Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Nucleotide Mapping”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 721 records · Page 40Linked to original sources
PubMed1990

Aryl hydrocarbon (Ah) receptor DNA-binding activity. Sequence specificity and Zn2+ requirement.

The aryl hydrocarbon (Ah) receptor, also called the xenobiotic or TCDD receptor, mediates transcriptional activation of the cytochrome P-450c (CYP1A1) gene by interacting with Ah or xenobiotic response elements. This paper presents evidence that a metal ion, probably Zn2+, is an essential cofactor for the Ah receptor. This paper also maps in detail the interactions between the Ah response element XRE1 and the Ah receptor from the rat hepatocyte-derived cell line LCS7. Interactions were mapped by three methods, 1) methylation interference footprinting, 2) mobility shift competition experiments, using a series of synthetic oligonucleotides with systematic alterations in the Ah response element core sequence, and 3) orthophenanthroline/Cu+ footprinting. These findings suggest the following consensus sequence for DNA recognition by the Ah receptor: CNA/TNA/TCACGCA/TA/T. The chelators 1,10-phenanthroline and oxalic acid inhibited the sequence-specific DNA-binding activity of the AH receptor in a concentration dependent manner, suggesting that the DNA-binding activity of the receptor requires divalent metal ions. Inhibition was due to metal-chelation, since: 1) inhibition was almost completely prevented by the presence of Zn2+, or other divalent metal ions having high affinity for the chelators used, while metal ions with low affinity did not protect; 2) the DNA-binding activity of the receptor could be restored by dialysis to remove 1,10-phenanthroline, but only in the presence of Zn2+, while dialysis in the absence of metal ions reversed inhibition by the nonchelating isomer 4,7-phenanthroline. The involvement of a divalent cation in receptor function, possibly bound via sulfhydryls, was also suggested by the finding that Cd2+ and Co2+ inhibited DNA-binding activity. Once bound to the XRE1 DNA sequence, the receptor could not be inhibited by 1,10-phenanthroline, suggesting that the essential metal ion must become inaccessible to chelation when the receptor binds DNA. The Zn2+ requirement of the Ah receptor is similar to that of the estrogen and the glucocorticoid receptors and is consistent with the hypothesis that the Ah receptor is a member of the steroid and thyroid hormone receptor superfamily.

Animals↗
PubMed1996

Expression of the barley stripe mosaic virus RNA beta "triple gene block".

Genomic RNA beta of barley strip mosaic virus (BSMV) contains four defined open reading frames (ORFs). These include the coat protein (beta a) and a "triple gene block" consisting of the beta b, beta c, and beta d ORFs that overlap one another. Two subgenomic beta RNAs (sgRNA beta 1 and sgRNA beta 2) with sizes of 2.5 and 0.96 kb were identified in BSMV-infected protoplasts, and their transcription initiation sites were mapped to nucleotides 789 and 2327, respectively, of RNA beta by primer extension experiments. In a cell-free wheat germ translation system, genomic RNA beta served as a mRNA only for the 22-kDa coat protein, and sgRNA beta 1 directed synthesis of only the 58-kDA beta b protein. However, with sgRNA beta 2, three proteins with sizes of 14, 17, and 23 kDa were synthesized. Both the 14- and the 23-kDa proteins were recognized by the beta d antibodies in vitro and in vivo. These results demonstrated that the 14-kDa protein was encoded by the beta d ORF and suggested that the 23-kDa protein, designated beta d', is a readthrough product of the amber stop codon of the beta d ORF. Mutagenesis of sgRNA beta 2 revealed that the 17-kDa protein was a product of the beta c ORF. Expression of sgRNA beta 1 and sgRNA beta 2 was also investigated with the chloramphenicol acetyl transferase (CAT) reporter gene in protoplasts coinfected with RNAs alpha and gamma plus chimeric RNA beta derivatives containing the CAT gene in-frame with the beta b, beta c, beta d, or beta d' ORFs. Elimination of the sgRNA beta 1 promoter abolished CAT expression from the beta b-CAT chimeric RNA, and removal of the sgRNA beta 2 promoter prevented CAT expression from the beta c-CAT, beta d-CAT, and beta d'-CAT chimeric RNAs. Taken together, these results demonstrate that the BSMV coat protein is the sole translation product of the genomic RNA beta, whereas sgRNA beta 1 serves as a messenger for translation of the beta b protein, and sgRNA beta 2 functions as a messenger for translation of beta c and beta d and the newly discovered beta d' protein. Additional mutagenesis experiments indicate that beta c is translated by a leaky scanning mechanism.

