Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Sulfonium Compounds”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources
PubMed2003

Growth of sulfate-reducing bacteria and methanogenic archaea with methylated sulfur compounds: a commentary on the thermodynamic aspects.

Methylated sulfur compounds such as dimethylsulfoniopropionate, dimethylsulfide, methanethiol, and other methylated sulfur compounds can act as sources of carbon and energy for the growth under anoxic conditions of a number of sulfate-reducing bacteria and methanogenic archaea. We summarise the range of degradative reactions that do or might occur in such organisms, and present thermodynamic data for these processes. These data enable estimates of the feasibility of the reactions as growth-supporting systems, and of the possible maximum growth yields of the bacteria and archaea catalysing them. We compare our new estimates with the few data that are currently available from the literature, and show that some published growth-yield assessments need reevaluation.

3-Mercaptopropionic Acid↗
PubMed2000

Simultaneous derivatization of acyl and S-alkyl moieties of acyl thioesters by using trimethylsulfonium hydroxide for gas chromatographic analysis.

The reaction of long-chain acyl thioesters, viz. lauric acid dodecyl thioester, 1,8-di-S-palmitoyl octanedithiol, and tristearoyl alpha-monothioglycerol, with trimethylsulfonium hydroxide in the presence of methanol leads to simultaneous derivatization of acyl moieties and S-alkyl moieties of acyl thioesters to the corresponding fatty acid methyl esters and methyl alkylsulfides, respectively. These derivatized products were analyzed by gas chromatographic technique.

Chromatography, Gas↗
PubMed1988

Non-enzymatic glutathione conjugation of 2-nitroso-6-methyldipyrido [1,2-a: 3',2'-d] imidazole (NO-Glu-P-1) in vitro: N-hydroxy-sulfonamide, a new binding form of arylnitroso compounds and thiols.

In order to study the possible detoxification mechanisms of the carcinogenic arylamine, 2-amino-6-methyldipyrido[1,2-a: 3',2'-d]imidazole (Glu-P-1), the in vitro non-enzymatic reaction of 2-nitroso-6-methyldipyrido[1,2-a: 3',2'-d]imidazole (NO-Glu-P-1) with reduced glutathione (GSH) was examined at pH 7.4 under both aerobic and anaerobic conditions. Two GSH-arylamine adducts were isolated and found to contain the Glu-P-1 and GSH moieties in a 1:1 molar ratio via an N-S linkage. Their structures were assigned as sulfinamide (-NH-SO-) and N-hydroxy-sulfonamide (-N(OH)-SO2-) by their behaviour under acidic and basic conditions and by UV-VIS, 1H-NMR, infrared and mass spectrometries. Also, a N-hydroxy-sulfonamide adduct was produced when NO-Glu-P-1 and cysteine were reacted at pH 7.4. The N-hydroxy-sulfonamide structure is a new binding form between arylnitroso compounds and thiols. The formation of these adducts may also take place in vivo as a detoxification of toxic arylamines since GSH is abundant in organs such as liver or kidney.

Chromatography, High Pressure Liquid↗
PubMed2004

Environmental VOSCs--formation and degradation of dimethyl sulfide, methanethiol and related materials.

Volatile organic sulfur compounds (VOSCs) play a major role in the global sulfur cycle. Two components, dimethyl sulfide (DMS) and methanethiol (MT) are formed in large amounts by living systems (e.g. algae, bacteria, plants), particularly in marine environments. A major route to DMS is by action of a lyase enzyme on dimethylsulfoniopropionate (DMSP). DMSP has other roles, for instance as an osmoprotectant and cryoprotectant. Demethiolation of DMSP and other materials leads to MT. A major transport process is release of DMS from the oceans to the atmosphere. Oxidation of DMS in the atmosphere by hydroxyl and nitrate radicals produces many degradation products including CO2, COS, dimethyl sulfoxide, dimethyl sulfone, organic oxyacids of sulfur, and sulfate. These materials also have roles in biotic processes and there are complex metabolic interrelationships between some of them. This review emphasizes the chemical reactions of the organic sulfur cycle. For biotic reactions, details of relevant enzymes are provided when possible.

Atmosphere↗
PubMed2004

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

Chromatography, High Pressure Liquid↗
PubMed2006

Bacterial taxa that limit sulfur flux from the ocean.

Flux of dimethylsulfide (DMS) from ocean surface waters is the predominant natural source of sulfur to the atmosphere and influences climate by aerosol formation. Marine bacterioplankton regulate sulfur flux by converting the precursor dimethylsulfoniopropionate (DMSP) either to DMS or to sulfur compounds that are not climatically active. Through the discovery of a glycine cleavage T-family protein with DMSP methyltransferase activity, marine bacterioplankton in the Roseobacter and SAR11 taxa were identified as primary mediators of DMSP demethylation to methylmercaptopropionate. One-third of surface ocean bacteria harbor a DMSP demethylase homolog and thereby route a substantial fraction of global marine primary production away from DMS formation and into the marine microbial food web.

Bacteria↗
PubMed2002

A mechanistic analysis of penetration of glyphosate salts across astomatous cuticular membranes.

