Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “MD simulation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 775 records · Page 43Linked to original sources
PubMed2000

Monte carlo simulation of the mixed alkali effect with cooperative jumps

In our previous works on molecular dynamics (MD) simulations of lithium metasilicate (Li2SiO3), it has been shown that the long time behavior of the lithium ions in Li2SiO3 has been characterized by the component showing the enhanced diffusion (Levy flight) due to cooperative jumps. It has also been confirmed that the contribution of such component decreases by interception of the paths in the mixed alkali silicate (LiKSiO3). Namely, cooperative jumps of like ions are much decreased in number owing to the interception of the path for unlike alkali-metal ions. In the present work, we have performed a Monte Carlo simulation using a cubic lattice in order to establish the role of the cooperative jumps in the transport properties in a mixed alkali glass. Fixed particles (blockage) were introduced instead of the interception of the jump paths for unlike alkali-metal ions. Two types of cooperative motions (a pull type and a push type) were taken into account. Low-dimensionality of the jump path caused by blockage resulted in a decrease of a diffusion coefficient of the particles. The effect of blockage is enhanced when the cooperative motions were introduced.

Journal Article↗
PubMed2006

Self-assembling of peptide/membrane complexes by atomistic molecular dynamics simulations.

Model biological membranes consisting of peptide/lipid-bilayer complexes can nowadays be studied by classical molecular dynamics (MD) simulations at atomic detail. In most cases, the simulation starts with an assumed state of a peptide in a preformed bilayer, from which equilibrium configurations are difficult to obtain due to a relatively slow molecular diffusion. As an alternative, we propose an extension of reported work on the self-organization of unordered lipids into bilayers, consisting of including a peptide molecule in the initial random configuration to obtain a membrane-bound peptide simultaneous to the formation of the lipid bilayer. This strategy takes advantage of the fast reorganization of lipids, among themselves and around the peptide, in an aqueous environment. Model peptides of different hydrophobicity, CH3-CO-W2L18W2-NH2 (WL22) and CH3-CO-W2A18W2-NH2 (WA22), in dipalmitoyl-phosphatidylcholine (DPPC) are used as test cases. In the equilibrium states of the peptide/membrane complexes, achieved in time ranges of 50-100 ns, the two peptides behave as expected from experimental and theoretical studies. The strongly hydrophobic WL22 is inserted in a transmembrane configuration and the marginally apolar, alanine-based WA22 is found in two alternative states: transmembrane inserted or parallel to the membrane plane, embedded close to the bilayer interface, with similar stability. This shows that the spontaneous assembly of peptides and lipids is an unbiased and reliable strategy to produce and study models of equilibrated peptide/lipid complexes of unknown membrane-binding mode and topology.

Computer Simulation↗
PubMed2002

Molecular dynamics simulation of the ligand binding domain of mGluR1 in response to agonist and antagonist binding.

The interdomain movements of the ligand binding domain (LBD) of mGluR1 in response to agonist or antagonist binding are studied by 2 ns molecular dynamics (MD) simulations. Our results indicate that MD is able to reproduce many of the experimentally determined features of the open and closed conformations of LBD. Analysis of the ligand behavior over time allows to delineate some of the molecular determinants responsible for the agonist-induced or antagonist-blocked LBD responses.

Binding Sites↗
PubMed1998

Functional conformational changes of endo-1,4-xylanase II from Trichoderma reesei: a molecular dynamics study.

Recent crystallographic studies have revealed a range of structural changes in the three-dimensional structure of endo-1,4-xylanase (XYNII) from Trichoderma reesei. The observed conformational changes can be described as snapshots of an open-close movement of the active site of XYNII. These structures were further analyzed in this study. In addition, a total of four 1 ns molecular dynamics (MD) simulations were performed representing different states of the enzyme. A comparison of the global and local changes found in the X-ray structures and the MD runs suggested that the simulations reproduced a similar kind of active site opening and closing as predicted by the crystal structures. The open-close movement was characterized by the use of distance difference matrixes and the Hinge-find program (Wriggers and Schulten, Proteins 29:1-14, 1997) to be a 'hinge-bending' motion involving two large rigidly-moving regions and an extended hinge. This conformational feature is probably inherent to this molecular architecture and probably plays a role in the function of XYNII.

Binding Sites↗
PubMed2005

A molecular dynamics computer simulation study of room-temperature ionic liquids. II. Equilibrium and nonequilibrium solvation dynamics.

