Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genes, Insect”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 775 records · Page 43Linked to original sources
PubMed1997

Tissue-specific alternative splicing of Shaker potassium channel transcripts results from distinct modes of regulating 3' splice choice.

Alternative splicing of precursor RNA enables a single gene to encode multiple protein isoforms with different functional characteristics and tissue distributions. Differential splicing of Drosophila Shaker (Sh) gene transcripts regulates the tissue-specific expression of kinetically distinct potassium ion channels throughout development. Regulation of Sh alternative splicing is being examined in germline transformants using lacZ as a reporter gene. P-element constructs were generated in which one or both of the two mutually exclusive Sh 3' acceptor sites were positioned in the same translational reading frame as the lacZ coding sequences. The constructs were introduced into the germline and the transgenic animals examined for tissue-specific beta-galactosidase expression patterns. Some tissues exhibit "promiscuous" splicing; these tissues are competent to splice to either 3' acceptor even when both are present on the same pre-mRNA. In other tissues splice choice results from competition between the two 3' sites; these tissues can splice to either site when it is the only available 3' acceptor, but when given a choice will splice to only one of the two 3' acceptors. In some tissues, splicing occurs exclusively at only one of the 3' acceptor sites; these tissues are not competent to splice to one of the sites even if it is the only 3' acceptor present on the pre-mRNA. These results suggests that multiple, distinct regulatory modes are operating to control tissue-specific alternative splicing of Sh 3' domains and are discussed in terms of potential underlying mechanisms for regulating the tissue-specific expression of alternatively spliced genes.

Alternative Splicing↗
PubMed1997

Location and mapping of an autosomal recessive mutation causing unique phenotypic change in Drosophila bipectinata.

In Drosophila bipectinata, flies with bilateral outgrowths on thorax were detected in sepia eye colour mutant stock. Such thoracic outgrowths have not been reported earlier in any species of Drosophila and appear to be unique phenotypic change in D. bipectinata caused due to autosomal recessive mutation. By using a double recessive mutant stock (se og) and a wild type stock, crosses were made and on the basis of recombination data of F1 females, the og mutation was mapped on the second chromosome of D.bipectinata. Further, D. bipectinata exhibits spontaneous male recombination in low frequency.

Animals↗
PubMed1997

[Search for insertion mutations disrupting mitosis using a transposon from the reporter gene in Drosophila melanogaster].

Transpositions of the vector P[lArB] into the regions 78D, 61F, and 85F of chromosome 3, which result in various anomalies of mitoses in neural ganglions of homozygous larvae, were obtained by insertion mutagenesis. The tissue specificity of regulatory elements controlling the reporter gene was studied by staining for the activity of beta-galactosidase reporter gene of the vector P[lArB]. These regulatory elements are suggested to be the enhancers of the genes carrying insertions. In all studied mutants, staining for beta-galactosidase was found in tissues containing actively proliferating cells. The staining of germarium in adult female ovaries was the most pronounced. The germarium staining pattern was used for the identification of novel insertions leading to mitosis abnormalities. The P1003 (99F) insertion was found, which according to preliminary data leads to an increase in the mitotic index and anomalies of chromosome structure in neuroblasts of homozygous larvae. In addition, the 22w (42A) insertion leading to chromosome arrest in metaphase was found.

Animals↗
PubMed1998

From pattern to gene, from gene to pattern.

Our understanding of animal development has been revolutionized by genetic approaches to the identification and isolation of pattern-regulating genes. In the past several years, fundamental embryological concepts such as morphogenetic fields, compartments, and organizers have been defined at a molecular level and visualized in developing animals. Here, I will discuss how the focus on the regulation and function of genes with dramatic effects on pattern formation, primarily by through the analysis of gene expression patterns as surrogates of physical pattern elements, has elucidated gene hierarchies that control developmental pathways.

Animals↗
PubMed1998

From selectors to realizators.

In 1975 Antonio Garcia-Bellido proposed a framework for understanding the morphogenetic function of homeotic genes in terms of selector genes and realizator genes. Since then, much has been learnt of the molecular nature and expression patterns of the Hox selector genes. Our identification of realizator genes, and our understanding of how specific sets of realizators are activated in different segments, is still far from complete, however. Here we discuss the nature of the Hox target genes identified so far and the basis of the target specificity of Hox gene products.

