Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Library preparation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 739 records · Page 41Linked to original sources
PubMedDate not supplied

Molecular cloning and expression of cDNA for human granulocyte colony-stimulating factor.

Granulocyte colony-stimulating factor (G-CSF) is a member of the CSF family of hormone-like glycoproteins that regulate haematopoietic cell proliferation and differentiation, and G-CSF almost exclusively stimulates the colony formation of granulocytes from committed precursor cells in semi-solid agar culture. Recently, Nomura et al. have established a human squamous carcinoma cell line (designated CHU-2) from a human oral cavity tumour which produces large quantities of CSF constitutively, and the CSF produced by CHU-2 cells has been purified to homogeneity from the conditioned medium. We have now determined the partial amino-acid sequence of the purified G-CSF protein, and by using oligonucleotides as probes, have isolated several clones containing G-CSF complementary DNA from the cDNA library prepared with messenger RNA from CHU-2 cells. The complete nucleotide sequences of two of these cDNAs were determined and the expression of the cDNA in monkey COS cells gave rise to a protein showing authentic G-CSF activity. Furthermore, Southern hybridization analysis of DNA from normal leukocytes and CHU-2 cells suggests that the human genome contains only one gene for G-CSF and that some rearrangement has occurred within one of the alleles of the G-CSF gene in CHU-2 cells.

Amino Acid Sequence↗
PubMed1999

Receptors for polytropic and xenotropic mouse leukaemia viruses encoded by a single gene at Rmc1.

The onset of leukaemia caused by type C retroviruses (MLV) in mice is accelerated by the emergence of recombinant polytropic or mink cell focus-forming (MCF) viruses. Susceptibility to infection by polytropic/MCF and also by closely related xenotropic MLV has been mapped to Rmc1 on mouse chromosome 1 (refs 5-7). To identify this gene, we introduced an expression cDNA library prepared from mouse NIH3T3 fibroblasts into nonpermissive hamster cells and screened these cells for acquired susceptibility to MCF viruses encoding beta-galactosidase and G418 resistance. From hamster cell clones identified in the screen, we recovered a mouse cDNA that maps to Rmc1 and confers MCF MLV infection when expressed in nonpermissive cell lines. It encodes a membrane protein related to Syg1p (suppressor of yeast G alpha deletion; ref. 8). The receptor-binding domain of the MCF MLV envelope protein binds specifically to Xenopus laevis oocytes that express mouse Syg1, suggesting it functions as a receptor that mediates virus entry. We also obtained the cDNA encoding human SYG1. When expressed in hamster cells, it establishes infectivity by MCF MLV as well as xenotropic MLV, which do not infect laboratory mice.

3T3 Cells↗
PubMed2001

Cloning of BNIP3h, a member of proapoptotic BNIP3 family genes.

Apoptosis is regulated by interaction of antiapoptotic Bcl-2 family proteins with various proapoptotic proteins, several of which are also members of the Bcl-2 family. BNIP3 (formerly NIP3) is a proapoptotic mitochondrial protein classified in the Bcl-2 family based on limited sequence homology-3 (BH3) domain and COOH-terminal transmembrane domain. Sequence comparison of BNIP3 has indicated that there are several BNIP3 human homologs of this protein, like BNIP3L, Nix and BNIP3. We have cloned a new member of BNIP3 family from the cDNA library prepared from human dermal papilla cells and designated as BNIP3h. BNIP3h shows substantial homology with other BNIP3 family proteins. BNIP3h induced apoptosis from 24 hours after transfection in MCF7 cell lines and its apoptosis inducing activity is extended until 72 hours after transfection.

Amino Acid Sequence↗
PubMed1991

Analysis of the cDNA sequence encoding MHC-A beta in tubular epithelium from mouse kidney.

Class II gene products of the major histocompatibility complex (MHC) are not expressed usually in abundance on normal epithelium. The cell surface visibility of such proteins for the immune system is thought to be limited protectively in order to minimize inflammation consequent to the recognition of self-antigens in parenchymal structures by T lymphocytes. In the current experiments we investigated whether the previously recognized sparseness of A beta on the surface of tubular epithelial cells might be accounted for by a protein coding difference deduced from the primary structure of its transcript compared with sequence from lymphoid cells that normally express A beta in generous amounts. We demonstrate, however, using clones obtained from a cDNA library prepared from tubular epithelium harvested from H-2s (A beta/alpha+; E beta/alpha-) mice susceptible to autoimmune interstitial nephritis, that the nucleotide sequence encoding the class II A beta chain in cells from both compartments is essentially identical. Our findings suggest that there is no primary structural aberrancy in the coding region of parenchymal A beta that would contribute to its low expression. The protective tolerance afforded by reduced numbers of class II molecules in normal tissues is, therefore, more likely the result of repressive regulatory processes.