The molecular dynamics (MD) simulation study of solvation structure and free energetics in 1-ethyl-3-methylimidazolium chloride and 1-ethyl-3-methylimidazolium hexafluorophosphate using a probe solute in the preceding article [Y. Shim, M. Y. Choi and H. J. Kim, J. Chem. Phys. 122, 044510 (2005)] is extended to investigate dynamic properties of these liquids. Solvent fluctuation dynamics near equilibrium are studied via MD and associated time-dependent friction is analyzed via the generalized Langevin equation. Nonequilibrium solvent relaxation following an instantaneous change in the solute charge distribution and accompanying solvent structure reorganization are also investigated. Both equilibrium and nonequilibrium solvation dynamics are characterized by at least two vastly different time scales--a subpicosecond inertial regime followed by a slow diffusive regime. Solvent regions contributing to the subpicosecond nonequilibrium relaxation are found to vary significantly with initial solvation configurations, especially near the solute. If the solvent density near the solute is sufficiently high at the outset of the relaxation, subpicosecond dynamics are mainly governed by the motions of a few ions close to the solute. By contrast, in the case of a low local density, solvent ions located not only close to but also relatively far from the solute participate in the subpicosecond relaxation. Despite this difference, linear response holds reasonably well in both ionic liquids.

Journal Article↗
PubMed2006

Solvation dynamics of C153 in supercritical fluoroform: a simulation study based on two-site and five-site models of the solvent.

Molecular dynamics (MD) simulations of a probe solute (coumarin C153) in supercritical fluoroform are used to study time-dependent solute-solvent interactions. We study the dynamics of solvent reorganization in response to electronic excitation of C153 at a temperature of 1.03 T(c) (the critical temperature) and a series of densities above and below the critical density. Simulations of a two-site and five-site models of fluoroform are presented and compared. The time-dependent solvation response after solute electronic excitation is studied in the two cases, and the five-site results present an earlier onset of exponential decay that is closer to what is expected to be the experimental response. This is confirmed by comparison to experiment. In addition to obtaining the solvation response from nonequilibrium MD trajectories, approximate solvation responses were obtained from equilibrium time correlations of the fluctuations in the solvation energy change in the presence of ground- and excited-state solutes. For the five-site model, the equilibrium excited-state response shows stronger density dependence than the ground-state one. The nonequilibrium response appears to have an intermediate decay rate between the two equilibrium functions. The solute-partial-charge-solvent-induced-dipole interaction was also taken into account by means of a perturbative approach, which improved the agreement with experimental measurements available at densities corresponding to 1.4-1.6 rho(c) (where rho(c) the critical density). From the comparison between the two models, it is possible to conclude that an atomistic description is necessary for correctly representing the portion of solvation dynamics that is related to reorientation. This consideration is supported by providing results for orientational time correlation functions and by comparing the correlation times with the experimental ones.

Journal Article↗
PubMed2006

Effects of metal ion and solute conformation change on hydration of small amino acid.

The effects of metal ion and solute conformation change on the structures, energetic and dynamics of water molecules in the first hydration shell of amino acid were studied, using three forms of alanine (Ala) and Li(+)/Ala as model molecules. The theoretical investigations were started with construction of the test-particle model (T-model) potentials for all molecules involved and followed by molecular dynamics (MD) simulations of [Ala](aq) and [Li(+)/Ala](aq) at 298 K. The MD results showed that the hydrogen bond (H-bond) networks of water at the functional groups of Ala are strengthened by the metal ion binding, whereas the rotation of the N-C(alpha) bond from the angle phi=0 degrees to 180 degrees brings about smaller effects which cannot be generalized. It was also shown that the dynamics of water molecule in the first hydration shell of amino acid could be estimated from the total-average potential energy landscapes and the water exchange diagrams. The MD results suggested inclusion of an additional dynamic step in the water exchange process, in which water molecule moves inside a channel within the first hydration shell of solute, before leaving the channel at some point. The theoretical results reported in the present work iterated the necessity to include explicit water molecules in the model calculations.

Alanine↗
PubMed2006

Phi-analysis at the experimental limits: mechanism of beta-hairpin formation.

