Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “transcript abundance”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 739 records · Page 41Linked to original sources
PubMed1998

Expression and regulation of mRNA for distinct isoforms of cAMP-specific PDE-4 in mitogen-stimulated and leukemic human lymphocytes.

We reported previously that the gene for PDE-1B1 is induced in isolated human peripheral blood lymphocytes (HPBL) following mitogenic stimulation (Jiang, X., Li, J., Paskind, M., and Epstein, P.M. [1996] Proc. Natl. Acad. Sci. USA 93, 11,236-11,241). Using reverse transcription-polymerase chain reaction (RT-PCR), we investigated possible changes in the expression of the four genes for cAMP-specific phosphodiesterase (PDE-4A-D) in HPBL under the same conditions. Isolated, quiescent HPBL express mRNA for PDE-4B as the principal transcript. Following mitogenic stimulation with phytohemagglutinin (PHA), mRNA for PDE-4A and PDE-4D are clearly induced. HPBL appear not to express PDE-4C under resting or stimulated conditions. The PHA induced increase in PDE-1B1, PDE-4A, and PDE-4D mRNA is mimicked by incubation of HPBL with dibutyryl cAMP (dBcAMP) and 1-methyl-3-isobutylxanthine (IBMX). The B-lymphoblastoid cell line, RPMI 8392, and the T-leukemic cell line, Molt 4, express PDE-4A mRNA as the most abundant transcript, but incubation with dBcAMP and IBMX induces an increase in the expression of mRNA for PDE-4B in both of these cell lines, and in PDE-4D3 in the RPMI 8392 cell line. These studies demonstrate that expression of mRNA for PDE-1B1 and some of the subtypes of PDE-4 are induced in HPBL following mitogenic stimulation, possibly secondarily to elevation of cAMP induced by the mitogen. As already indicated for PDE-1B1, some of these subtypes of PDE-4 might also provide additional therapeutic targets for treatment of immunoproliferative disorders and immune dysfunction.

1-Methyl-3-isobutylxanthine↗
PubMed2006

Modulated microRNA expression during adult lifespan in Caenorhabditis elegans.

MicroRNAs (miRNAs) are small, abundant transcripts that can bind partially homologous target messages to inhibit their translation in animal cells. miRNAs have been shown to affect a broad spectrum of biological activities, including developmental fate determination, cell signaling and oncogenesis. Little is known, however, of miRNA contributions to aging. We examined the expression of 114 identified Caenorhabditis elegans miRNAs during the adult lifespan and find that 34 miRNAs exhibit changes in expression during adulthood (P<or= 0.05), 31 with more than a twofold level change. The majority of age-regulated miRNAs decline in relative abundance as animals grow older. Expression profiles of developmental timing regulators lin-4 and let-7 miRNAs, as well as conserved muscle miRNA miR-1, show regulation during adulthood. We also used bioinformatic approaches to predict miRNA targets encoded in the C. elegans genome and we highlight candidate miRNA-regulated genes among C. elegans genes previously shown to affect longevity, genes encoding insulin-like ligands, and genes preferentially expressed in C. elegans muscle. Our observations identify miRNAs as potential modulators of age-related decline and suggest a general reduction of message-specific translational inhibition during aging, a previously undescribed feature of C. elegans aging. Since many C. elegans age-regulated miRNAs are conserved across species, our observations identify candidate age-regulating miRNAs in both nematodes and humans.

Animals↗
PubMed1992

The gene for the helix-loop-helix protein, Id, is specifically expressed in neural precursors.

While mammalian neurogenesis has been characterized extensively, the molecules involved in regulating neural cell determination and differentiation remain ill-defined. There is accruing evidence that various members of the basic helix-loop-helix (bHLH) protein family critically regulate these biological processes in a number of tissues. Id, a negative regulator of bHLH proteins, was found to exhibit peak gene expression during mouse embryogenesis with a striking pattern in the central nervous system. Id transcripts were specifically localized to undifferentiated neural precursors of the ventricular zone and were not present in their differentiated derivatives. In addition, in the peripheral nervous system, dorsal root ganglia sensory precursors, known to be undifferentiated while dividing, also expressed Id mRNA. However, in the sympathetic nervous system and adrenal medulla, where differentiation and division occur simultaneously in precursors, Id was not expressed. Since Id transcript abundance inversely correlated with differentiation, this protein, similar to its Drosophila homolog, extramacrochaetae, may play a negative regulatory role in neural differentiation.