Animals↗
PubMed2005

Expression analysis onto microarrays of randomly selected cDNA clones highlights HOXB13 as a marker of human prostate cancer.

In a strategy aimed at identifying novel markers of human prostate cancer, we performed expression analysis using microarrays of clones randomly selected from a cDNA library prepared from the LNCaP prostate cancer cell line. Comparisons of expression profiles in primary human prostate cancer, adjacent normal prostate tissue, and a selection of other (nonprostate) normal human tissues, led to the identification of a set of clones that were judged as the best candidate markers of normal and/or malignant prostate tissue. DNA sequencing of the selected clones revealed that they included 10 genes that had previously been established as prostate markers: NKX3.1, KLK2, KLK3 (PSA), FOLH1 (PSMA), STEAP2, PSGR, PRAC, RDH11, Prostein and FASN. Following analysis of the expression patterns of all selected and sequenced genes through interrogation of SAGE databases, a further three genes from our clone set, HOXB13, SPON2 and NCAM2, emerged as additional candidate markers of human prostate cancer. Quantitative RT-PCR demonstrated the specificity of expression of HOXB13 in prostate tissue and revealed its ubiquitous expression in a series of 37 primary prostate cancers and 20 normal prostates. These results demonstrate the utility of this expression-microarray approach in hunting for new markers of individual human cancer types.

Biomarkers, Tumor↗
PubMed1997

Identification of RB18A, a 205 kDa new p53 regulatory protein which shares antigenic and functional properties with p53.

Immunological screening with the anti-p53 moAb, PAb1801 of a cDNA expression library, prepared from human B lymphoma cells, led us to identify a new human 205 kDa protein called RB18A for 'Recognized By PAb1801 moAntibody'. Immunoblotting or immunoprecipitation of fusion protein or in vitro translated protein, respectively, demonstrated that RB18A protein was recognized by several anti-p53 moAb reacting with the N or C-terminal domains of p53. Full length sequence of RB18A cDNA and computer analysis demonstrated that despite common antigenic determinants between RB18A and p53 proteins, nucleotide and deduced protein sequences did not reveal any significant homologies. RB18A mRNA was detected in all tissues tested except in kidney. In addition, RB18A protein shared identical functions with p53 protein: binding to DNA or to p53 and self-oligomerization. Furthermore, RB18A regulated p53 specific binding on his DNA consensus binding site. These functions were associated to the C-terminal domain of RB18A protein and more specifically to the PAb421 binding site present in this domain. The activation by RB18A of p53 binding on DNA was induced through an unstable interaction between both proteins. Altogether, our data demonstrated that RB18A protein shares antigenic and functional properties with p53 and regulated p53 functions.

Amino Acid Sequence↗
PubMed1993

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation.

3T3 Cells↗
PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗
PubMed1995

Cloning, sequencing and expression of the pyrophosphate-dependent phosphofructo-1-kinase from Naegleria fowleri.

The cDNA for the PPi-dependent phosphofructo-1-kinase has been cloned and sequenced from a cDNA library prepared from the free-living amoeba Naegleria fowleri. The coding sequence of the cDNA consists of 1311 bases which translates into 437 amino acids with a molecular mass of 48095 Da. Comparison of the sequence with those of the previously described sequences of PPi-dependent phosphofructokinases from Propionibacterium freudenreichii and potato tuber revealed amino acid identities of 23 and 28% respectively and high conservation in those regions assumed to be part of the active site. The reading frame was cloned into an expression vector, which was transformed into Escherichia coli. Extracts of the transformed cells contained PPi-dependent phosphofructokinase activity that could be purified to homogeneity. The activity was lost on incubation with the chaotropic agent, KSCN, and recovered by subsequent incubation with AMP. These properties are consistent with those described by Mertens, De Jonckheere and Van Schaftingen [Biochem. J. (1993) 292, 797-803] for the enzyme prepared from Naegleria and support the idea that the cloned cDNA coded for the complete native enzyme. No nucleotide-binding motif or evidence for a nucleotide-binding site characteristic of the ATP-dependent phosphofructokinases could be found within the primary structure.

