Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 739 records · Page 41Linked to original sources
PubMed2004

Growth arrest, apoptosis, and telomere shortening of Barrett's-associated adenocarcinoma cells by a telomerase inhibitor.

BACKGROUND & AIMS: Barrett's esophageal adenocarcinoma (BEAC) is a complication of gastroesophageal reflux disease, with no effective chemotherapy and poor prognosis. BEAC cells, like many other types of cancers, may reactivate telomerase to achieve unlimited proliferative potential, making telomerase a unique therapeutic target. The purpose of this study was to evaluate effects of telomerase inhibition on BEAC. METHODS: We examined the effect of a selective G-quadruplex intercalating telomerase inhibitor, 2,6-bis[3-(N-Piperidino)propionamido]anthracene-9,10-dione (PPA), on telomerase activity, telomere length, colony size distribution, and proliferative potential in 2 BEAC cell lines, BIC-1 and SEG-1. RESULTS: Telomerase activity was >10-fold and >600-fold elevated in the adenocarcinoma cells as compared with normal gastric/intestinal cells and normal diploid fibroblasts, respectively. Telomeres were short, being less than 4 kilobase pair in both tumor cell lines. Exposure to PPA effectively inhibited telomerase activity and shortened telomeres. PPA also arrested cell proliferation and reduced colony number and size after a lag period of about 10 cell generations, consistent with the attrition of telomeres. The growth arrest was not due to senescence but was due to apoptosis. Expression analysis of the cells following PPA treatment did not show significant change in the expression of genes involved in cell-cycle proliferation and apoptosis. Exposure to PPA had no effect on proliferative potential of normal intestinal cells. CONCLUSIONS: We conclude that telomerase inhibition by PPA induces cell growth arrest in BEAC cells and demonstrate the potential of telomerase inhibitors in chemoprevention and treatment of Barrett's-associated esophageal adenocarcinoma.

Adenocarcinoma↗
PubMed2001

On new hypotheses about autosomal dominant polycystic kidney disease type 1.

The purpose of this paper is to suggest a partial explanation of the aetiology of autosomal dominant polycystic kidney disease type 1, one of the most common genetic diseases in humans. To this aim we put forward a number of interconnected ideas, based on a number of experimental evidences and plausibility arguments. We stress the major role played by the instability of some genomic tandem repeats, together with the DNA structures known as quadruplexes, the pseudogenes and the gene conversion. The model we propose can be considered a multi-hit generalization of the well-known two-hit model, a generalization that could well have a validity also outside the specific context. We finally provide an indication of the likely guilty DNA segment for the above disease, and we propose a possible simple experimental line of action aimed to confirm or disproof our suggestion.

Age of Onset↗
PubMed2003

A deoxyribozyme that harnesses light to repair thymine dimers in DNA.

In vitro selection was used to investigate whether nucleic acid enzymes are capable of catalyzing photochemical reactions. The reaction chosen was photoreactivation of thymine cyclobutane dimers in DNA by using serotonin as cofactor and light of wavelengths longer than the absorption spectrum of DNA. Curiously, the dominant single-stranded DNA sequence selected, UV1A, was found to repair its internal thymine dimer substrate efficiently even in the absence of serotonin or any other cofactor. UV1C, a 42-nucleotide fragment of UV1A, repaired the thymine dimer substrate in trans (k(cat)/k(uncat) = 2.5 x 10(4)), showing optimal activity with 305 nm light and thus resembling naturally occurring photolyase enzymes. Mechanistic investigation of UV1C indicated that its catalytic role likely exceeded the mere positioning of the substrate in a conformation favorable for photoreactivation. A higher-order structure, likely a quadruplex, formed by specific guanine bases within the deoxyribozyme, was implicated as serving as a light-harvesting antenna, with photoreactivation of the thymine dimer proceeding possibly via electron donation from an excited guanine base. In a primordial "RNA world," self-replicating nucleic acid populations may have been vulnerable to deactivation via UV light-mediated pyrimidine dimer formation. Photolyase nucleic acid enzymes such as the one described here could thus have played a role in preserving the integrity of such an RNA world.

Base Sequence↗
PubMed1994

The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure.