Animals↗
PubMed2006

Positive feedback of hepatic angiotensinogen expression in silver sea bream (Sparus sarba).

The renin-angiotensin system (RAS) is involved in the maintenance of fluid homeostasis in vertebrates. Production of the precursor protein, angiotensinogen, is regulated by other components within the RAS. Angiotensin II (Ang II) stimulates the production and secretion of angiotensinogen in many mammalian models. However, the existence of a similar positive feedback mechanism for angiotensinogen has not been demonstrated for any non-mammalian species. In the present study, we have cloned the angiotensinogen for silver sea bream (Sparus sarba) and investigated the role of Ang II on angiotensinogen expression. The nucleotide sequence of angiotensinogen for S. sarba only exhibits a fair resemblance to other fish angiotensinogens and shows 76.6% similarity to that of Takifugu rubripes and 57.2% similarity to that of Danio rerio. Angiotensinogen transcripts have been identified in the brain, liver, kidney, and various parts of the intestine of sea bream, an observation, which probably implies the presence of a local RAS at the tissue level. The liver is probably the major source of angiotensinogen, as it exhibits the highest angiotensinogen transcript abundance among different tissues. Differential angiotensinogen expression was found among different regions of the intestine where the pyloric caeca exhibits the highest expression. Putative Ang I is identified at the N-terminal of the deduced protein with a novel sequence [Asn1, Ile5, His9]-Ang I. Hepatic angiotensinogen expression in sea bream adapted to different salinities remained constant and this is probably due to desensitization of the angiotensin receptors by angiotensin. A positive feedback mechanism of angiotensinogen by Ang II has been demonstrated as exogenous Ang II increased the amount of angiotensinogen transcript in isolated hepatocytes in vitro. Blockade of endogenous RAS by the angiotensin converting enzyme (ACE) inhibitor, captopril, significantly lowered the hepatic expression of angiotensinogen in vivo. The effect of Ang II stimulation on angiotensinogen expression is more potent in fish than that in mammals. These data suggest that the positive feedback mechanism of angiotensinogen by Ang II has already evolved in teleosts and such mechanism may be involved in the maintenance of angiotensinogen secretion under resting and hypertensive conditions.

Amino Acid Sequence↗
PubMed2006

Beepath: an ordered quantitative-PCR array for exploring honey bee immunity and disease.

Honey bees and other insects face many important parasites and pathogens against which they have evolved behavioral, morphological, physiological, and immune-based defenses. To help validate honey bee immune-gene candidates and determine their responsiveness to pathogens, a quantitative-PCR array was developed to measure transcript levels for 48 honey bee and pathogen genes in parallel. It is shown that this array can accurately measure host and pathogen transcript abundance, providing a new tool for assessing the environmental and genetic components behind honey bee immunity. By using common platforms and chemistries (e.g., SYBR-Green intercalating dye), quantitative-PCR arrays such as the one described should have diverse uses in invertebrate pathology.

Animals↗
PubMed1997

Differential expression of chitinases in Vitis vinifera L. responding to systemic acquired resistance activators or fungal challenge.

The concept of systemic acquired resistance (SAR) enables a novel approach to crop protection, and particular pathogenesis-related proteins, i.e. an acidic chitinase, have been classified as markers of the SAR response. Basic class I (VCHIT1b) and a class III (VCH3) chitinase cDNAs were cloned from cultured Vitis vinifera L. cv Pinot Noir cells and used to probe the induction response of grapevine cells to salicylic acid or yeast elicitor. Furthermore, the cells were treated with the commercial SAR activators 2,6-dichloroiso-nicotinic acid or benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester. Elicitor or salicylic acid induced both VCHIT1b and VCH3 transcript abundances, whereas 2,6-dichloroiso-nicotinic acid or benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester enhanced exclusively the expression of VCH3. To assess the systemic sensation of chitinase expression, single leaves of Vitis vinifera L. cv Pinot Noir or Vitis rupestris plants were inoculated with Plasmopara viticola spore suspensions, and the VCH3 and VCHIT1b mRNA amounts in the infected versus the adjacent, healthy leaf were monitored. Two VCH3 mRNA maxima were observed 2 and 6 d postinoculation in the infected, susceptible V. vinifera tissue, whereas in the healthy leaf the transcript increased from low levels d 2 postinoculation to prominent levels d 6 to 8 postinoculation. The level of VCH3 mRNA increased also over 4 d in the inoculated, resistant V. rupestris tissue. However, necrotic spots rapidly limited the infection, and the VCH3 transcript was undetectable in the upper-stage, healthy leaf. The expression of VCHIT1b remained negligible under either experimental condition. Overall, the results suggest that the selective expression of VCH3 might be a reliable indicator of the SAR response in V. vinifera L.