Adenosine Monophosphate↗
PubMed2001

Molecular characterization of a phosphatidylcholine-hydrolyzing phospholipase C.

While searching for a phospholipase C (PLC) specific for phosphatidylcholine in mammalian tissues, we came across such an activity originating from a contamination of Pseudomonas fluorescens. This psychrophilic bacterium was found to contaminate placental extracts upon processing in the cold. The secreted phosphatidylcholine-hydrolyzing PLC was purified by a combination of chromatographic procedures. As substrates, the enzyme preferred dipalmitoyl-phosphatidylcholine and 1-palmitoyl-2-arachidonoyl-phosphatidylcholine over phosphatidylinositol. The active enzyme is a monomer of approximately 40 kDa. As for other bacterial PLCs, the enzyme requires Ca2+ and Zn2+ for activity; dithiothreitol affected the activity due to its chelation of Zn2+, but this inhibition could be compensated for by addition of ZnCl2. The compound D609, described to selectively inhibit phosphatidylcholine-specific PLCs, caused half-inhibition of the P. fluorescens enzyme at approximately 420 microM, while 50-fold lower concentrations similarly affected PLCs from Bacillus cereus and Clostridium perfringens. Partial peptide sequences obtained from the pure P. fluorescens enzyme after tryptic cleavage were used to clone a DNA fragment of 3.5 kb from a P. fluorescens gene library prepared from our laboratory isolate. It contains an ORF of 1155 nucleotides encoding the PLC. There is no significant sequence homology to other PLCs, suggesting that the P. fluorescens enzyme represents a distinct subclass of bacterial PLCs. The protein lacks cysteine residues and consequently contains no disulfide bonds. Interestingly, P. fluorescens reference strain DSMZ 50090 is devoid of the PLC activity described here as well as of the relevant coding sequence.

Amino Acid Sequence↗
PubMed2001

Mapping of expressed sequence tags from a porcine early embryonic cDNA library.

The goal of this study was to identify and map genes expressed during the elongation phase of embryogenesis in swine. Expressed sequence tags were analysed from a previously described porcine cDNA library prepared from elongating swine embryos. Average insert length of randomly selected clones was approximately 600 bp, with a range from < 100 to > 2500 bp. Single-pass, coding strand sequences from 1132 independent clones were compared with the GenBank non-redundant (nr) database via BLASTN analysis to identify potential porcine homologous of known genes. Among these sequences, 781 (69%) showed significant (score > 300) homology to non- mitochondrial sequences previously deposited in GenBank. Sequences matching interleucin 1 beta and thymosin beta 10 were most frequently observed (24 and 18 clones, respectively), in addition to matches with 310 other distinct genes. No significant match in the GenBank nr database was obtained for 303 sequences. Analysis demonstrated that 151 (50%) had open reading frames (ORF) extending at least 50 codons from the first base of the clone insert. Genetic markers were developed and used to map a subset of 17 genes, selected on the basis of function or of the ability to design primers that successfully amplified porcine genomic DNA, to 10 different porcine chromosomes, providing a set of mapped markers corresponding to genes expressed during conceptus elongation.

Alleles↗
PubMed1991

Negative and positive regulation of a novel proline-rich protein mRNA by fungal elicitor and wounding.

The structure and expression of a cDNA clone (PvPRP1) isolated from a cDNA library prepared from bean (Phaseolus vulgaris) cells treated with fungal elicitor have been characterized. Sequence analysis of the 1.1 kb insert revealed a complete open reading frame which encodes a 32 kDa protein. The protein resembles other proline-rich proteins in plants but possesses several unique features: (i) the N-terminal half of the protein is proline rich and contains three identical repeats of Pro-Val-His-Pro-Pro-Val-Lys-Pro-Pro-Val and six related repeats; (ii) the proline-rich region contains two tracts of six histidine residues; and (iii) the C-terminal half is low in proline and lacks repeats. Genomic blotting experiments suggest the presence of a single PvPRP1 gene as well as more distantly related genes within the bean genome. A dramatic decrease in PvPRP1 mRNA levels occurs within 2 h of elicitor treatment of cell cultures. The PvPRP1 mRNA is present at a moderate level in hypocotyls. Upon wounding, the mRNA level initially decreases over 5 h and then accumulates over 25 h to levels which are higher than the basal level in unwounded hypocotyls. Based on the similarity to other proline-rich proteins with repeated motifs, including the presence of a putative signal peptide, it is likely that the PvPRP1 protein is targetted to the cell wall. The expression of the PvPRP1 gene appears to be integrated with the remodeling of the plant cell wall during the defense response.