The 37-residue Formin-binding protein, FBP28, is a canonical three-stranded beta-sheet WW domain. Because of its small size, it is so insensitive to chemical denaturation that it is barely possible to determine accurately a denaturation curve, as the transition spans 0-7 M guanidinium hydrochloride (GdmCl). It is also only marginally stable, with a free energy of denaturation of just 2.3 kcal/mol at 10 degrees Celsius so only small changes in energy upon mutation can be tolerated. But these properties and relaxation times for folding of 25 micros-400 micros conspire to allow the rapid acquisition of accurate and reproducible kinetic data for Phi-analysis using classical temperature-jump methods. The transition state for folding is highly polarized with some regions having Phi-values of 0 and others 1, as readily seen in chevron plots, with Phi-values of 0 having the refolding arms overlaying and those of 1 the unfolding arms superimposable. Good agreement is seen with transition state structures identified from independent molecular dynamics (MD) simulations at 60, 75, and 100 degrees Celsius, which allows us to explore further the details of the folding and unfolding pathway of FBP28. The first beta-turn is near native-like in the transition state for folding (experimental) and unfolding (MD and experiment). The simulations show that there are transient contacts between the aromatic side-chains of the beta-strands in the denatured state and that these interactions provide the driving force for folding of the first beta-hairpin of this three-stranded sheet. Only after the backbone hydrogen bonds are formed between beta1 and beta2 does a hydrogen bond form to stabilize the intervening turn, or the first beta-turn.

Amino Acid Sequence↗
PubMed1998

Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.

A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.

Adenine↗
PubMed2005

Mesoscale model of polymer melt structure: self-consistent mapping of molecular correlations to coarse-grained potentials.

Development and application of coarse-graining methods to condensed phases of macromolecules is an active area of research. Multiscale modeling of polymeric systems using coarse-graining methods presents unique challenges. Here we apply a coarse-graining method that self-consistently maps structural correlations from detailed molecular dynamics (MD) simulations of alkane oligomers onto coarse-grained potentials using a combination of MD and inverse Monte Carlo methods. Once derived, the coarse-grained potentials allow computationally efficient sampling of ensemble of conformations of significantly longer polyethylene chains. Conformational properties derived from coarse-grained simulations are in excellent agreement with experiments. The level of coarse graining provides a control over the balance of computational efficiency and retention of chemical identity of the underlying polymeric system. Challenges to extension and application of this and similar structure-based coarse-graining methods to model dynamics and phase behavior in polymeric systems are briefly discussed.

Journal Article↗
PubMed1997

Characterization of lipid membrane dynamics by simulation: I. Torsion angle motions of the linear chains.

The torsion angle motions, generated from molecular dynamics (MD) simulations, of the two aliphatic chains of 1,2-dimyristoyl-sn-glycero-3-phosphatidylcholine (DMPC) in its lipid monolayer were evaluated by comparing these motions to those of an equivalent isolated (free) n-alkane chain, and the same n-alkane chain in its crystal lattice. The time-dependent autocorrelation and (1,2)-, (1,3)-, (1,4)-, and (1,5)-cross-correlation functions were constructed to analyze the torsion angle motions. It was found that the torsion angle motions of the DMPC lipid monolayer aliphatic chains are intermediate to those of the free n-alkane chain and the same n-alkane chain in its crystal lattice, particularly for short correlation times. The torsion angle motions of the aliphatic chains of DMPC are also found to be essentially independent of the charge state on the head group. The linear aliphatic chains of a DMPC lipid monolayer behave most like the isolated n-alkane chains with respect to torsion angle flexibility, even though the pairs of aliphatic chains of each DMPC are part of an ordered monolayer assembly. The aliphatic chains of the DMPC molecules in their monolayer exhibit at least two types of wave motions. One of the wave motions is the same in form, though somewhat more diffuse, as a traveling wave found in n-alkane crystals. The other wave motion involves major torsion angle transitions, and has some characteristics of the soliton properties observed in n-alkane crystals near their respective melt transition temperatures.

Computer Simulation↗
PubMed2005

Molecular dynamics simulation of sucrose- and trehalose-coated carboxy-myoglobin.

We performed a room temperature molecular dynamics (MD) simulation on a system containing 1 carboxy-myoglobin (MbCO) molecule in a sucrose-water matrix of identical composition (89% [sucrose/(sucrose + water)] w/w) as for a previous trehalose-water-MbCO simulation (Cottone et al., Biophys J 2001;80:931-938). Results show that, as for trehalose, the amplitude of protein atomic mean-square fluctuations, on the nanosecond timescale, is reduced with respect to aqueous solutions also in sucrose. A detailed comparison as a function of residue number evidences mobility differences along the protein backbone, which can be related to a different efficacy in bioprotection. Different heme pocket structures are observed in the 2 systems. The joint distribution of the magnitude of the electric field at the CO oxygen atom and of the angle between the field and the CO unit vector shows a secondary maximum in sucrose, absent in trehalose. This can explain the CO stretching band profile (A substates distribution) differences evidenced by infrared spectroscopy in sucrose- and trehalose-coated MbCO (Giuffrida et al., J Phys Chem B 2004;108:15415-15421), and in particular the appearance of a further substate in sucrose. Analysis of hydrogen bonds at the protein-solvent interface shows that the fraction of water molecules shared between the protein and the sugar is lower in sucrose than in trehalose, in spite of a larger number of water molecules bound to the protein in the former system, thus indicating a lower protein-matrix coupling, as recently observed by Fourier transform infrared (FTIR) experiments (Giuffrida et al., J Phys Chem B 2004;108:15415-15421).