The fragile X mental retardation syndrome is associated with the expansion of trinucleotide 5'-d(CGG)-3' repeats within the FMR1 gene and with hypermethylation of the cytosine residues of these repeats. The expansion and hypermethylation may account for the suppression of the transcription of the FMR1 gene and for the delay of its replication during the cell cycle. Here we show that d(CGG)n oligomers can form a stable Hoogsteen-bonded structure that exhibits properties consistent with those of tetraplex DNA. Oligomers, d(mCGG)n, (n = 4, 5, or 7), at pH 8.0 and in the presence of an alkali metal ion form stable species exhibiting a reduced electrophoretic mobility in nondenaturing polyacrylamide gels. These species are denatured by heating at 90 degrees C for 10 min. With a short d(mCGG)5 oligomer, the slowly migrating species is formed only when the cytosine residue is 5-methylated, whereas with the longer d(CGG)7 it is generated whether or not cytosine is 5-methylated. By contrast, complementary cytosine-rich oligomers do not form analogous complexes. The second-order association kinetics of the formation of the slowly migrating species of d(mCGG)5 suggests that it is an interstrand complex. Formation of intermediate-size complexes between d(mCGG)5 and d(mCGG)7 indicates that the stoichiometry of the slowly migrating structures is tetramolecular. Protection of the complex from methylation by dimethyl sulfate indicates the involvement of the N-7 positions of the guanine residues in Hoogsteen hydrogen bonding, a characteristic of quadruplex structures. If formed in vivo along the expanded and hypermethylated d(mCGG)n stretch, this tetraplex structure could suppress transcription and replication of the FMR1 gene in the fragile X syndrome cells.

Electrophoresis, Polyacrylamide Gel↗
PubMed1996

Inter-strand C-H...O hydrogen bonds stabilizing four-stranded intercalated molecules: stereoelectronic effects of O4' in cytosine-rich DNA.

DNA fragments with stretches of cytosine residues can fold into four-stranded structures in which two parallel duplexes, held together by hemiprotonated cytosine.cytosine+ (C.C+) base pairs, intercalate into each other with opposite polarity. The structural details of this intercalated DNA quadruplex have been assessed by solution NMR and single crystal x-ray diffraction studies of cytosine-rich sequences, including those present in metazoan telomeres. A conserved feature of these structures is the absence of stabilizing stacking interactions between the aromatic ring systems of adjacent C.C+ base pairs from intercalated duplexes. Effective stacking involves only the exocyclic keto groups and amino groups of the cytidine bases. The apparent absence of stability provided by stacking interactions between the bases in this intercalated DNA has prompted us to examine the available structures in detail, in particular with regard to unusual features that could compensate for the lack of base stacking. In addition to base-on-deoxyribose stacking and intra-cytidine C-H...O hydrogen bonds, this analysis reveals the presence of a hitherto unobserved, systematic intermolecular C-H...O hydrogen bonding network between the deoxyribose sugar moieties of antiparallel backbones in the four-stranded molecule.

Base Composition↗
PubMed1999

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n.

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

Base Sequence↗
PubMed2006

Telomestatin-induced telomere uncapping is modulated by POT1 through G-overhang extension in HT1080 human tumor cells.

Telomestatin is a potent G-quadruplex ligand that interacts with the 3' telomeric overhang, leading to its degradation, and induces a delayed senescence and apoptosis of cancer cells. POT1 and TRF2 were recently identified as specific telomere-binding proteins involved in telomere capping and t-loop maintenance and whose interaction with telomeres is modulated by telomestatin. We show here that the treatment of HT1080 human tumor cells by telomestatin induces a rapid decrease of the telomeric G-overhang and of the double-stranded telomeric repeats. Telomestatin treatment also provokes a strong decrease of POT1 and TRF2 from their telomere sites, suggesting that the ligand triggers the uncapping of the telomere ends. The effect of the ligand is associated with an increase of the gamma-H2AX foci, one part of them colocalizing at telomeres, thus indicating the occurrence of a DNA damage response at the telomere, but also the presence of additional DNA targets for telomestatin. Interestingly, the expression of GFP-POT1 in HT1080 cells increases both telomere and G-overhang length. As compared with HT1080 cells, HT1080GFP-POT1 cells presented a resistance to telomestatin treatment characterized by a protection to the telomestatin-induced growth inhibition and the G-overhang shortening. This protection is related to the initial G-overhang length rather than to its degradation rate and is overcome by increased telomestatin concentration. Altogether these results suggest that telomestatin induced a telomere dysfunction in which G-overhang length and POT1 level are important factors but also suggest the presence of additional DNA sites of action for the ligand.

Base Sequence↗
PubMed1992

An eclectic DNA structure adopted by human telomeric sequence under superhelical stress and low pH.