Amino Acid Sequence↗
PubMed1993

Molecular characterization of two cDNAs from Sinapis alba L. expressed specifically at an early stage of tapetum development.

Flower formation in the long-day plant Sinapis alba is strictly dependent on an inductive light treatment. Differential screening of an apex cDNA library prepared 10 days after flower induction against cDNAs from vegetative apices has identified two cDNA clones, pSFD10.35 and pSFD10.44, which represent transcripts expressed transiently between day 10 and day 20 after induction and which disappear before flowers reach maturity. The corresponding full-length cDNAs which were isolated, Satap35 and Satap44, display 86% overall sequence identity. These cDNAs encode polypeptides with predicted molecular weights of 12.7 and 12.4 kDa, and isoelectric points of 10.4 and 7.5, respectively. The N-terminal portions of the open reading frames have characteristics of signal sequences. In situ hybridization reveals that both transcripts are localized exclusively in the tapetal cell layer of the anthers. Maximal expression is observed in flower buds of approximately 1.5 mm length (tetrad stage). Southern blot analysis demonstrates the presence of additional, closely related genes in the Sinapis genome, as well as the occurrence of homologous genes in Arabidopsis thaliana, Brassica napus and Nicotiana tabacum.

Amino Acid Sequence↗
PubMed1993

An inventory of 1152 expressed sequence tags obtained by partial sequencing of cDNAs from Arabidopsis thaliana.

As part of the goal to generate a detailed transcript map for Arabidopsis thaliana, 1152 single run sequences (expressed sequence tags or ESTs) have been determined from cDNA clones taken at random in libraries prepared from different sources of plant material: developing siliques, etiolated seedlings, flower buds, and cultured cells. Eight hundred and ninety-five different genes could be identified, 32% of which showed significant similarity to existing sequences in Arabidopsis and an array of other organisms. These sequences in combination with their positioning on the Arabidopsis genetic map will not only constitute a new set of molecular markers for genome analysis in Arabidopsis but also provide a direct route for the in vivo analysis of their gene products. The sequences have been made available to the public databases.

Animals↗
PubMed1993

Expression of myb-related genes in the moss, Physcomitrella patens.

Three cDNA clones encoding proteins containing a myb-related DNA binding domain have been isolated from a cDNA library prepared from protonemal tissue of the moss, Physcomitrella patens. The three cDNA clones between them encode two different classes of myb-like proteins, termed Pp1 and Pp2, that, outside of the myb domain, show no regions of significant homology. Acidic domains, capable of forming alpha-helical structures, are present in the carboxy-termini of the derived amino acid sequences from Pp1 and Pp2cDNAs suggesting that, like other myb genes, these proteins probably function as transcriptional activators. In contrast to other plants, where extensive myb-related gene families are present in the genome, a relatively small family is present in P. patens. Analyses of transcript levels during development of P. patens showed that maximum levels of transcription of the two genes occurred in young wild-type protonemal tissue that correlated with the time of maximum mitotic index. A decline in the expression of both genes occurs with increasing age of the wild-type tissue. Aberrant levels of expression of the two genes were observed in developmental mutants of P. patens which, as well as carrying specific morphological mutations, have greatly retarded protonemal growth rates. Transformation of wild-type P. patens with antisense constructs derived from Pp1 and Pp2 cDNA clones led to a dramatically reduced frequency of transformants when the expression of the reporter gene within the constructs was selected. Taken together, the data strongly suggest that expression of Pp1 and Pp2 is essential for cell growth during normal gametophytic development of P. patens.

Amino Acid Sequence↗
PubMed1994

Characterization of an Arabidopsis cDNA for a soluble epoxide hydrolase gene that is inducible by auxin and water stress.