Animals↗
PubMed1998

Hox genes, homeosis and the evolution of segment identity: no need for hopeless monsters.

Significant changes have occurred in the developmental role of Hox genes, even within groups of arthropods that already have complex body plans and many different segment types. This is hard to reconcile with the 'selector gene' model for Hox gene function. Selector genes act as stable binary switches that direct lineages of cells to adopt alternative developmental fates. This model suggests that the regulation of selector genes can only evolve through mutations that alter the identity of whole developmental compartments -in the case of Hox genes, whole segments. Once segments have evolved distinct morphology and function, such mutations will result in dramatic homeotic transformations that are unlikely to be tolerated by natural selection. Thus we would expect the developmental role of these "master control genes" to become frozen as body plans become more complex. I argue for a revised model for the role and regulation of the Hox genes. This provides alternative mechanisms for evolutionary change, that may lead to incremental changes in segment morphology. The summation of such changes over long periods of time would result in differences in Hox gene function between taxa comparable to the effects of gross homeotic mutations, without the need to invoke the selective advantage of hopeful monsters.

Abnormalities, Multiple↗
PubMed1998

The mutation rate and the distribution of mutational effects of viability and fitness in Drosophila melanogaster.

The empirical distributions of the average viability and fitness of mutation accumulation lines of Drosophila melanogaster were analyzed using minimum distance estimation. Data come from two different experimental designs where mutations were allowed to accumulate: 1) in copies of chromosome II protected from natural selection and recombination (viability: Mukai et al., 1972; Ohnishi, 1977; fitness: Houle et al., 1992), 2) in inbred lines derived from the same isogenic stock (viability: Fernández & López-Fanjul, 1996; fitness: this paper). Information from all data sets converged, indicating that the mutational rates were small, about 1% for viability and 3% for fitness. For both traits, the rate of mutational decline appears to be smaller than suggested by previous studies (about one-fifth of the latter), the average mutational effect was neither severe nor very slight, ranging from -0.1 to -0.3, and the distribution of mutant effects was, at most, slightly leptokurtic. Therefore, the mutational load in natural populations is one to two orders of magnitude smaller than previously thought (as based upon analyses conditional to estimates of the mutational decline of viability or fitness that appear to be biased upward). Over 95% of the mutational variance of each trait was contributed by non-slightly deleterious mutations (absolute homozygous effect larger than 0.03 or 0.1, depending on the data set considered) occurring at a rate not higher than 0.025 per haploid genome and generation. Our data suggest that most deleterious mutations affecting fitness act mainly through a single component-trait.

Animals↗
PubMedDate not supplied

[Multiple role of hedgehog genes in vertebrates: data from analysis of mutations].

Hedgehog (hh) gene has been discovered in Drosophila as result of the now famous screen for embryonic mutants in Drosophila performed by Dr. Christianne Nusslein-Volhard and her Ph.D. student Eric Wieschaus in 1980 in Tubingen, Germany (Nusslein-Volhard and Wieschaus, 1980). Due to recognition of the impact of these mutants onto contemporary developmental biology these scientists obtained a Nobel Prize in 1995. By that time it become obvious that the history of hh studies represents one of the most interesting chapters of developmental biology.

Animals↗
PubMedDate not supplied

[Determination of the expression phase of chb(V40) gene in the cell cycle of Drosophila melanogaster].

Using autoradiography, we have determined cell cycle parameters in neuroblasts of III-rd instar larvae of D. melanogaster. The overall duration of the cell cycle is 9 h, tG1 = 4 h, tS = 3.5 h, tG2 = 1 h, and tM = = 0.5 h. Using histochemical staining for beta-galactosidase activity, we have determined the stage of expression of the reporter gene of P[1ArB] element inserted into chb gene. The chb gene, which codes for a centrosomal protein, is expressed during the last third of S phase. This result illustrates the feasibility of using the enhancer trap P[1ArB] to study differential expression of cell cycle genes.

Animals↗
PubMed1990

RNA editing in transcripts of the mitochondrial genes of the insect trypanosome Crithidia fasciculata.