We have found, with the aid of 2-D gel electrophoresis, that double-stranded human telomeric repeat, (T2AG3)12.(C3TA2)12, being cloned within a plasmid, forms a protonated superhelically-induced structure. Experiments on chemical and enzymatic probing also indicate that the human telomeric repeats adopt an unusual structure. We have proposed an eclectic model for this structure in which four different elements coexist: a non-orthodox intramolecular triplex stabilized by the canonical protonated C.G*C+ base-triads and highly enriched by noncanonical base-triads; the intramolecular quadruplex formed by a portion of the G-rich strand; the single-stranded region encompassing a portion of the G-rich strand and, probably, the (C,A)-hairpin formed by a portion of the C-rich strand.

Base Sequence↗
PubMed1994

An extension of the rigorous base-unit oriented description of nucleic acid structures.

Our proposed description for DNA base/base-pair structures (1), though rigorous, does not satisfy some of the requirements as established at the Cambridge Workshop (2). Here, we propose a revised description for base/base-unit structures of nucleic acids. This new description is as rigorous and satisfies all the requirements (2). Following the original approach, the moment-of-inertia frame is still the choice of the internal coordinate system for a base/base-unit. The revised description has the minimum number of parameters (i.e., six parameters per rigid body) in the set. Besides regular Watson-Crick type of helices (e.g., A-DNA, A-RNA, B-DNA, Z-DNA, etc.), the revised description also works for non-Watson-Crick, multiple stranded molecules (e.g., triplex, quadruplex, etc.) as well as parallel stranded molecules.

Base Composition↗
PubMed1995

Single strand targeted triplex formation: strand displacement of duplex DNA by foldback triplex-forming oligonucleotides.

Linear oligonucleotides that bind to single-stranded nucleic acid targets by formation of both Watson-Crick (duplex) and Hoogsteen (triplex) hydrogen bonds simultaneously (foldback triplex-forming oligonucleotides; FTFOs) were studied for their ability to disrupt duplex DNA. Recently, we reported that FTFOs interfere with quadruplex forming ability of guanine rich RNA and DNA sequences and indicated that they might also disrupt duplex structures binding to the purine target strand by foldback triplex formation (Kandimalla and Agrawal, Nucleic Acids Res. (1995) 23, 1068-1074). We now obtained evidence for strand displacement of duplex DNA by FTFOs using nuclease assays and thermal melting studies. UV melting studies revealed that complementary strands of 16 to 31 bases long were completely displaced. Results of DNase I assays showed that the FTFOs bound to purine site by strand displacement probably by preassociating with the duplex DNA in the major groove via Hoogsteen hydrogen bonding and subsequently displacing the complementary strand. Experiments with S1 nuclease, an enzyme specific for single-stranded nucleic acids, confirmed the strand displacement ability of the FTFOs.

Base Sequence↗
PubMed1998

Spectroscopic investigation of an intramolecular DNA triplex containing both G.G:C and T.A:T triads and its complex with netropsin.

The triple helix formation by the oligonucleotide 5'd(G4T4G4-[T4]-G4A4G4-[T4]-C4T4C4) ([T4] represents a stretch of 4 thymine residues) has been investigated by UV absorption spectroscopy and circular dichroism. In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we show the following significant results: i) In the absence of MgCl2, the oligonucleotide adopts a hairpin duplex structure with the dangling tail 5'd(G4T4G4-[T4]). This 5' extremity, which contains separated runs of four guanine residues, does not assume the expected tetraplex conformation observed when this sequence is free. ii) In the presence of MgCl2, the oligonucleotide folds back on itself twice to give a triple helix via a double hairpin formation, with [T4] single-strand loops. iii) The addition of high concentration of KCl to the preformed triplex does not disrupt the structure. Nevertheless, if the oligonucleotide is allowed to fold back in the presence of K+, triplex formation is inhibited. Circular dichroism studies demonstrate that the oligonucleotide adopts a dimeric conformation, resulting from the association of two hairpin duplexes, via the formation of an antiparallel G-quadruplex by the telomeric 5'd(G4T4G4-[T4]) extremities. iv) Under the experimental conditions used in this report, the triplex melts in a monophasic manner. v) Netropsin, a DNA minor groove ligand, binds to the central site A4/T4 of the duplex and to that of the triplex in an equimolar stoichiometry. In contrast with previous studies concerning pyr.pur:pyr triplexes, thermal denaturation experiments demonstrate that the netropsin binding stabilizes the intramolecular triplex.

Base Composition↗
PubMed2001

RADACK, a stochastic simulation of hydroxyl radical attack to DNA.