Binding Sites↗
PubMed2006

Structural and dynamical properties of different protonated states of mutant HIV-1 protease complexed with the saquinavir inhibitor studied by molecular dynamics simulations.

To understand the basis of drug resistance, particularly of the HIV-1 PR, three molecular dynamics (MD) simulations of HIV-1 PR mutant species, G48V, complexed with saquinavir (SQV) in explicit aqueous solution with three protonation states, diprotonation on Asp25 and Asp25' (Di-pro) and monoprotonation on each Asp residue (Mono-25 and Mono-25'). For all three states, H-bonds between saquinavir and HIV-1 PR were formed only in the two regions, flap and active site. It was found that conformation of P2 subsite of SQV in the Mono-25 state differs substantially from the other two states. The rotation about 177 degrees from the optimal structure of the wild type was observed, the hydrogen bond between P2 and the flap residue (Val48) was broken and indirect hydrogen bonds with the three residues (Asp29, Gly27, and Asp30) were found instead. In terms of complexation energies, interaction energy of -37.3 kcal/mol for the Mono-25 state is significantly lower than those of -30.7 and -10.7kcal/mol for the Mono-25' and Di-pro states, respectively. It was found also that protonation at the Asp25 leads to a better arrangement in the catalytic dyad, i.e., the Asp25-Asp25' interaction energy of -8.8 kcal/mol of the Mono-25 is significantly lower than that of -2.6kcal/mol for the Mono-25' state. The above data suggest us to conclude that interaction in the catalytic area should be used as criteria to enhance capability in drug designing and drug screening instead of using the total inhibitor/enzyme interaction.

Binding Sites↗
PubMed2006

Structure and energetics of channel-forming protein-polysaccharide complexes inferred via computational statistical thermodynamics.

The ion channel protein alpha-hemolysin (alphaHL) forms supramolecular complexes with the polysaccharide beta-cyclodextrin (betaCD). This system has potential uses in nanoscale device engineering. It has been found recently that betaCD formed longer- or shorter-lived complexes with some engineered alphaHL mutants then with a wild type protein (Gu et al. J. Gen. Physiol. 2001, 118, 481-493). However, how changes in the protein sequence affect complex lifetime was not completely understood in part due to the lack of knowledge of structures of these metastable complexes. In this paper, we present an extensive molecular modeling study of the betaCD-alphaHL and selected mutant complexes to gain insights into the betaCD-alphaHL interaction mechanisms and to predict possible structures and energetics of the complexes. Thermodynamic integration (TI) and umbrella sampling (US) techniques (with the weighted histogram analysis method (WHAM)) were used to calculate the relative binding affinities of the complexes formed with the wild type alphaHL and the M113N, M113E, M113A, and M113V mutants. Our results are in excellent agreement with experiment. While betaCD-M113N and betaCD-M113A complexes were stable in the configuration of the wild type complex, the equilibrium configuration of the betaCD-M113V and betaCD-M113E complexes was significantly different. In these cases, TI alone was insufficient to accurately calculate the corresponding free energy differences. By utilizing a TI/US combination in a novel manner, we were able to accurately calculate free energy changes in these flexible systems. The betaCD-M113A and betaCD-M113E complexes, which exhibited shorter lifetimes than other complexes in an experiment, in simulations exhibited greater flexibility and higher water solvation of the betaCD adapter. MD simulations of the betaCD-M113N complex with betaCD in a downward orientation were also performed.

Bacterial Proteins↗
PubMed2002

Molecular dynamics simulation for ligand-receptor studies. Carbohydrates interactions in aqueous solutions.

The review deals with the problem of the study of ligand-receptor interactions and the use of Molecular Dynamics (MD) simulation to approach such a problem. After a short review of the fundamentals of MD we describe the medium in which all biology takes place, water. Emphasis is put on the water models appropriate for simulation of macromolecular systems explicitly including the water molecules. We consider the quality of the water model both in terms of simplicity and performance to describe the liquid water properties. Heavy water, although not a biologically viable medium, is considered since many experiments make use of it as a solvent. Sweetness of carbohydrates is considered as an example of the procedure suitable to characterize active sites on the ligands. Consideration is given to the computation of the binding constants through molecular dynamics. The computation of the Free Energy is described and illustrated. The potentiality of MD for studies of ligand-receptor interactions is limited by the computer resources, for even with large computing facilities the need of relatively long simulation times severely restricts the study of large systems. A method is described in which several shells are treated at different levels of approximation, form mechanical response and mean electrical field to quantum mechanics, through stochastic dynamics and atomic classical MD. The review closes with a brief account of the perspectives of the method.