Amino Acid Sequence↗
PubMed2005

Reliable transcript quantification by real-time reverse transcriptase-polymerase chain reaction in primary neuroblastoma using normalization to averaged expression levels of the control genes HPRT1 and SDHA.

Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) represents a sensitive and efficient technique to determine expression levels of target genes in multiple samples and is increasingly used in clinical oncology to evaluate the patient's outcome or to detect minimal residual disease. Normalization of raw data are required to obtain comparable results between different specimens and is usually achieved by correlating transcript abundances of target genes with those of a single control gene with putatively stable expression levels. In this study, expression stability of six supposed control genes was evaluated in 64 samples of primary neuroblastoma and HPRT1 and SDHA mRNA levels were shown to exhibit the least expression variability among the samples. Because application of more than one control gene may enhance reliability of real-time RT-PCR results, various normalization factors consisting of the geometrical mean of multiple control gene expression values were calculated and evaluated by mRNA quantification of 14 target genes. Comparison with transcript levels determined by oligonucleotide-array expression analysis revealed that target gene mRNA quantification became most consistent after normalization to averaged expression levels of HPRT1 and SDHA. This normalization factor was in addition demonstrated to be not associated with stage of disease or MYCN amplification status of the tumor. Thus, these data indicate that the geometrical mean of HPRT1 and SDHA transcript levels represents a suitable internal control for biological and clinical studies investigating differential gene expression in primary neuroblastoma by real-time RT-PCR.

Gene Expression↗
PubMed2006

Insights into symbiotic nitrogen fixation in Medicago truncatula.

In silico analysis of the Medicago truncatula gene index release 8.0 at The Institute for Genomic Research identified approximately 530 tentative consensus sequences (TC) clustered from 2,700 expressed sequence tags (EST) derived solely from Sinorhizobium meliloti-inoculated root and nodule tissues. A great majority (76%) of these TC were derived exclusively from nitrogen-fixing and senescent nodules. A cDNA filter array was constructed using approximately 58% of the in silico-identified TC as well as cDNAs representing selected carbon and nitrogen metabolic pathways. The purpose of the array was to analyze transcript abundance in M. truncatula roots and nodules following inoculation by a wild-type S. meliloti strain, a mutant strain that forms ineffective nodules, an uninoculated root control, and roots following nitrate or ammonium treatments. In all, 81 cDNAs were upregulated in both effective and ineffective nodules, and 78% of these cDNAs represent in silico-identified TC. One group of in silico-identified TC encodes genes with similarity to putative plant disease resistance (R) genes of the nucleotide binding site-leucine-rich repeat type. Expression of R genes was enhanced in effective nodules, and transcripts also were detected in ineffective nodules at 14 days postinoculation (dpi). Homologous R gene sequences also have been identified in the Medicago genome. However, their functional importance in nodules remains to be established. Genes for enzymes involved in organic acid synthesis along with genes involved in nitrogen metabolism were shown to be coexpressed in nitrate-fed roots and effective nodules of M. truncatula.

Gene Expression Profiling↗
PubMed1997

Identification of a gene containing zinc-finger motifs based on lost expression in malignantly transformed rat ovarian surface epithelial cells.

We have used a rat model of epithelial ovarian cancer to identify a gene that shows decreased or lost expression in five of eight independently transformed rat ovarian surface epithelial cell lines compared to the normal progenitor cells. Hence, we refer to this gene as Lot1 (lost on transformation 1; GenBank accession no. U72620). The most abundant transcript of the gene is approximately 6 kb. This sequence contains a 1749-nucleotide open reading frame and, within the 3' untranslated region, 22 near-perfect 60-70-bp repeats and adenine- and uracil-rich areas. The deduced amino acid sequence from the open reading frame contains seven zinc-finger motifs of the C2H2 type, as well as proline-, glutamine-, and glutamic acid-rich areas. The gene maps to the short arm of chromosome one in the rat. Lot1 shows a limited distribution of expression in normal rat tissues, including ovary, which shows abundant expression. Furthermore, examination of DNA derived from multiple species indicates that the gene is widely conserved.

