Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “frameshifting”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 757 records · Page 42Linked to original sources
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2005

Novel frameshift and splice site mutations in the neurotrophic tyrosine kinase receptor type 1 gene (NTRK1) associated with hereditary sensory neuropathy type IV.

Congenital insensitivity to pain with anhidrosis or hereditary sensory and autonomic neuropathy type IV (HSAN IV) is the first human genetic disorder implicated in the neurotrophin signal transduction pathway. HSAN IV is characterized by absence of reaction to noxious stimuli, recurrent episodes of fever, anhidrosis, self-mutilating behavior and often mental retardation. Mutations in the neurotrophic tyrosine kinase, receptor, type 1 (NTRK1) are associated with this disorder. Here we report four homozygous mutations, two frameshift (p.Gln626fsX6 and p.Gly181fsX58), one missense (p.Arg761Trp) and one splice site (c.359+5G>T) mutation in four HSAN IV patients. The splice site mutation caused skipping of exons 2 and 3 in patient's mRNA resulting in an in-frame deletion of the second leucine-rich motif. NTRK1 mutations are only rarely reported in the European population. This report extends the spectrum of NTRK1 mutations observed in patients diagnosed with HSAN IV.

Case-Control Studies↗
PubMed2002

A new frameshift mutation encoding a truncated amelogenin leads to X-linked amelogenesis imperfecta.

The amelogenin proteins are the most abundant organic components of developing dental enamel. Their importance for the proper mineralization of enamel is evident from the association between previously identified mutations in the X-chromosomal gene that encodes them and the enamel defect amelogenesis imperfecta. In this investigation, an adult male presenting with a severe hypoplastic enamel phenotype was found to have a single base deletion at the codon for amino acid 110 of the X-chromosomal 175-amino acid amelogenin protein. The proband's mother, who also has affected enamel, carries the identical deletion on one of her X-chromosomes, while the father has both normal enamel and DNA sequence. This frameshift mutation deletes part of the coding region for the repetitive portion of amelogenin as well as the hydrophilic tail, replacing them with a 47-amino acid segment containing nine cysteine residues. While greater than 60% of the protein is predicted to be intact, the severity of this phenotype illustrates the importance of the C-terminal region of the amelogenin protein for the formation of enamel with normal thickness.

Adult↗
PubMed2001

Fh-Souassi: a founder frameshift mutation in exon 10 of the LDL-receptor gene, associated with a mild phenotype in Tunisian families.

Familial hypercholesterolemia (FH) has a higher prevalence in central Tunisia together with a milder clinical expression than in western countries. The molecular basis of FH in Tunisia remains unknown. Our aim was to identify FH-causing mutations in three unrelated families (21 subjects) from the area of Souassi (central Tunisia). In probands with a presentation of homozygous FH, the promoter and 18 exons of the low density lipoprotein (LDL)-receptor gene were sequenced in both orientations. A novel complex frameshift mutation was identified in exon 10, nucleotides 1477-1479 (TCT) at Serine 472 were replaced by an insertion of seven nucleotides (AGAGACA), producing a premature termination codon 43 amino acids downstream. Binding of 125I-labelled LDL at 4 degrees C to cultured fibroblasts from two probands showed <2% normal LDL-receptor activity. AvaII digestion of PCR amplified genomic DNA identified this unique mutation in all families; homozygotes n=11, heterozygotes n=10. All mutation carriers shared the same haplotype (7 RFLPs), suggesting that they had a common ancestor. Despite high plasma LDL levels (m=16.0+/-3.0 mmol/l) and extravascular cholesterol deposits, most homozygotes were diagnosed after puberty and had a delayed onset of cardiovascular complications. Moreover, most heterozygotes were free of clinical signs and had plasma LDL cholesterol in the normal range (4.7+/-1.3 mmol/l) without taking any lipid-lowering medication. This mild clinical phenotype which contrasted with the severity of the mutation, could not be explained by specific apolipoprotein E or lipoprotein lipase alleles.

Adolescent↗
PubMed1999

Classical LCAT deficiency resulting from a novel homozygous dinucleotide deletion in exon 4 of the human lecithin: cholesterol acyltransferase gene causing a frameshift and stop codon at residue 144.