Base Sequence↗
PubMed1989

Nonsense mutations in the dihydrofolate reductase gene affect RNA processing.

Steady-state dihydrofolate reductase (dhfr) mRNA levels were decreased as a result of nonsense mutations in the dhfr gene. Thirteen DHFR-deficient mutants were isolated after treatment of Chinese hamster ovary cells with UV irradiation. The positions of most point mutations were localized by RNA heteroduplex mapping, the mutated regions were isolated by cloning or by enzymatic amplification, and base changes were determined by DNA sequencing. Two of the mutants suffered large deletions that spanned the entire dhfr gene. The remaining 11 mutations consisted of nine single-base substitutions, one double-base substitution, and one single-base insertion. All of the single-base substitutions took place at the 3' position of a pyrimidine dinucleotide, supporting the idea that UV mutagenesis proceeds through the formation of pyrimidine dimers in mammalian cells. Of the 11 point mutations, 10 resulted in nonsense codons, either directly or by a frameshift, suggesting that the selection method favored a null phenotype. An examination of steady-state RNA levels in cells carrying these mutations and a comparison with similar data from other dhfr mutants (A. M. Carothers, R. W. Steigerwalt, G. Urlaub, L. A. Chasin, and D. Grunberger, J. Mol. Biol., in press) showed that translation termination mutations in any of the internal exons of the gene gave rise to a low-RNA phenotype, whereas missense mutations in these exons or terminations in exon 6 (the final exon) did not affect dhfr mRNA levels. Nuclear run-on experiments showed that transcription of the mutant genes was normal. The stability of mature dhfr mRNA also was not affected, since (i) decay rates were the same in wild-type and mutant cells after inhibition of RNA synthesis with actinomycin D and (ii) intronless minigene versions of cloned wild-type and nonsense mutant genes were expressed equally after stable transfection. We conclude that RNA processing has been affected by these nonsense mutations and present a model in which both splicing and nuclear transport of an RNA molecule are coupled to its translation. Curiously, the low-RNA mutant phenotype was not exhibited after transfer of the mutant genes, suggesting that the transcripts of transfected genes may be processed differently than are those of their endogenous counterparts.

Animals↗
PubMed1989

Degradation of apolipoprotein II mRNA occurs via endonucleolytic cleavage at 5'-AAU-3'/5'-UAA-3' elements in single-stranded loop domains of the 3'-noncoding region.