Penetration of glyphosate salts across isolated poplar (Populus canescens (Aiton) Sm) cuticular membranes (CM) was studied using Na+, K+, NH4+, trimethylsulfonium+ (TMS) and isopropylamine+ (IPA) as cations. After droplet drying, humidity over the salt residues on the outer surfaces of the CM was kept constant, and cuticular penetration was monitored by sampling the receiver solution facing the inner surfaces of the CM. Glyphosate salts disappeared exponentially with time from the surfaces of the CM. This first-order process could be quantitatively described using rate constants (k) or half-times (time for 50% penetration; t1/2). Humidity strongly affected the velocity of penetration, as k increased by factors of 5.3 (K-glyphosate), 6.9 (TMS-glyphosate), 7.1 (NH4-glyphosate), 8.5 (Na-glyphosate) and 10.5 (IPA-glyphosate) when humidity was increased from 70 to 100%. Depending on the type of cation and humidity, t1/2 varied between 4 and 70h, but the humidity effect was statistically significant only at 100% humidity, when half-times were highest with IPA-glyphosate and lowest with TMS-glyphosate. Glyphosate acid penetration was measured only at 90% humidity and found to be extremely slow (t1/2 = 866 h). Adding 0.2 g litre-1 of a wetter (alkylpolyglucoside) to the donor increased IPA-glyphosate rate constants by about four times, but increasing concentration produced no further increase in k. When donors contained 0.2 g litre-1 wetter, further additions of 4 g litre-1 Ethomeen T25 did not change rate constants measured with IPA-glyphosate at 90% humidity, while Genapol C-100 and diethyl suberate increased k by only 35%. Concentration of IPA-glyphosate (1, 2 and 4 g litre-1) did not influence k at 90% humidity, and pH of donor solutions (4.0, 7.7, 9.5) had no effect on k of K-glyphosate at 90% humidity. Temperature (10 to 25 degrees C) had only a small influence on velocity of penetration of IPA-glyphosate and K-glyphosate, as energies of activation amounted to only 4.26 and 2.92 kJ mole-1, respectively. These results are interpreted as evidence for penetration of glyphosate salts in aqueous pores.

Cations↗
PubMed1974

Microbial oxidation of amines. Partial purification of a trimethylamine mono-oxygenase from Pseudomonas aminovorans and its role in growth on trimethylamine.

1. A mono-oxygenase, which oxidizes trimethylamine and other tertiary amines bearing methyl or ethyl groups, was partially purified sixfold from Pseudomonas aminovorans grown on trimethylamine as sole carbon source. 2. The preferred electron donor was NADPH. The enzyme had a pH optimum of 8.0-9.4 for trimethylamine oxidation, and 8.8-9.2 for dimethylamine oxidation. 3. The oxidation product of trimethylamine was shown to be trimethylamine N-oxide. Other tertiary amines were probably also converted into N-oxides. 4. The enzyme also oxidized secondary amines. 5. The oxidation of trimethylamine was only slightly inhibited by CO and not at all by KCN or proadifen hydrochloride (SKF 525-A), but was inhibited by trimethylsulphonium chloride, tetramethylammonium chloride, 2,4-dichloro-6-phenylphenoxyethylamine (Lilly 53325) and its NN-diethyl derivative (Lilly 18947). 6. The oxidation of dimethylamine showed a similar response to inhibitors and a parallel loss in activity on heating at 35 degrees C. 7. The activities of the trimethylamine mono-oxygenase, trimethylamine N-oxide demethylase and the secondary-amine mono-oxygenase increased severalfold during adaptation of succinate-grown bacteria to growth on trimethylamine, and the trimethylamine mono-oxygenase was the first enzyme to show an increase in activity. It is concluded that all three enzymes are involved in growth on trimethylamine by this organism.

Amines↗
PubMed1988

Synthesis of lysine-containing sulphonium salts and their properties as proteinase inhibitors.

Some sulphonium salts derived from lysine were synthesized with the general structure R-Lys-CH2S+-(alkyl)2. They were examined as inhibitors of the cysteine proteinase clostripain, which has a preference for cleaving peptide bonds at the carboxy group of basic amino acids, and of a number of trypsin-related serine proteinases. Clostripain was irreversibly inactivated by all reagents examined, but in the case of the serine proteinases, depending on the reagent structure, irreversible and reversible inhibitions were observed. These were kinetically characterized.

Cysteine Endopeptidases↗
PubMed1988

The synthesis and properties of peptidylmethylsulphonium salts with two cationic residues as potential inhibitors of prohormone processing.

Peptidylmethylsulphonium salts incorporating consecutive basic residues at the C-terminus of the peptidyl portion such as -Arg-Arg-, -Arg-Lys-, -Lys-Lys- and -Lys-Arg- were synthesized and examined as proteinase inhibitors. Serine proteinases with a specificity directed towards hydrolysis at cationic residues were found to be unaffected by these derivatives. On the other hand, cysteine proteinases, cathepsin B and, in particular, clostripain were readily inactivated by affinity labelling. The reagents thus are of promise for the study of prohormone processing promoted by cysteine proteinases.