Lecithin: cholesterolacyltransferase (LCAT) transacylates the fatty acid at the sn-2 position of lecithin to the 3beta-OH group of cholesterol forming lysolecithin and the majority of cholesteryl ester found in plasma. LCAT participates in the reverse cholesterol transport pathway in man where it esterifies tissue-derived cholesterol following efflux from peripheral cells into HDL. Only 38 unique mutations in the human LCAT gene have been reported worldwide. Our French female proband presented with corneal opacity and no detectable plasma LCAT activity using either endogenous or exogenous assays. Her total plasma cholesterol and HDL cholesterol were low (2.34 mmol/l and 0.184 mmol/l, respectively) with a very high cholesterol/cholesteryl ester molar ratio (10.9:1). Plasma triglycerides were 0.470 mmol/l with low apo B (40.5 mg/dl), apo A-I (14.7 mg/dl), apo A-II (6.8 mg/dl) and apo E (2.1 mg/dl) levels. Plasma lipoprotein analysis by ultracentrifugation showed very low HDL concentrations and a characteristic shift of the lipoprotein profile towards larger, less dense particles. No proteinuria, renal dysfunction or signs of atherosclerosis were noted at age 45. Sequence analysis of her LCAT gene showed a novel homozygous TG-deletion at residues 138-139 that resulted in a frameshift causing the generation of a stop codon and premature termination of the LCAT protein at amino acid residue 144. Western blotting of the patient's plasma using a polyclonal IgY primary antibody against human LCAT failed to demonstrate the presence of a truncated LCAT protein. A 53 bp mismatched PCR primer was designed to generate an Fsp 1 restriction site in the wild type sequence of exon 4 where the mutation occurred. The 155 bp PCR product from the wild type allele produced a 103 bp and 52 bp fragment with Fsp 1 and no cleavage products with the mutant allele thus permitting rapid screening for this novel mutation.

Adolescent↗
PubMed1999

A novel frameshift mutation in the McLeod syndrome gene in a Japanese family.

We report a novel mutation in the XK gene (XK) in a Japanese patient with McLeod syndrome. A 50-year-old man showed progressive muscular atrophy, choreic movement, elevated level of serum creatinine kinase, and acanthocytosis. The expression level of all the Kell antigens in erythrocyte was decreased and molecular analysis revealed a single-base (T) deletion at the nucleotide position 1095 in XK. This deletion caused a frameshift in translation, leading to a premature stop codon at the amino acid position 408. We conclude this single-base deletion causes defective Kx protein, which is responsible for the McLeod phenotype in this patient.

Amino Acid Transport Systems, Neutral↗
PubMed1999

Two novel frameshift mutations in the adrenoleukodystrophy gene in Italian patients.

Two novel frameshift adrenoleukodystrophy mutations in two families were identified: a complex dinucleotide deletion/tetranucleotide insertion at 1116 TC-->GAGA (codon 244 [serine]) and an AG deletion at nucleotide 1462 (codon 359 [glutamic acid]). Both mutations are predicted to cause premature termination of protein synthesis. The patients were affected by childhood cerebral adrenoleukodystrophy and by adrenomyeloneuropathy with mild Addison disease, respectively.

Adrenoleukodystrophy↗
PubMed2001

Adaptive reversions of a frameshift mutation in arrested Saccharomyces cerevisiae cells by simple deletions in mononucleotide repeats.

Adaptive mutations are characterised as the outcome of an as yet unknown mechanism, which allows a few individuals of a cell population to overcome a starvation-induced cell cycle arrest and to proliferate. A release from such a non-lethal growth limitation is accomplished by mutations generated without DNA replication. Originally adaptive mutations were described in Escherichia coli, but more recently also in a simple eukaryote, the budding yeast Saccharomyces cerevisiae. We are studying the adaptive reversion of a frameshift allele which occurs when an auxotrophic yeast strain is starved for the amino acid essential for its proliferation. In this communication, we report on the DNA sequences from the locus concerned. Comparison between sequences from revertant clones which arose several days after growth arrest by starvation and those from revertants produced during proliferation shows significantly different mutation spectra: for replication-dependent revertants nucleotide gains and losses in a variety of sequence contexts are reasonably balanced, whereas for the replication-independent, i.e. adaptive, revertants mainly simple deletions in mononucleotide repeats were observed. These mutations resemble those known to originate from DNA polymerase slippage errors which were miscorrected or had escaped correction by the mismatch repair machinery. Our data present strong evidence for differences in the mechanistic origins of adaptive versus DNA replication-dependent mutations in a eukaryote. Most probably, mutations in non-replicating cells contribute to evolution, and if conserved in mammals, to human carcinogenesis.

Base Sequence↗
PubMed1997

A direct role for DNA polymerase III in adaptive reversion of a frameshift mutation in Escherichia coli.