RADACK was conceived to simulate the radiation-induced attack to different DNA forms and complexes. It allows to separately calculate the probability of attack to each reactive atom of the sugar and of the base and takes into account the sequence-dependent structure of DNA as known from crystallographic or NMR studies or resulting from molecular modelling. The calculations are aimed to assess sequence-, structure- and ligand-dependent modulation of damages of sugar and bases, leading to single strand breaks (frank strand breaks, FSB) and alkali-labile base modifications (alkali-revealed breaks, ARB), respectively. The modelling procedure and the results of simulations for some representative structures (B, Z and quadruplex forms) are here described and discussed. The calculated relative probabilities of OH* radical attack to all reaction sites are compared to experimental FSB and ARB values. By a fitting procedure, the relative efficiencies of conversion of the C4' and C5'-centred radicals into FSB, epsilon (C4'): epsilon (C5'), and the relative efficiencies of base radicals- to- ARB conversion, epsilon(T) : epsilon(A) : epsilon(C) : epsilon(G), are then deduced for each DNA form. The ability of the model to account for the distribution of damages in DNA-ligand complexes is proven by its successful application to two DNA-protein systems : the lac repressor-lac operator complex and the nuclcosome core.

Bacterial Proteins↗
PubMedDate not supplied

The mysteries of telomere structure and recognition: could radioprobing help?

PURPOSE: Telomeres are specialized DNA-protein complexes found at the ends of eukaryotic chromosomes. In normal somatic cells these become shorter with each cell division and appear to control their replicative lifespan. However almost all tumours show activation of the enzyme telomerase, a specialised reverse transcriptase/DNA polymerase, that can add new telomeric repeats to the ends of chromosomes and this appears to be a key factor in the cell immortalization process. Consequently there is much current interest in the potential for inhibitors of telomere extension in the treatment of cancer. Several groups have found that it is possible to produce inhibitory molecules that target the telomeric repeat (substrate) DNA rather than the telomerase enzyme itself. This is thought to work because it has been found that in vitro, these DNA sequences can fold up into a four-stranded (quadruplex) structure that the drugs recognise and stabilize, but which is not recognised by the enzyme. However, while medicinal chemists continue to base rational design programs on this hypothesis, there is currently very little evidence that these structures form in vivo, and that in vivo the drugs work by binding to them. To have incontrovertible evidence of where and how these telomerase inhibitors and DNA interact is therefore a pressing concern for a basic understanding of their mechanism of action and effective drug development. MATERIALS AND METHODS: Radioprobing represents a valuable new approach to the study of DNA structures. Recently we have shown through computer simulations of radioprobing that the technique is a remarkably sensitive probe of quite fine details of DNA conformation. Here we report on our simulations of the binding of a radiolabelled telomerase inhibitor, related to a class of novel inhibitors under development at Nottingham, to a variety of possible structures for telomeric DNA. RESULTS AND CONCLUSIONS: The predicted cleavage patterns prove to be very sensitive to the DNA structure, and the mode of binding of the drug. These results suggest that radioprobing experiments should be able to provide unambiguous evidence as to the 'true' nature of the telomere-drug complexes, and so aid the rational design programme.

Animals↗
PubMedDate not supplied

CD of single-stranded, double-stranded, and G-quartet nucleic acids in complexes with a single-stranded DNA-binding protein.

We review CD studies of a single-stranded DNA binding protein, g5p, of the Ff group of bacterial viruses. The CD spectrum of the g5p is dominated by a positive tyrosine La band at 229 nm, to which all five of the protein tyrosines contribute. The La band becomes much less positive upon binding of g5p to nucleic acids. CD spectra of mutant proteins identified a single tyrosine, Y34, that is largely responsible for this CD perturbation. At >250 nm, CD perturbations of nucleic acids can be monitored during g5p binding, and CD titrations have identified two distinct modes of binding of the g5p at physiological ionic strength (0.2 M NaCl). SELEX selection of sequences bound preferentially by g5p yielded a G-rich sequence that is closely related to telomere sequences and has CD properties of a G-tetraplex. CD spectroscopy showed that the presumed G-quadruplex form is maintained within saturated g5p x DNA complexes.

Circular Dichroism↗
PubMed2002

Telomerase and telomeres: from basic biology to cancer treatment.