Degradation intermediates of the estrogen-regulated apolipoprotein (apo) II mRNA were identified by S1 nuclease mapping and primer extension analysis. S1 mapping of poly(A)-RNA detected a series of mRNAs truncated at specific sites in the 3'-noncoding region. Many of these sites were also detected by primer extension analysis indicating that truncated molecules resulted from endonucleolytic cleavage in the 3'-noncoding region. Identical cleavage sites were seen with RNA from estrogen-treated animals or from animals withdrawn from hormone under conditions where apoII mRNA degraded in the slow (t1/2 = 13 h) or rapid (t1/2 = 1.5 h) decay mode. No differences were seen in poly(A) tail length or heterogeneity among these conditions. These results indicate that the estrogen-induced alteration in apoII mRNA turnover does not involve a new pathway of degradation, but, more likely, involves an increased targeting of the mRNA for degradation by a preexisting pathway. These data are consistent with a mechanism in which the initial step in apoII mRNA degradation is an endonucleolytic cleavage in the 3'-noncoding region without prior removal of the poly(A) tail. The endonucleolytic cleavage sites occurred predominantly at 5'-AAU-3' or 5'-UAA-3' trinucleotides found in single-stranded domains in a secondary structure model of the naked mRNA (Hwang, S-P. L., Eisenberg, M., Binder, R., Shelness, G. S., and Williams, D. L. (1989) J. Biol. Chem. 264, 8410-8418). The structure of the 3'-noncoding region in polyribosomal messenger ribonucleoprotein was examined by titrations of liver homogenates with dimethyl sulfate and cobra venom RNase. The results suggest that the typical cleavage site is a 5'-AAU-3' or 5'-UAA-3' trinucleotide in an accessible single-stranded loop domain. Single-stranded domains alone or accessible domains alone are not sufficient for cleavage. Similarly, 5'-AAU-3' or 5'-UAA-3' trinucleotides alone are not sufficient for cleavage. Localization of these trinucleotides to accessible single-stranded domains in the polyribosomal messenger ribonucleoprotein may provide the specificity for cleavage during targeted degradation.

Animals↗
PubMed1999

Inactivation and regulation of the aerobic C(4)-dicarboxylate transport (dctA) gene of Escherichia coli.

The gene (dctA) encoding the aerobic C(4)-dicarboxylate transporter (DctA) of Escherichia coli was previously mapped to the 79-min region of the linkage map. The nucleotide sequence of this region reveals two candidates for the dctA gene: f428 at 79.3 min and the o157a-o424-o328 (or orfQMP) operon at 79.9 min. The f428 gene encodes a homologue of the Sinorhizobium meliloti and Rhizobium leguminosarum H(+)/C(4)-dicarboxylate symporter, DctA, whereas the orfQMP operon encodes homologues of the aerobic periplasmic-binding protein- dependent C(4)-dicarboxylate transport system (DctQ, DctM, and DctP) of Rhodobacter capsulatus. To determine which, if either, of these loci specify the E. coli DctA system, the chromosomal f428 and orfM genes were inactivated by inserting Sp(r) or Ap(r) cassettes, respectively. The resulting f428 mutant was unable to grow aerobically with fumarate or malate as the sole carbon source and grew poorly with succinate. Furthermore, fumarate uptake was abolished in the f428 mutant and succinate transport was approximately 10-fold lower than that of the wild type. The growth and fumarate transport deficiencies of the f428 mutant were complemented by transformation with an f428-containing plasmid. No growth defect was found for the orfM mutant. In combination, the above findings confirm that f428 corresponds to the dctA gene and indicate that the orfQMP products play no role in C(4)-dicarboxylate transport. Regulation studies with a dctA-lacZ (f428-lacZ) transcriptional fusion showed that dctA is subject to cyclic AMP receptor protein (CRP)-dependent catabolite repression and ArcA-mediated anaerobic repression and is weakly induced by the DcuS-DcuR system in response to C(4)-dicarboxylates and citrate. Interestingly, in a dctA mutant, expression of dctA is constitutive with respect to C(4)-dicarboxylate induction, suggesting that DctA regulates its own synthesis. Northern blot analysis revealed a single, monocistronic dctA transcript and confirmed that dctA is subject to regulation by catabolite repression and CRP. Reverse transcriptase-mediated primer extension indicated a single transcriptional start site centered 81 bp downstream of a strongly predicted CRP-binding site.

Aerobiosis↗
PubMed1997

Fibroblast growth factor receptor signaling activates the human interstitial collagenase promoter via the bipartite Ets-AP1 element.

