proinsulin mRNA was quantitated in rat insulinoma cells adapted to culture at levels 1:50 those in normal islets. Samples of RNA (20-50 micrograms) enriched about 50-fold for mRNA sequences by repeated oligo-deoxythymidylate chromatography were assayed. No insulin mRNA was detected in 50 micrograms samples of RNA from brain or in 20 micrograms samples from subsections of brain or other extrapancreatic tissues. RNA samples were undegraded as assessed by ability to stimulate protein synthesis in a cell-free system. Proinsulin mRNA from pancreas as added to brain homogenates and recovered intact. Brain RNA samples with insulin mRNA levels 1:1000 that of pancreas would be predicted to have 50-75 pg proinsulin mRNA/50 micrograms sample assayed if present. Because none was found, brain must have a concentration less than 1:6,000 that of pancreas. These findings suggest that immunoassayable insulin detected in extrapancreatic tissues of the adult rat is synthesized by the pancreas.

Animals↗
PubMed1979

Regulation of albumin synthesis in rat liver.

The present report reviews our findings on the subcellular distribution of albumin mRNA in rat liver under normal and abnormal physiologic conditions, the identification of albumin mRNA in specific mRNP complexes in liver cytosol of starved rats, and evidence fo albumin mRNA sequences in a higher molecular weight nuclear precursor to cytoplasmic albumin mRNA.

Albumins↗
PubMed1988

A highly sensitive Northern blot assay detects multiple proenkephalin A-like mRNAs in human caudate nucleus and pheochromocytoma.

Total RNA from post mortem human caudate nucleus, cerebellum, cerebral cortex and pheochromocytoma tissues has been prepared. Northern blot analysis, using a single-stranded human proenkephalin A antisense probe (cRNA), revealed the existence of two different proenkephalin A-like sequences in the human caudate nucleus and pheochromocytoma RNA extracts of approximately 1400 and 1000 nucleotides in length respectively, whereas no specific RNA bands could be detected in the cortex and only the 1400 nucleotide band was present in the cerebellum. Under highly stringent hybridization conditions, the proenkephalin A-like RNA bands still appear, indicating that the detected RNA species have either identical or a closely related sequence to that of the well-characterized human proenkephalin A mRNA sequence.

Adrenal Gland Neoplasms↗
PubMed1988

Characterization of cytochrome c oxidase III transcripts that are edited only in the 3' region.

The cytochrome c oxidase subunit III (COIII) transcript of T. brucei is extensively edited by the addition and deletion of uridines. We have identified partially edited COIII RNAs; they have unedited 5' and edited 3' regions. Transcripts with edited 5' but unedited 3' regions were not detected. The partially edited RNAs may be editing intermediates. The junctions of unedited and edited sequences in cDNAs differ from both the DNA and fully edited mRNA sequences over a multinucleotide region. The partially edited RNAs could arise from several processes, but it seems likely that editing proceeds in the 3' to 5' direction.

Animals↗
PubMed1989

Poly(A), poly(A) binding protein and the regulation of mRNA stability.

This review has focused on the possibility that interactions between mRNA sequences and the poly(A)-nucleoprotein complex play important roles in mRNA turnover. It is important to stress that additional genetic and biochemical tests are necessary to characterize how PABP interacts with mRNA in cells and to determine whether the poly(A) protection hypothesis is accurate. Moreover, there may be a significant number of mRNAs whose half-lives are independent of polyadenylation. For example, the stabilities of poly(A)-containing and deadenylated alpha 2u-globulin and interferon mRNAs are similar in microinjected oocytes. Thus, an important challenge in this field will be to analyse the complex and interactive factors that determine the half-lives of specific mRNAs.

Carrier Proteins↗
PubMed1981

Analysis of interferon mRNA in human fibroblast cells induced to produce interferon.

The levels of interferon mRNA as a function of interferon induction by poly(rI) . poly(rC) in human fibroblast cells were determined by RNA hybridization using a cloned beta interferon cDNA and by translation in Xenopus oocytes. Whereas previous studies analyzed mixtures of interferons, the availability of the cloned beta interferon cDNA and the antiserum to purified beta interferon enabled us to focus on the expression of only one class (beta) of interferon genes. The induction of interferon synthesis depends primarily on the accumulation of interferon beta mRNA in the cells, and the interferon beta mRNA rapidly disappears several hours after its appearance in the cytoplasm. No detectable interferon beta mRNA sequences are present in uninduced cells. The degradation of interferon beta mRNA in the induced cells requires ongoing protein synthesis; accumulation of interferon beta mRNA was observed in the continuous presence of cycloheximide. The interferon beta mRNA detected at the early stages of induction is 1100 nucleotides long and its size progressively decreases with time. By both the hybridization and the translational assay in Xenopus oocytes, only one size of interferon beta mRNA and one species of beta interferon could be identified.