The limited capacity to divide is one of the major differences between normal somatic cells and cancerous cells. This 'finite life span' of somatic cells is closely linked to loss of telomeric DNA at telomeres, the 'chromosome caps' consisting of repeated (7TAGGG) sequences., In more than 85% of advanced cancers, this telomeric attrition is compensated by telomerase, 'the immortality enzyme', implying that telomerase inhibition may restore mortality in tumor cells. This review discusses the progress in research on the structure and function of telomeres and the telomerase holoenzyme. In addition, new developments in telomere/telomerase targeting compounds such as antisense oligonucleotides and G-quadruplex stabilizing substances, but also new telomerase expression-related strategies such as telomerase promoter-driven suicide gene therapy and telomerase immunotherapy will be presented. It will be discussed how these data can be implemented in telomerase-directed therapies.

Animals↗
PubMed2005

Gold DNA-conjugates: ion specific self-assembly of gold nanoparticles via the dG-quartet.

The Oxytricha telomere DNA hairpin 5'-d(G4T4G4) immobilized on 13 nm gold nanoparticles forms a supramolecular assembly via dGC-quartets, as determined by the color change and by SEM. The aggregation is ion-dependent and selective for sodium ions. K+ is less efficient while Li+ and Cs+ do not drive the aggregation. This work is the first effort exploring the use of secondary structures of DNA (quadruplexes) for producing self-assemblies of gold nanoparticles.

Base Sequence↗
PubMed2001

Toxicity and toxicokinetics of a phosphorothioate oligonucleotide against the c-myc oncogene in cynomolgus monkeys.

A 2-week toxicity and toxicokinetic study of a 15-mer phosphorothioate oligonucleotide, INX-3280, against the c-myc oncogene was performed in cynomolgus monkeys. As this oligonucleotide readily adopts an aggregate structure, a quadruplex, which may be associated with adverse physiologic effects, this study was performed using INX-3280 that had been converted to its monomeric form. Animals received intravenous (i.v.) infusions of monomeric INX-3280 three times per week for 2 weeks at doses of 3 or 15 mg/kg per administration. The monkeys were examined for clinical signs: changes in hematology, serum chemistry, coagulation, and urinalysis parameters; complement activation; macroscopic findings at necropsy; and histopathologic alterations. In addition, the toxicokinetics of INX-3280 were evaluated, using a validated HPLC assay, after the first and last (sixth) doses. No treatment-related clinical signs of any adverse effects were observed, and there were no test article-related changes in hematology, serum chemistry, or complement activation parameters. The only alteration in clinical pathology parameters was a minor (30%) prolongation of the activated partial thromboplastin time (aPTT), reflecting slight inhibition of the intrinsic coagulation pathway, which was less than that reported with other oligonucleotides given at similar doses. Treatment-related histopathologic alterations consisted of characteristic accumulation of basophilic material in the cytoplasm of tubular epithelial cells in the kidney, resident macrophages in the lymph nodes, and Kupffer cells in the liver. These changes were graded as minimal in all cases. The basophilic material is believed to reflect accumulation of the oligonucleotide or metabolites or both. The pharmacokinetic parameters of INX-3280 were identical on the first and sixth administrations and were similar to those reported for other phosphorothioate oligonucleotides. Maximum concentration (Cmax) values for INX-3280 (101-119 microg/ml) were in excess of the threshold plasma concentrations reported to trigger complement activation by phosphorothioate oligonucleotides. It is concluded that the safety profile of monomeric INX-3280 in cynomolgus monkeys is quite favorable relative to the known effects of other phosphorothioate oligonucleotides, particularly with respect to the blood level-related toxicities of this class of compounds, including complement activation and inhibition of coagulation. This study found no toxicities that were expected to be clinically significant.

Animals↗
PubMed2006

A palindromic repeat sequence adopts a stable fold back structure under supercoiling.

A synthetic deoxyoligonucleotide containing five palindromic repeats of GGATCC self assembles to form a parallel four-stranded structure held together by G-tetrads that shows slower mobility than duplex DNA. This structure is hypersensitive to S1 nuclease and resistant to DMS modification. The same oligonucleotide when cloned in a plasmid forms a different structure under supercoiling that persists stably even in the cleaved out insert. On polyacrylamide gel electrophoresis, the cleaved out insert moves to a position midway between the duplex and parallel four-stranded forms of the oligonucleotide. Upon S1 nuclease treatment, the cleaved out insert shows a discreet band of 18 base pairs, suggesting an unfolded region in the middle. All the guanines in the cleaved out insert are sensitive to DMS modification and produce a positive peak at 285 nM in the circular dichroism spectrum, a signature of fold back tetraplex structures. We propose a fold back quadruplex structure for the insert under supercoiling with only A.T.A.T and G.C.G.C tetrads. This is the first suggestive evidence of a general tetraplex motif without G quartets as that proposed for generalized recombination.

Base Sequence↗