Binding Sites↗
PubMed2005

Molecular dynamics simulations of the 136 unique tetranucleotide sequences of DNA oligonucleotides. II: sequence context effects on the dynamical structures of the 10 unique dinucleotide steps.

Molecular dynamics (MD) simulations including water and counterions on B-DNA oligomers containing all 136 unique tetranucleotide basepair steps are reported. The objective is to obtain the calculated dynamical structure for at least two copies of each case, use the results to examine issues with regard to convergence and dynamical stability of MD on DNA, and determine the significance of sequence context effects on all unique dinucleotide steps. This information is essential to understand sequence effects on DNA structure and has implications on diverse problems in the structural biology of DNA. Calculations were carried out on the 136 cases embedded in 39 DNA oligomers with repeating tetranucleotide sequences, capped on both ends by GC pairs and each having a total length of 15 nucleotide pairs. All simulations were carried out using a well-defined state-of-the-art MD protocol, the AMBER suite of programs, and the parm94 force field. In a previous article (Beveridge et al. 2004. Biophysical Journal. 87:3799-3813), the research design, details of the simulation protocol, and informatics issues were described. Preliminary results from 15 ns MD trajectories were presented for the d(CpG) step in all 10 unique sequence contexts. The results indicated the sequence context effects to be small for this step, but revealed that MD on DNA at this length of trajectory is subject to surprisingly persistent cooperative transitions of the sugar-phosphate backbone torsion angles alpha and gamma. In this article, we report detailed analysis of the entire trajectory database and occurrence of various conformational substates and its impact on studies of context effects. The analysis reveals a possible direct correspondence between the sequence-dependent dynamical tendencies of DNA structure and the tendency to undergo transitions that "trap" them in nonstandard conformational substates. The difference in mean of the observed basepair step helicoidal parameter distribution with different flanking sequence sometimes differs by as much as one standard deviation, indicating that the extent of sequence effects could be significant. The observations reveal that the impact of a flexible dinucleotide such as CpG could extend beyond the immediate basepair neighbors. The results in general provide new insight into MD on DNA and the sequence-dependent dynamical structural characteristics of DNA.

Base Pairing↗
PubMed1988

Molecular modeling and dynamics of neuropeptide Y.

A combination of molecular modeling and molecular dynamics (MD) is used to determine a theoretical structure for neuropeptide Y (NPY). Starting with the X-ray structure for avian pancreatic polypeptide (APP), the substituted amino acids were mutated, the side chains oriented to local potential energy minima, and the entire structure minimized and subjected to an MD simulation. Comparison of the resulting NPY structure with APP X-ray and MD results showed secondary structural elements to be maintained and RMS fluctuations to be similar, although differences in both were observed. The approach presented offers a means to study the structure-function relationships of NPY and other similar polypeptides when combined with pharmacological measurements.

Computer Simulation↗
PubMed2003

Molecular dynamics simulation of the formation, structure, and dynamics of small phospholipid vesicles.

Here, we use coarse grained molecular dynamics (MD) simulations to study the spontaneous aggregation of dipalmitoylphosphatidylcholine (DPPC) lipids into small unilamellar vesicles. We show that the aggregation process occurs on a nanosecond time scale, with bicelles and cuplike vesicles formed at intermediate stages. Formation of hemifused vesicles is also observed at higher lipid concentration. With either 25% dipalmitoylphosphatidylethanolamine (DPPE) or lysoPC mixed into the system, the final stages of the aggregation process occur significantly faster. The structure of the spontaneously formed vesicles is analyzed in detail. Microsecond simulations of isolated vesicles reveal significant differences in the packing of the lipids between the inner and outer monolayers, and between PC, PE, and lysoPC. Due to the small size of the vesicles they remain almost perfectly spherical, undergoing very limited shape fluctuations or bilayer undulations. The lipid lateral diffusion rate is found to be faster in the outer than in the inner monolayer. The water permeability coefficient of the pure DPPC vesicles is of the order of 10(-)(3) cm s(-)(1), in agreement with experimental measurements.

1,2-Dipalmitoylphosphatidylcholine↗