Interstitial collagenases participate in the remodeling of skeletal matrix and are regulated by fibroblast growth factor (FGF). A 0.2-kb fragment of the proximal human interstitial collagenase [matrix metalloproteinase (MMP1)] promoter conveys 4- to 8-fold induction of a luciferase reporter in response to FGF2 in MC3T3-E1 osteoblasts. By 5'-deletion, this response maps to nucleotides -100 to -50 relative to the transcription initiation site. The 63- bp MMP1 promoter fragment -123 to -61 confers this FGF2 response on the rous sarcoma virus minimal promoter. Intact Ets and AP1 cognates in this element are both required for responsiveness. The AP1 site supports basal and FGF-inducible promoter activity. The intact Ets cognate represses basal transcriptional activity in both heterologous and native promoter contexts and is also required for FGF activation. FGF2 up-regulates a DNA-binding activity that recognizes the MMP1 AP1 cognate and contains immunoreactive Fra1 and c-Jun. Both constitutive and FGF-inducible DNA-binding activities are present in MC3T3-E1 cells that recognize the MMP1 Ets cognate; prototypic Ets transcriptional activators are not present in these complexes. Inhibitors of protein kinase C, phosphatidyl inositol 3-OH kinase, and calmodulin-dependent protein kinase do not attenuate MMP1 promoter activation. FGF2 activates ERK1/ERK2 signaling in osteoblasts; however, 25 microM MAPK-ERK kinase (MEK) inhibitor PD98059 (inhibits by > 85% the phosphorylation of ERK1/ERK2) has no effect on MMP1 promoter activation by FGF2. Ligand-activated and constitutively active FGF receptors initiate MMP1 induction. Dominant negative Ras abrogates MMP1 induction by constitutively active FGFR2-ROS, but dominant negative Rho and Rac do not inhibit induction. The mitogen-activated protein kinase (MAPK) phosphatase MKP2 [inactivates extracellular regulated kinase (ERK) = Jun N-terminal kinase (JNK) > p38 MAPK] completely abrogates MMP1 activation, whereas PAC1 (inactivates ERK = p38 > JNK) attenuates but does not completely prevent induction. Thus, a Ras- and MKP2-regulated MAPK pathway, independent of ERK1/ERK2 MAPK activity, mediates FGF2 transcriptional activation of MMP1 in MC3T3-E1 osteoblasts, converging upon the bipartite Ets-AP1 element. The DNA-protein interactions and signal cascades mediating FGF induction of the MMP1 promoter are distinct from two other recently described FGF response elements: the MMP1 promoter (-123 to -61) represents a third FGF-activated transcriptional unit.

Animals↗
PubMed1998

Arginine 302 mutations in the pyruvate dehydrogenase E1alpha subunit gene: identification of further patients and in vitro demonstration of pathogenicity.

Three further patients with mutations in the codon for arginine 302 of the E1alpha subunit of the pyruvate dehydrogenase complex have been identified. Mutations in this codon have now been found in nine patients with pyruvate dehydrogenase deficiency in seven unrelated families, in sharp contrast to the great majority of other PDH E1alpha mutations which have been described in single individuals only. Because of the relatively high frequency of this mutation and because very few PDH E1alpha mutations have been demonstrated to be causative, we have established a system for analysing the consequences of defined mutations using transfection of normal and mutant PDH E1alpha cDNA into transformed human fibroblasts which have no endogenous E1alpha mRNA or protein. Using this test system, we have demonstrated that the R302C mutation results in the production of PDH E1alpha protein which is devoid of enzymic activity.

Arginine↗
PubMed1992

Acute undifferentiated leukemia with CD7+ and CD13+ immunophenotype. Lack of molecular lineage commitment and association with poor prognostic features.

The authors studied six adult patients with acute leukemia with these unusual characteristics: unclassifiable morphology and undifferentiated cytochemistry by French-American-British (FAB) criteria; concurrent expression of CD13 (and CD33) myeloid and early T-cell CD7 immune markers; no evidence of T-cell lineage commitment as determined by T-cell receptor beta (beta), gamma (gamma), and delta (delta) chain gene rearrangement study and cytoplasmic CD3 epsilon expression; and no evidence of myeloid cell lineage commitment, as shown by absent myeloid-specific c-fms proto-oncogene expression and negative myeloperoxidase ultrastructural staining (one case). Clinically, these diagnostic features matched with a poor prognosis, being associated with refractoriness to treatment, relapse and progression of disease, antecedent hematologic abnormality, and other malignancy. These cases may represent a distinct stem cell leukemia syndrome deserving immediate recognition and a nonconventional chemotherapeutic approach.