Cathepsin B↗
PubMed1978

Enhancement of 5-hydroxytryptamine-induced contraction of the guinea pig ileum by a new sulfur compound, tripropylsulfonium bromide.

In the presence of tripropylsulfonium bromide (TPS) (1 X 10(-4) g/ml), a new compound, the phasic contraction of the isolated guinea pig ileum to 5-hydroxytryptamine (5-HT) (5 X 10(-7) g/ml) was consistently enhanced ("TPS effect"). TPS alone increased moderatley the spontaneous movement of the ileum. When the contraction height was calculated as the percentage of that to 5-HT alone, such was observed in the "TPS effect" to be 167.1 +/- 3.6% (mean +/- S.E., n = 80). TPS did not enhance the contraction due to acetylcholine or histamine. The "TPS effect" remained unaffected in the presence of dibenzyline (1 X 10(-7) g/ml), was abolished by morphine(1 X 10(-6) g/ml), tetrodotoxin (2 X 10(-8) g/ml) adenosine (3 X 10(-6) g/ml) and atropine (1 X 10(-7) g/ml) and was not observed under anoxic conditions. Eserine (1 X 10(-8) g/ml) strengthened the "TPS effect" markedly. It is concluded that this effect may be the result of the potentiating effect of TPS on the action of 5-HT through the M receptors, possibly by the facilitation of the acetylcholine-liberation from the nervous tissue.

Acetylcholine↗
PubMedDate not supplied

[An analysis of the action of metalloatranes on the hypothalamic neurons of rats].

Neurophysiological effects of different metal derivatives of atranes at single and repeated introduction into rats have been studied. Spontaneous activity of separate hypothalamic neurons was found to change at introduction of atranes. Discharge activity of hypothalamic [correction of pretubercular] cells changed both in phasic and in tonic mode in response to single injection of atranes. The data obtained allow to conclude that metal derivatives of atranes do not exert specific effect on hypothalamic neurons.

Animals↗
PubMed1989

Biological activity of sulphur ylides. I. Antimicrobial properties of some new carbonyl stabilized sulphonium ylides.

Antimicrobial properties of some new carbonyl stabilized sulphonium ylides have been tested against two bacteria Staphylococcus aureus, Escherichia coli and two fungi Alternaria alternata and Curvularia lunata. The potent antifungal activity of these compounds suggest their practical applications in fungicidal formulations and other pharmacological preparations.

Alkenes↗
PubMed1975

On the role of tryptophan residues in the mechanism of action of glyceraldehyde-3phosphate dehydrogenase as tested by specific modification.

A method is described to selectively modify one of the three tryptophan residues of the subunit of glyceraldehyde-3-phosphate dehydrogenase from yeast. As modifying agent dimethyl (2-hydroxy-5-nitrobenzyl) sulfonium bromide was used. The residue which is modified by the procedure described has been identified as Trp-193. There are either one or two molecules of the modifying agent being added to this tryptophan side chain. The modification apparently does not cause a detectable conformational change of the protein as judged from the methods employed. However, the enzymatic activities in the dehydrogenase as well as in the esterase reactions are lost after the modification. It could be established that the modification rendered the enzyme unable to bind the oxidized coenzyme. Also the charge-transfer interaction between enzyme and coenzyme could no longer be observed.

Apoproteins↗
PubMed1989

Sulfonium salts as derivatizing agents. 2. Determination of theophylline in plasma by automated gas chromatography.

An automated gas chromatographic method for determination of theophylline in plasma is described. A novel feature of this assay is the use of triethylsulfonium hydroxide as an on-column alkylating agent. A simple extraction procedure together with automated sample injection and data processing has facilitated processing of large numbers of samples generated in pharmacokinetic studies. The between-run coefficient of variation was 2.2% at 5 micrograms/ml (n = 5) and 3.9% at 15 micrograms/ml (n = 6). Within-run coefficient of variation was 2.4% at 5 micrograms/ml (n = 9) and 3.3% at 15 micrograms/ml (n = 6). Accuracy was 105% at a concentration of 5 micrograms/ml and 102% at 15 micrograms/ml.

Alkylation↗
PubMed1992

Inhibition of Clostridium perfringens phospholipase C by ammonium and sulfonium dications.

Polyamines, alkyldiammonium and alkyldisulfonium salts, inhibit the Clostridium perfringens phospholipase C-catalyzed hydrolysis of 1-S-phosphocholine-2-O-hexadecanoyl-1-mercapto-2-ethanol (1) at pH 7.5, 37 degrees C, mu = 1.0 with KCl. Simple saturation kinetics are observed as both 1 and [Ca2+] are varied and simple linear inhibition is observed. The data are consistent with a non-competitive mechanism that involves binding of the inhibitors to free enzyme, E.[Ca2+] and E.[Ca2+].[S]; the inhibition constants for decamethylenebis(trimethylammonium) and decamethylenebis(dimethylsulfonium) bromides are 90 and 0.28 mM, respectively. It is suggested that the enhanced inhibition by the alkyldisulfonium salts results from more favorable equilibrium constants for contact ion-pair formation or from the formation of tetracoordinate sulfuranes.

Ammonia↗