With the aid of cDNA and RNA sequence analysis, we have determined to what extent transcripts of mitochondrial maxicircle genes of the insect trypanosome Crithidia fasciculata are altered by RNA editing, a novel mechanism of gene expression which operates via the insertion and deletion of uridine residues. Editing of cytochrome c oxidase (cox) subunit II and III transcripts and of maxicircle unidentified reading frame (MURF) 2 RNA is limited to a small section and results in the creation of a potential AUG translational initiation codon (coxIII, MURF2) or the removal of a frameshift (coxII). No differences with the genomic sequences were observed in the remainder of these RNAs. Surprisingly, NADH dehydrogenase subunit I transcripts were completely unedited in the coding region, implying that an AUG translational initiation codon is absent. The partial ribosomal RNA sequences determined also conform to the gene sequences. Together these results lead to the conclusion that the unusual sequences predicted by the protein and rRNA genes must indeed be present in the gene products. Editing also occurred in the poly(A) tail of RNAs from all protein genes, including those that are unedited in the coding region. The tails display a large variation in AU sequence motifs. Finally, some cDNAs contained sequences absent from both the DNA and the edited RNA. Some of these may represent intermediates in the RNA editing process. We argue, however, that long runs of T may be artefacts of cDNA synthesis.

Animals↗
PubMed2006

Rapid adaptive evolution of the tumor suppressor gene Pten in an insect lineage.

The Pten gene was initially identified in humans as a tumor suppressor. It has since been shown to play important roles in the control of cell size, cell motility, apoptosis, and organ size, and it has also been implicated in aging. Pten is highly conserved among organisms as diverse as nematodes, insects, and vertebrates. In contrast, a phylogenetic analysis by maximum likelihood of a 133-amino acid region showed an average nonsynonymous-to-synonymous rate ratio of 10.4 for Pten in the lineage leading to parasitoid wasps of the Nasonia genus, indicating very strong positive selection. A previous study identified Pten as a potential QTL candidate gene for differences in male wing size in Nasonia. Most of the amino acid replacements that occurred in the Nasonia lineage cluster in a small region of the protein surface, suggesting that they might be involved in an interaction between Pten and another protein. The phenotypic changes due to Pten are not yet known, although it is not associated with known differences in male wing size. Introgression of Pten from one species to another does affect longevity, but a causal relationship is not established.

Adaptation, Biological↗
PubMed1992

Insecticidal properties of genetically engineered baculoviruses expressing an insect juvenile hormone esterase gene.

Exploring the possibility of enhancing the properties of baculoviruses as biological control agents of insect pests, we tested the effect of expressing an insect gene (jhe) encoding juvenile hormone esterase. Juvenile hormone esterase inactivates juvenile hormone, which regulates the outcome of an insect molt. A cDNA encoding the juvenile hormone esterase of Heliothis virescens was inserted into the genome of Autographa californica nuclear polyhedrosis virus such that the gene was expressed under the control of a strong, modified viral promoter. This virus, however, naturally encodes an ecdysteroid UDP-glucosyltransferase which inactivates ecdysone, the hormone which initiates molting. Since ecdysteroid UDP-glucosyltransferase could mask the effects of jhe expression by blocking molting entirely, jhe-expressing viruses in which the ecdysteroid UDP-glucosyltransferase gene was deleted or disrupted were constructed. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of proteins from infected cells revealed several intracellular proteins and two major secreted proteins which reacted with antibodies to authentic juvenile hormone esterase. Western blot analysis coupled with tunicamycin treatment indicated that differential glycosylation was responsible for the multiple products. Hemolymph of recombinant virus-infected fourth-instar Trichoplusia ni larvae contained levels of juvenile hormone esterase activity 40-fold higher than maximal levels found in uninfected larvae. However, little or no difference in developmental characteristics, weight gain, or time of mortality was observed between insects infected with the jhe-expressing viruses and control viruses.

Animals↗
PubMedDate not supplied

Insect oenocytes: a model system for studying cell-fate specification by Hox genes.