Cells, Cultured↗
PubMed1991

Endonucleolytic degradation of puf mRNA in Rhodobacter capsulatus is influenced by oxygen.

The formation of pigment-protein complexes in facultatively photosynthetic bacteria is regulated by the oxygen tension in the culture. It is shown that the degradation of some mRNA species encoding components of the photosynthetic apparatus is affected by oxygen. The puf mRNA segment, encoding the pigment-binding proteins of the reaction center, and the 0.5-kb puc mRNA species, encoding pigment-binding proteins of the light-harvesting LHII antenna complex of Rhodobacter capsulatus were degraded more rapidly under high oxygen tension than under low oxygen tension. Studies on strains having deletions or insertions in the puf operon indicate that rate-limiting endonucleolytic cleavage in the reaction center coding region of the polycistronic puf mRNA was influenced by growth conditions. However, other mRNA segments, for which exonucleolytic degradation was postulated to be rate-limiting, decayed with the same rate under either high or low oxygen tension. Likewise, the degradation of the puhA mRNA, the cycA mRNA, and the cytfbc mRNA was found to be independent of the oxygen tension in the culture. The data strongly suggest that specific mRNA sequences or structures are responsible for the observed oxygen effect on mRNA stability.

Blotting, Northern↗
PubMed1983

cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs.

Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago.

Amino Acid Sequence↗
PubMed2000

Down-regulation of cyclin D1 expression by prostaglandin A(2) is mediated by enhanced cyclin D1 mRNA turnover.

Prostaglandin A(2) (PGA(2)), an experimental chemotherapeutic agent, causes growth arrest associated with decreased cyclin D1 expression in several cancer cell lines. Here, using human non-small-cell lung carcinoma H1299 cells, we investigated the mechanisms whereby PGA(2) down-regulates cyclin D1 expression. Transcription rates of the cyclin D1 gene, studied using a cyclin D1 promoter-luciferase construct and nuclear run-on assays, were not affected by PGA(2) treatment. Instead, the cyclin D1 mRNA was rendered unstable after exposure to PGA(2). Since the stability of labile mRNA is modulated through binding of proteins to specific mRNA sequences, we sought to identify protein(s) recognizing the cyclin D1 mRNA. In electrophoretic mobility-shift assays using radiolabeled RNA probes derived from different regions of cyclin D1 mRNA, we observed that (i) lysates prepared from PGA(2)-treated cells exhibited enhanced protein-cyclin D1 RNA complex formation; (ii) the kinetics of complex formation correlated closely with that of cyclin D1 mRNA loss; and (iii) binding occurred within a 390-base cyclin D1 3' untranslated region (UTR) (K12). This binding activity could be cross-linked, revealing proteins ranging from 30 to 47 kDa. The RNA-binding protein AUF1, previously associated with the degradation of target mRNAs, bound cyclin D1 mRNA, because anti-AUF1 antibodies were capable of supershifting or immunoprecipitating cyclin D1 mRNA-protein complexes. Finally, insertion of K12 in the 3'UTR of reporter genes markedly reduced the expression and half-life of the resulting chimeric mRNAs in transfected, PGA(2)-treated cells. Our data demonstrate that PGA(2) down-regulates cyclin D1 expression by decreasing cyclin D1 mRNA stability and implicates a 390-base element in the 3'UTR in this regulation.

3' Untranslated Regions↗
PubMed1985

The sequence of 967 amino acids at the carboxyl-end of rat thyroglobulin. Location and surroundings of two thyroxine-forming sites.

The entire rat thyroglobulin mRNA sequence (about 8500 nucleotides) has been cloned in five recombinant plasmids containing overlapping cDNA inserts. The 3' end of the mRNA is precisely defined by the poly (A) tail found in the furthest 3' end clone. Evidence that most of the 5' end is cloned come from size considerations and from a primer extension experiment. At the 3' end of the mRNA only one long open reading frame is present in the sequence of 3018 nucleotides that has been established. In the deduced protein sequence we have localized two thyroxine-forming sites in a region containing a high concentration of tyrosine residues.

Amino Acid Sequence↗