The sequences of adaptive reversions of a lac frameshift mutation in Escherichia coli resemble DNA polymerase errors, and the adaptive reversions decrease in strains with an antimutator DNA polymerase III (PolIII) allele. The latter finding could imply that DNA PolIII itself makes adaptive mutations. Alternatively, normal DNA PolIII errors could saturate post-synthesis mismatch repair during adaptive mutation. If so, the antimutator strain would produce fewer adaptive mutations because it possesses greater capacity for mismatch repair which could correct errors made by a polymerase other than DNA PolIII. Mismatch repair capacity is limited specifically during adaptive mutation, necessitating a test of this indirect model. This indirect model is ruled out here by the observation that the antimutator PolIII allele decreases adaptive mutation even in mismatch repair-defective cells. This supports a direct role for DNA PolIII in recombination-dependent adaptive mutation.

Adaptation, Physiological↗
PubMed1998

In situ detection of frameshift mutations in mouse cells.

A reporter gene system that allows in situ detection of cells that have suffered a specific frameshift mutation was developed. To construct the reporter gene, the open reading frame of a human placental alkaline phosphatase (PLAP) gene was disrupted by insertion of either 5 or 7 G:C basepairs, which formed mutant alleles carrying 9 and 11 consecutive G residues, respectively. The mutant PLAP genes did not produce alkaline phosphatase activity in cultured mouse cells in transient transfection assays. Several cell lines that contained integrated copies of the mutant PLAP genes were made. Histochemical staining of fixed cells showed that these cell lines contained a small number of cells that expressed PLAP activity and bound antibodies directed against PLAP. Cells carrying the allele with 11 consecutive G residues (G11 allele) acquired PLAP activity at a rate between 2 x 10(-3) and 2 x 10(-4) events per cell per generation, depending on the cell line. Cells carrying the allele with 9 consecutive G residues (G09 allele) acquired PLAP activity at a rate between 2 x 10(-5) and 2 x 10(-6) events per cell per generation, depending on the cell line. Cultures of PLAP+ cells were derived from cell lines carrying PLAP mutant genes. All the cells in these cultures had PLAP activity and bound anti-PLAP antibody. PLAP mRNA levels were the same in cultures where all cells were PLAP+ and in cultures where less than 1% of the cells expressed PLAP activity. DNA sequence analysis of PLAP+ cells showed that the G11 allele reverted by losing one basepair, and the G09 allele reverted by gaining one basepair.

Alkaline Phosphatase↗
PubMed1999

Stabilization of the intermediate in frameshift mutation.

A mismatch repair, proofreading deficient mutant of Escherichia coli lost a C from a C8 run at a rate 10 times higher than the loss of A from an A8 sequence in the same double mutant. This greater frameshift instability of a homopolymeric run of C's may be due to stabilization of a stacked intermediate. Gain of a (CA) unit in a similarly constructed (CA)15 sequence occurred at a rate about 1/3 that previously reported for a (CA)14 construct losing a (CA) repeat unit.

Base Sequence↗
PubMed2003

Frameshift mutations in caspase-5 and other target genes in leukemia and lymphoma cell lines having microsatellite instability.

Microsatellite instability (MSI) was examined in 49 lymphoid leukemia/lymphoma cell lines. Frameshift mutations within eight MSI target genes were analyzed in the 12 cell lines and nine childhood acute lymphoblastic leukemia (ALL) samples with MSI. Six cell lines (50%) showed mutations within the coding repeats of the BLM, caspase-5, TCF-4, and PTEN genes. No mutations were identified in the nine childhood ALL samples with MSI. This is the first report that describes mutations of these genes in hematological malignancies. Mutations, presumably caused by an abnormality of the DNA repair genes, may be selected for during the establishment of cell lines.

Adenosine Triphosphatases↗
PubMed2002

Frameshift mutations in the MBD4/MED1 gene in primary gastric cancer with high-frequency microsatellite instability.

MBD4/MED1 is a newly identified mismatch repair gene, which is mutated in colon, endometrial, and pancreatic high-frequency microsatellite instability (MSI-H) tumors. To assess its role in gastric cancers, we investigated MBD4/MED1 mutations in sporadic gastric cancers, compared with colon cancers. Frameshift mutations were found in 29% of gastric and 20% of colon MSI-H cancers, but not in any low-frequency microsatellite instability/microsatellite stable cancers. MBD4/MED1 is mutated in gastric cancers as frequently as in colon cancers; these mutations reduce the accuracy of DNA repair, and may lead to cancer progression.

Aged↗
PubMed1998

Frameshift mismatch recognition by the human MutS alpha complex.