Acute Disease↗
PubMed1990

The use of genetic markers for personal identification and the analysis of family relationships.

In 1984 a family of hypervariable sequences was discovered in human DNA which when used as DNA probes provided a sufficiently informative sampling of an individual's DNA as to uniquely identify each person (except for genetically identical twins). Termed a DNA 'fingerprint', the DNA pattern revealed by the probes said nothing about characteristics of age, sex, height, or colour but immediately met a long-unanswered need for certain definition in the establishment of identity and family relationships. DNA tests are now a key tool in forensic investigations and are rapidly gaining acceptance in courts around the world. DNA tests are also replacing conventional serology for the resolution of paternity disputes. The definition provided by the DNA tests was possibly most urgently sought by immigration families in the UK who were separated by an inability to prove their family ties. The interest from the public has been overwhelming and Cellmark Diagnostics have already completed tests on over 15,000 individuals in the UK since opening in June 1987. Media coverage has been extensive, and continues to view DNA tests as beneficial; this, coupled with its commercial potential, suggests that DNA technology is here to stay.

Consanguinity↗
PubMed1994

Differential expression during embryogenesis of three genes clustered in the Ras1 region of Drosophila melanogaster.

Transcription mapping and nucleotide sequence analysis reveal that the genomic region of the Drosophila Ras1 gene contains a cluster of three closely localized genes. A gene termed Rlb1 is located nearby and upstream of Ras1, and is oriented in the opposite polarity relative to Ras1. In addition, a third gene termed Rlc1, is found at a very close proximity downstream to Rlb1. Ras1, the homologue of the human transforming ras genes, has been shown to be active in the posterior termini of the Drosophila embryo and in the eye imaginal disc in pathways of cell fate determination. We demonstrate that during embryogenesis Ras1 transcripts are restricted mainly to the embryonic central nervous system, suggesting that the gene product also may have a role in these nerve cells. Rlb1 encodes for a novel, lysine-rich basic protein. It is expressed mainly in the developing midgut and in the somatic mesoderm. Rlc1 also encodes for a novel, basic protein. The expression of Rlc1 during embryogenesis is similar, but not identical, to the expression pattern detected for Ras1. The vertebrate p21Ras proteins are bound to the inner face of the cell membrane. Ras1, the Drosophila homologue of p21, and the Rlb1 protein, are also non-cytoplasmic, membranous proteins. Rlb1 is found in the cell membrane of larval midgut epithelial cells. In addition, Rlb1 is detected in the nuclei of these cells, and in the nuclei of the midgut imaginal cells.

Amino Acid Sequence↗
PubMed1988

Undetectable bcr-abl rearrangements in some CML patients are due to a deletion mutation in the bcr gene.

Most patients with chronic myelogenous leukemia (CML) have Philadelphia (Ph) chromosome. Breakpoints on chromosome 22 in CML occur in a small region designated as the breakpoint cluster region (bcr). More than 90 percent of CML patients have breakpoints in the bcr; the remaining patients had no detectable rearrangement. In our study, a commercially available 1.2 kb HindIII-BglII (1.2 HBg) bcr probe was used to locate breakpoints in the bcr, which were found in 22 of 24 patients. Furthermore, using a probe upstream from the 1.2 HBg probe, rearranged bands were clearly detected in the two patients in whom no extra bands had been found with the 1.2 HBg probe. These results strongly suggest that these two patients carry a deletion at the acr-abl recombination point encompassing the area of the 1.2 HBg probe. Therefore, in our series, all CML patients eventually had breakpoints in the bcr, and the involvement of rearrangement was demonstrated to be highly specific for CML. Our data indicate that hybridization of CML cellular DNA with several bcr probes is important in examining accurately the frequency of bcr-abl rearrangements in CML, as some cases contain a deletion within the region.