Amino Acid Sequence↗
PubMed2004

A transcriptional timetable of autumn senescence.

BACKGROUND: We have developed genomic tools to allow the genus Populus (aspens and cottonwoods) to be exploited as a full-featured model for investigating fundamental aspects of tree biology. We have undertaken large-scale expressed sequence tag (EST) sequencing programs and created Populus microarrays with significant gene coverage. One of the important aspects of plant biology that cannot be studied in annual plants is the gene activity involved in the induction of autumn leaf senescence. RESULTS: On the basis of 36,354 Populus ESTs, obtained from seven cDNA libraries, we have created a DNA microarray consisting of 13,490 clones, spotted in duplicate. Of these clones, 12,376 (92%) were confirmed by resequencing and all sequences were annotated and functionally classified. Here we have used the microarray to study transcript abundance in leaves of a free-growing aspen tree (Populus tremula) in northern Sweden during natural autumn senescence. Of the 13,490 spotted clones, 3,792 represented genes with significant expression in all leaf samples from the seven studied dates. CONCLUSIONS: We observed a major shift in gene expression, coinciding with massive chlorophyll degradation, that reflected a shift from photosynthetic competence to energy generation by mitochondrial respiration, oxidation of fatty acids and nutrient mobilization. Autumn senescence had much in common with senescence in annual plants; for example many proteases were induced. We also found evidence for increased transcriptional activity before the appearance of visible signs of senescence, presumably preparing the leaf for degradation of its components.

Aging↗
PubMed2005

Transcriptional profiling of the developmentally important signalling pathways in human embryonic stem cells.

BACKGROUND: Embryonic stem cells (ESC) maintain their 'stemness' by self-renewal. However, the molecular mechanisms underlying self-renewal of human embryonic stem cells (hESC) remain to be elucidated. In this study, expression profiles of the molecules of developmentally important signalling pathways were investigated to better understand the relationships of the signalling pathways for self-renewal in hESC. METHODS: Two human ESC lines were cultured on mouse embryonic fibroblast (MEF) feeder cells. Gene expression was analysed by RT-PCR, real-time RT-PCR and Western blotting. RESULTS: In the bone morphogenetic protein (BMP4), transforming growth factor (TGF-beta) and fibroblast growth factor (FGF4) signalling pathways, ligands and antagonists were highly expressed in hESC compared with human embryoid body (hEB). Human ESC showed abundant transcripts of intracellular molecules in the Wnt, Hh and Notch signalling pathways. No difference was detected in the expression level of the JAK/STAT signalling molecules between hESC and hEB. Western blot analysis showed that the transcriptional levels of the signalling molecules in hESC were consistent with translational levels. From the real-time PCR analysis, expression levels of some genes, such as Oct3/4, Nodal and beta-catenin, were different between two hESC lines. CONCLUSION: The self-renewal of hESC is probably maintained by coordinated regulation of signalling-specific molecules and in a signalling-specific manner.

Animals↗
PubMed1999

Rapid and systemic accumulation of chloroplast mRNA-binding protein transcripts after flame stimulus in tomato.

It has been shown that tomato (Lycopersicon esculentum) plants respond to flame wounding and electrical stimulation by a rapid (15 min) and systemic up-regulation of proteinase inhibitor (pin) genes. To find other genes having a similar expression pattern, we used subtractive cDNA screening between flamed and control plants to select clones up-regulated by flame wounding. We report the characterization of one of them, a chloroplast mRNA-binding protein encoded by a single gene and expressed preferentially in the leaves. Systemic gene expression in response to flaming in the youngest terminal leaf exhibited three distinct phases: a rapid and transient increase (5-15 min) in transcript accumulation, a decline to basal levels (15-45 min), and then a second, more prolonged increase (60-90 min). In contrast, after a mechanical wound the rapid, transient increase (5 min) was followed by a rapid decline to basal levels but no later, prolonged accumulation. In the petiole, the initial flame-wound-evoked transient increase (15 min) was followed by a continuous decline for 3 h. The nature of the wound signal(s) causing such rapid changes in transcript abundance is discussed in relation to electrical signaling, which has recently been implicated in plant responses to wounding.