A cDNA (1122 bp) was isolated from a cDNA library prepared from Arabidopsis thaliana L. that had been subjected to drought stress for 1 h. The sequencing of a genomic clone corresponding to the cDNA and S1 mapping analysis revealed that the cDNA lacked the first 6 bp from its translational start (ATG). The resulting open reading frame encodes a polypeptide of 321 amino acids, and the calculated molecular weight of this polypeptide is 36,423 Da. The deduced amino acid sequence shows a high degree of similarity to C terminal halves of those of soluble epoxide hydrolases (sEHs) of human, mouse and rat, 35.5%, 34.1% and 33.1%, respectively. The cDNA was expressed in Escherichia coli cells, and the expressed protein migrates at 40 kDa when analyzed by SDS-PAGE. The recombinant protein at 40 kDa is much smaller than the mammalian sEH (58 kDa) but has characteristics of activity and inhibition similar to the mammalian sEHs when assayed with the substrate trans-stilbene oxide and the inhibitors 4-fluorochalcone oxide (4FCO), (2R,3R)-3-(4-nitrophenyl) glycidol (RRNPG), and (2S,3S)-3-(4-nitrophenyl)glycidol (SSNPG), which indicates that the cDNA did encode a soluble epoxide hydrolase of A. thaliana (AtsEH). Drought stress, but not heat or cold stress, slightly increased the accumulation of the mRNAs for AtsEH. The level of AtsEH transcripts increased strongly after treatment with a plant hormone, auxin (2,4-dichlorophenoxyacetic acid, 2,4-D; naphthalene-acetic acid, NAA; and indole-3-acetic acid, IAA) in young, pre-bolting plants. Treatment with cytokinin (6-benzylaminopurine, BA), abscisic acid (ABA) or gibberellin (GA3) had no detectable effect on AtsEH transcript levels. The transcripts for AtsEH gene were detected in the aerial vegetative organs of bolting plants (i.e. stems and leaves), but not in roots, flowers and seeds. The possible function of AtsEH is discussed. A similar sEH cDNA has recently been characterized in potato (Stapleton et al., 1994).

Amino Acid Sequence↗
PubMed1995

Correlation between the induction of a gene for delta 1-pyrroline-5-carboxylate synthetase and the accumulation of proline in Arabidopsis thaliana under osmotic stress.

The isolation and characterization is reported of a cDNA for delta 1-pyrroline-5-carboxylate (P5C) synthetase (cAtP5CS), an enzyme involved in the biosynthesis of proline, from a cDNA library prepared from a dehydrated rosette plant of Arabidopsis thaliana. Southern blot analysis suggested that only one copy of the corresponding gene (AtP5CS) is present in A. thaliana. The deduced amino acid sequence of the P5CS protein (AtP5CS) from A. thaliana exhibited 74% homology to that of the P5CS from Vigna aconitifolia. Northern blot analysis revealed that the gene for P5CS was induced by dehydration, high salt and treatment with ABA, while it was not induced by heat or cold treatment. Moreover, the simultaneous accumulation of proline was observed as a result of the former treatments in A. thaliana. A cDNA for P5C reductase (cAtP5CR) was also isolated from A. thaliana and Northern blot analysis was performed. The AtP5CR gene was not induced to a significant extent by dehydration or high-salt stress. These observations suggest that the AtP5CS gene plays a principal role in the biosynthesis of proline in A. thaliana under osmotic stress.

1-Pyrroline-5-Carboxylate Dehydrogenase↗
PubMed1996

A sugar transporter from Medicago truncatula: altered expression pattern in roots during vesicular-arbuscular (VA) mycorrhizal associations.

A cDNA clone encoding a hexose transporter has been isolated from a library prepared from Medicago truncatula roots colonized by the mycorrhizal fungus Glomus versiforme. The clone (Mtst1) represents a M. truncatula gene and expression studies in yeast indicate that the encoded protein transports glucose and fructose but not sucrose. Transcripts corresponding to Mtst1 are expressed in leaves, stems and roots of M. truncatula, with the highest levels of expression in roots. In the roots, Mtst1 transcripts were detected in two distinct locations; the phloem fiber cells of the vascular tissue, and the cells of the root tip. Mtst1 expression in the roots is regulated in response to colonization by G. versiforme; transcript levels increased two- to fourfold in both M. truncatula and M. sativa following colonization by G. versiforme but did not increase during the unsuccessful interaction between G. versiforme and a M. sativa myc- mutant, suggesting that the increase in Mtst1 transcripts in the successful mycorrhizal interaction is correlated with internal growth of the fungus and potentially with a functioning symbiosis. Mtst1 transcripts were also detected in the cortical cells of the mycorrhizal root, specifically in areas of the root that were highly colonized by the mycorrhizal fungus. Thus, the formation of a symbiotic association with a VA mycorrhizal fungus is accompanied by a change in the cell type-specific expression of a transporter that potentially functions to supply sugars to root cells critically involved in the symbiotic association.

Amino Acid Sequence↗