Chromosome Aberrations↗
PubMed1988

Discordant expression of the G syndrome in monozygotic twins.

We present clinical manifestations of monozygotic male twins with different degrees of expression of the G syndrome. Monozygosity was confirmed using DNA mini-satellite "fingerprint" analysis. The findings in these twins suggest that expression of the G syndrome can be strongly influenced by the prenatal developmental environment.

Abnormalities, Multiple↗
PubMed1989

Mutant fibronectin gene in skin fibroblasts of sclerotic lesions from patients with progressive systemic sclerosis.

A mutant fibronectin gene was identified in skin fibroblasts obtained from sclerotic lesions of 7 patients with progressive systemic sclerosis. We found 2 point mutations adjacent to the cell-attachment tetrapeptide DNA sequence in the cell-binding domain of the fibronectin gene. This observation suggests that the mutant fibronectin is related to an integral component of sclerotic pathogenesis through abnormal cellular interactions.

Amino Acid Sequence↗
PubMedDate not supplied

Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1988

Optimized oligonucleotide probes for DNA fingerprinting.

The three different simple repetitive oligonucleotide probes (CT)8, (CAC)5 and (TCC)5 were hybridized to a panel of human DNAs which had been digested with the restriction endonucleases Alu I, Hinf I and Mbo I. The resulting DNA fingerprints were analyzed and different parameters calculated, such as the maximal mean allele frequency and the average number of polymorphic bands per individual. The highest number of bands was obtained after hybridization of Hinf I digested DNA with (CAC)5. The probability of finding the same band pattern as in individual A in individual B is 2 x 10(-8). The DNAs of monozygous twins show indistinguishable banding patterns and the bands are inherited according to the Mendelian laws. Thus this procedure reveals informative fingerprints that can be used for individual identification, e.g. in paternity testing and in forensic applications. In most of these experiments 32P-labelled probes were employed, yet the biotinylated oligonucleotide (GACA)4 produced results which were equivalent to those obtained by hybridization with the 32P-labelled probe (GACA)4.

Blotting, Southern↗
PubMedDate not supplied

Use of the hydroxyl radical and gel electrophoresis to study DNA structure.

The hydroxyl radical has been used as a chemical probe to study in solution the structure of DNA and DNA-protein complexes. The hydroxyl radical abstracts a deoxyribose hydrogen atom, cleaving one strand of the DNA. The cutting pattern, visualized by separating the cleavage products using gel electrophoresis, shows the reactivity of each backbone position toward the radical. This method has been applied to studies of DNA bending and helical twist. Phased runs of adenines (adenine tracts) cause sequence-directed DNA bending. The hydroxyl radical cleavage of a bent DNA fragment containing short adenine tracts phased with the helix screw gives rise to an unusual cutting pattern. The hydroxyl radical cleavage rate decreases in the 5' to 3' direction along each adenine tract, with a minimum at the 3' end of each adenine tract. The cleavage of the matching thymine tract is similar, but the minimum in the pattern is offset in the 3' direction. This pattern on the autoradiograph of the gel is interpreted to indicate that bending is accompanied by a narrow minor groove in the DNA molecule. Furthermore, hydroxyl radical cleavage results in different cutting patterns for two similar sequences, (CGA4T4)5 and (CGT4A4)5, which have been shown to be bent and relatively straight, respectively. The hydroxyl radical method has also been used to determine the helical repeat of the metallothionein IIA gene to be about 10.5 base pairs per turn. Methods of optimizing the hydroxyl radical reaction for DNA-protein footprinting are discussed. Because individual gel bands give information about cutting frequency at particular positions in the backbone, gel resolution and clear autoradiographs are important to this work.(ABSTRACT TRUNCATED AT 250 WORDS)

Autoradiography↗