Amino Acid Sequence↗
PubMed2004

Regulation of iron transport in Streptococcus pneumoniae by RitR, an orphan response regulator.

RitR (formerly RR489) is an orphan two-component signal transduction response regulator in Streptococcus pneumoniae that has been shown to be required for lung pathogenicity. In the present study, by using the rough strain R800, inactivation of the orphan response regulator gene ritR by allele replacement reduced pathogenicity in a cyclophosphamide-treated mouse lung model but not in a thigh model, suggesting a role for RitR in regulation of tissue-specific virulence factors. Analysis of changes in genome-wide transcript mRNA levels associated with the inactivation of ritR compared to wild-type cells was performed by the use of high-density DNA microarrays. Genes with a change in transcript abundance associated with inactivation of ritR included piuB, encoding an Fe permease subunit, and piuA, encoding an Fe carrier-binding protein. In addition, a dpr ortholog, encoding an H(2)O(2) resistance protein that has been shown to reduce synthesis of reactive oxygen intermediates, was activated in the wild-type (ritR(+)) strain. Microarray experiments suggested that RitR represses Fe uptake in vitro by negatively regulating the Piu hemin-iron transport system. Footprinting experiments confirmed site-specific DNA-binding activity for RitR and identified three binding sites that partly overlap the +1 site for transcription initiation upstream of piuB. Transcripts belonging to other gene categories found to be differentially expressed in our array studies include those associated with (i) H(2)O(2) resistance, (ii) repair of DNA damage, (iii) sugar transport and capsule biosynthesis, and (iv) two-component signal transduction elements. These observations suggest that RitR is an important response regulator whose primary role is to maintain iron homeostasis in S. pneumoniae. The name ritR (repressor of iron transport) for the orphan response regulator gene, rr489, is proposed.

Animals↗
PubMed2006

Selective degradation of maternal and embryonic transcripts in in vitro produced bovine oocytes and embryos using sequence specific double-stranded RNA.

RNA interference (RNAi) has been used for selective degradation of an mRNA transcript or inhibiting its translation to a functional protein in various species. Here, we applied the RNAi approach to suppress the expression of the maternal transcript C-mos and embryonic transcripts Oct-4 in bovine oocytes and embryos respectively, using microinjection of sequence-specific double-stranded RNA (dsRNA). For this, 435 bp C-mos and 341 bp Oct-4 dsRNA were synthesized and microinjected into the cytoplasm of immature oocytes and zygotes respectively. In experiment 1, immature oocytes were categorized into three groups: those injected with C-mos dsRNA, RNase-free water and uninjected controls. In experiment 2, in vitro produced zygotes were categorized into three groups: those injected with Oct-4 dsRNA, RNase-free water and uninjected controls. The developmental phenotypes, the level of mRNA and protein expression were investigated after treatment in both experiments. Microinjection of C-mos dsRNA has resulted in 70% reduction of C-mos transcript after maturation compared to the water-injected and uninjected controls (P<0.01). Microinjection of zygotes with Oct-4 dsRNA has resulted in 72% reduction in transcript abundance at the blastocyst stage compared to the uninjected control zygotes (P<0.01). Moreover, a significant reduction in the number of inner cell mass (ICM) cells was observed in Oct-4 dsRNA-injected embryos compared to the other groups. From oocytes injected with C-mos dsRNA, 60% showed the extrusion of the first polar body compared to 50% in water-injected and 44% in uninjected controls. Moreover, only oocytes injected with C-mos dsRNA showed spontaneous activation. In conclusion, our results demonstrated that sequence-specific dsRNA can be used to knockdown maternal or embryonic transcripts in bovine embryogenesis.

Animals↗
PubMed2003

[Vascular-specific promoters and cis-regulatory elements].

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.

Gene Expression Regulation, Plant↗
PubMed2003

Promoter analysis of Helicobacter pylori genes with enhanced expression at low pH.