During insect development, morphological differences between segments are controlled by the Hox gene family of transcription factors. Recent evidence also suggests that variation in the regulatory elements of these genes and their downstream targets underlies the evolution of several segment-specific morphological traits. This review introduces a new model system, the larval oenocyte, for studying the evolution of fate specification by Hox genes at single-cell resolution. Oenocytes are found in a wide range of insects, including species using both the short and the long germ modes of development. Recent progress in our understanding of the genetics and cell biology of oenocyte development in the fruitfly Drosophila melanogaster is discussed. In the D. melanogaster embryo, the formation of this cell type is restricted to the first 7 abdominal segments and is under Hox gene control. Oenocytes delaminate from the dorsal ectoderm of A1-A7 in response to an induction that involves the epidermal growth factor receptor (EGFR) signalling pathway. Although the receptor itself is required in the presumptive oenocytes, its ligand Spitz (Spi) is secreted by a neighbouring chordotonal organ precursor (COP). Thus, in dorsal regions, local signalling from this component of the developing peripheral nervous system induces the formation of oenocytes. In contrast, in lateral regions of the ectoderm, Spi signal from a different COP induces the formation of secondary COPs in a homeogenetic manner. This dorsoventral difference in the fate induced by Spi ligand is controlled by a prepattern in the responding ectoderm that requires the Spalt (Sal) transcription factor. Sal protein is expressed in the dorsal but not lateral ectoderm and acts as a competence modifier to bias the response to Spi ligand in favour of the oenocyte fate. We discuss a recently proposed model that integrates the roles of Sal and the EGFR pathway in oenocyte/chordotonal organ induction. This model should provide a useful starting point for future comparative studies of these ectodermal derivatives in other insects.

Animals↗
PubMed1991

In vivo generation of hybrids between two Bacillus thuringiensis insect-toxin-encoding genes.

The parasporal crystal of Bacillus thuringiensis is composed of polypeptides highly toxic to a number of insect larvae. The structural genes (cryIA) encoding the Lepidoptera-specific toxin from different bacterial strains diverge primarily in a single hypervariable region, whereas the N-terminal and C-terminal parts of the proteins are highly conserved. In this report, we describe the generation of hybrid genes between two cryIA genes. Two truncated cryIA genes were cloned in a plasmid vector in such way as to have only the hypervariable region in common. The two truncated cryIA genes were separated by the tetracycline-resistance determinant (or part of it). In vivo recombination between the hypervariable regions of the cryIA genes reconstituted an entire hybrid cryIA gene. Direct sequence analysis of 17 recombinant plasmids identified eleven different crossover regions which did not alter the reading frame and allowed the production of eight different hybrid proteins. The recombination events were independent from the RecA function of Escherichia coli. Some of the hybrid gene products were more specific in their insecticidal action and one had acquired a new biological activity.

Amino Acid Sequence↗
PubMed1997

Isolation and characterization of a genomic clone for the gene of an insect molting enzyme, chitinase.

Genomic clones for a chitinolytic enzyme were isolated from a library of Sau 3A digested DNA from the tobacco hornworm, Manduca sexta, using a previously isolated chitinase cDNA clone as a probe [Kramer et al., Insect Biochem. Molec. Biol. 23, 691-701 (1993)]. Restriction enzyme mapping and Southern blot analysis of four genomic clones suggested that these are overlapping clones. Sequence analysis of the genomic clones and Southern blot analysis of total genomic DNA also suggest that the M. sexta genome has only one chitinase gene detectable by the cDNA probe. This gene is organized into at least 11 exons in a region spanning > 11 kb. The sequenced M. sexta chitinase gene has a series of exons corresponding to identifiable structural/functional regions of the protein. Similarities in structure and organization between the M. sexta chitinase gene and chitinase genes from other sources are described.

Amino Acid Sequence↗
PubMed2006

Baculovirus-mediated gene silencing in insect cells using intracellularly produced long double-stranded RNA.

Double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful reverse genetics tool to silence gene expression in multiple organisms, including plants, nematodes and insects. In this study, DNA vectors capable of promoting the synthesis of long hairpin dsRNAs in vivo from a DNA template to suppress gene expression in insect cells have been successfully constructed. The inhibition of the expression of a gene encoding enhanced green fluorescent protein (eGFP) in insect cells was demonstrated by using plasmid or baculovirus vectors. Both plasmid and baculovirus vectors were able to inhibit eGFP expression in a dose dependent manner. Complete inhibition was obtained when co-transfection ratios of target plasmid to inhibition plasmid were 1:1 and 1:0.1. Eighty percent suppression was still maintained even when the ratio of eGFP plasmid to 'hairpin' plasmid was as high as 1:0.01. When the hairpin dsRNAs were encoded in a baculovirus, the suppression was about 50% when the ratio of 'target' baculovirus to 'inhibition' baculovirus reached 1:10. Therefore, the designed plasmid and baculovirus vectors are useful to induce RNAi in insect cell systems.

Animals↗
PubMed1995

Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis.

A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).

Amino Acid Sequence↗