DNA mismatch binding by an extensively purified hMutS alpha mismatch recognition complex was investigated using a bandshift assay. The complex bound to G. T mispairs and to looped structures containing an unpaired single or two adjacent bases. A CA loop was preferentially recognised if the unpaired bases formed part of a repeated sequence. In general, single base loops were also more favourably recognised by hMutS alpha when present in monotonic runs of two to five. In one series of substrates, based on a known hotspot for frameshift mutations in the hypoxanthine-guanine phosphoribosyltransferase gene, in which different length G, A, C or T tracts were flanked by closely similar sequences, an A loop was bound preferentially in the absence of adjacent As and a C loop in the absence of adjacent Cs. This preferential binding was influenced by the base immediately 5' to the loop. Thus, while repeated regions generally favour recognition of single base loops by hMutS alpha, other factors related to local sequence may influence this interaction.

Binding Sites↗
PubMed2000

Discrete in vivo roles for the MutL homologs Mlh2p and Mlh3p in the removal of frameshift intermediates in budding yeast.

The DNA mismatch repair machinery is involved in the correction of a wide variety of mutational intermediates. In bacterial cells, homodimers of the MutS protein bind mismatches and MutL homodimers couple mismatch recognition to downstream processing steps [1]. Eukaryotes possess multiple MutS and MutL homologs that form discrete, heterodimeric complexes with specific mismatch recognition and repair properties. In yeast, there are six MutS (Msh1-6p) and four MutL (Mlh1-3p and Pms1p) family members [2] [3]. Heterodimers comprising Msh2p and Msh3p or Msh2p and Msh6p recognize mismatches in nuclear DNA [4] [5] and the subsequent processing steps most often involve a Mlh1p-Pms1P heterodimer [6] [7]. Mlh1p also forms heterodimeric complexes with Mlh2p and Mlh3p [8], and a minor role for Mlh3p in nuclear mismatch repair has been reported [9]. No mismatch repair function has yet been assigned to the fourth yeast MutL homolog, Mlh2p, although mlh2 mutants exhibit weak resistance to some DNA damaging agents [10]. We have used two frameshift reversion assays to examine the roles of the yeast Mlh2 and Mlh3 proteins in vivo. This analysis demonstrates, for the first time, that yeast Mlh2p plays a role in the repair of mutational intermediates, and extends earlier results implicating Mlh3p in mismatch repair.

Base Pair Mismatch↗
PubMed2002

An "integrated model" of programmed ribosomal frameshifting.

Many viral mRNAs, including those of HIV-1, can make translating ribosomes change reading frame. Altering the efficiencies of programmed ribosomal frameshift (PRF) inhibits viral propagation. As a new target for potential antiviral agents, it is therefore important to understand how PRF is controlled. Incorporation of the current models describing PRF into the context of the translation elongation cycle leads us to propose an 'integrated model' of PRF both as a guide towards further characterization of PRF at the molecular and biochemical levels, and for the identification of new targets for antiviral therapeutics.

Frameshifting, Ribosomal↗
PubMed2003

Spectrum of mutations in the arylsulfatase A gene in a Canadian DNA collection including two novel frameshift mutations, a new missense mutation (C488R) and an MLD mutation (R84Q) in cis with a pseudodeficiency allele.

We describe three novel mutations in the human arylsulfatase A gene in three patients with MLD, an autosomal recessive lysosomal storage disorder. An insertion, 2590_2591insCCCC in exon 8 and a deletion, 752_758delGCCGGCC, in exon 3 will both result in frameshifts. A mutation in exon 8, 2566T-->C, results in a missense mutation C488R, disrupting an unusual cysteine-knot at the C-terminal end of the protein. All three mutations are heterozygous with previously documented mutations. A previously reported mutation, R84Q was identified on a pseudodeficiency allele. These mutations are part of a heterogeneous spectrum of mutations found in a collection of DNA samples from MLD patients from across Canada and the USA.

Adolescent↗
PubMed1998

The mutagenesis proteins UmuD' and UmuC prevent lethal frameshifts while increasing base substitution mutations.

Error-prone DNA repair consists of replicative filling-in of DNA gaps carrying lesions. We have reconstituted E. coli SOS error-prone repair using purified DNA polymerase III holoenzyme, SSB, RecA, UmuD', a UmuC fusion protein, and a gap lesion plasmid. In the absence of UmuDC, or without SOS induction, replication skips over the lesion, forming mostly one-nucleotide deletions. These cause translational frameshifts that usually inactivate genes. UmuD' and UmuC, in the presence of RecA and SSB, stimulate translesion replication and change its mutagenic specificity such that deletions are prevented and base substitutions are increased. This results in mutagenic but nondetrimental gap repair and provides an effective mechanism for generating genetic variation in bacteria adapting to environmental stress.

Bacterial Proteins↗