To identify Helicobacter pylori genes with expression that is enhanced under low pH conditions, we used subtractive hybridization methodology. We identified 28 acid-induced genes, of which 18 have known or putative functions. Six pairs of genes were co-transcribed. Primer extension analysis identified single or multiple transcriptional start points (tsp) for 14 of the 22 loci. Sequence analysis of the -10 regions upstream of the tsps revealed consensus motifs for multiple RNA polymerase sigma factors present in H. pylori (sigma80, sigma54 and sigma28). No sequences resembling the -35 Escherichia coli consensus sequence (TTGACA) were present upstream of any of the genes. Both increased gene transcription and decreased mRNA decay contribute to the observed increase in H. pylori transcript abundance at acid pH. These studies document the complex response of H. pylori to environmental pH changes, and provide insight into mechanisms used for intragastric survival.

Bacterial Proteins↗
PubMed2001

Cysteine protease inhibitor is specifically expressed in pre- and early-vitellogenic oocytes from the brook trout periovulatory ovary.

A cDNA fragment hybridizing with a transcript abundant in the periovulatory ovary was obtained while performing subtractive cloning on brook trout ovulatory and postovulatory ovarian tissue. Using this fragment as a probe, a 478 bp full-length cDNA was obtained by screening an ovulatory ovarian cDNA library. This cDNA presumably codes for an 88 amino acid protein that is structurally related to a new family of cysteine protease inhibitors characterized by the presence of a type I thyroglobulin motif in the amino acid sequence. Therefore, the protein was tentatively named an oocyte cysteine protease inhibitor (OCPI). On Northern blots, the OCPI cDNA hybridizes with a 0.5 kb transcript present in the ovary during the periovulatory period. The OCPI transcript and protein were localized to the cytoplasm of pre- and early-vitellogenic oocytes. On Northern blots of RNA from other tissues, the OCPI transcript was detected only in the ovary. On Western blots, OCPI was detected in the ovarian tissue at all periovulatory stages tested. The specific localization of both OCPI transcript and protein to pre- and early-vitellogenic oocytes and the structural similarity to protease inhibitors, suggest that OCPI might be involved in the protection of oocytes during the periovulatory period or in the regulation of yolk formation and degradation.

Amino Acid Sequence↗
PubMed2004

The Arabidopsis FtsH metalloprotease gene family: interchangeability of subunits in chloroplast oligomeric complexes.

The Arabidopsis At filamentation temperature sensitive (FtsH) metalloprotease gene family comprises 12 members (AtFtsH1-AtFtsH12), including three pairs of closely related genes that are targeted to chloroplasts (AtFtsH2 and AtFtsH8; AtFtsH1 and AtFtsH5; and AtFtsH7 and AtFtsH9). Mutations in AtFtsH5 (var1) and AtFtsH2 (var2) give rise to variegated plants with green- and white-sectored leaves. Cells in the green sectors contain morphologically normal chloroplasts, whereas cells in the white sectors are blocked in chloroplast biogenesis. A major question is how chloroplasts arise in cells that have a mutant genotype. We have found by two-dimensional (2-D) green gel and gel filtration analyses that AtFtsH2/VAR2 forms oligomeric complexes. Two bands in the 2-D green gels that correspond to AtFtsH5/VAR1 + AtFtsH1 and AtFtsH2/VAR2 + AtFtsH8 have been identified, and these bands are coordinately reduced in amount in var1 and var2 thylakoids that lack AtFtsH5/VAR1 and AtFtsH2/VAR2, respectively. These reductions are not because of alterations in transcript abundance. Overexpression of AtFtsH8 in var2-4 (a putative null allele) normalizes the variegation phenotype of the mutant and restores the two bands to their wild-type levels. These results suggest that AtFtsH8 is interchangeable with AtFtsH2/VAR2 in AtFtsH-containing oligomers, and that the two proteins have redundant functions. Consistent with this hypothesis, AtFtsH2 and AtFtsH8 have similar expression patterns, as monitored by promoter-beta-glucuronidase (GUS) fusion and RT-PCR experiments. Based on our findings, we propose that AtFtsH1, AtFtsH2/VAR2, AtFtsH5/VAR1, and AtFtsH8 interact to form oligomeric structures, and that subunit stoichiometry is controlled post-transcriptionally in var1 and var2, perhaps by turnover. A threshold model is presented to explain the pattern of variegation in var2 in which AtFtsH8 provides a compensating activity in the green sectors of the mutant.

Arabidopsis↗