PubMed1996
The A1 heterogeneous nuclear ribonucleoprotein (hnRNP) is the best studied of the "core" hnRNP proteins that are tightly associated with heterogeneous nuclear RNA (hnRNA) within eukaryotic nuclei. Previous studies suggested that hnRNP A1 preferentially binds (under nonequilibrium conditions) to the pyrimidine-rich span of sequence at the 3'splice site of most introns [Swanson, M.S., & Dreyfuss, G. (1988) EMBO J. 11, 3519-3529; Buvoli et al. (1990) Nucleic Acids Res. 18, 6595-6600; Ishikawa et al. (1993) Mol. Cell. Biol. 13, 4301-4310]. Recently, Burd and Dreyfuss [(1994) EMBO J. 13, 1197-1204] used selection/amplification from pools of random sequence RNA to uncover an even higher-affinity A1 oligo that contained two copies of a high-affinity consensus sequence, UAGGGU/A. We have extended these studies by using a fluorescence assay to characterize the equilibrium binding properties of A1 to each of these oligonucleotides. By also characterizing the binding of A1 to sequence-randomized control oligonucleotides, we have been able to better evaluate the inherent "sequence-specific" binding properties of A1. Although these studies indicate that under equilibrium conditions A1 cannot specifically recognize the beta-globin, 3'-splice site DNA oligo analogue studied by Buvoli et al. (1990), they confirmed the high-affinity binding to the "winner" 20-mer RNA that was uncovered via selection/amplification and that has the sequence UAUGAUAGGGACUUAGGGUG (Burd & Dreyfuss, 1994). In 0.1 M NaCl, we found that A1 has approximately 100-fold higher affinity for this winner sequence sequence than it does for either a randomized version of this sequence or a 20-mer oligo corresponding to an unrelated beta-globin intron sequence. This winner RNA oligo aggregates in solution to form an apparent dimer that may represent a G-quartet resulting from dimerization of two Hoogsteen base-paired hairpins. On the basis of salt sensitivity studies carried out with various fragments of A1, the ability of A1 to discriminate the winner sequence from its randomized control results primarily from increased ionic interactions with the glycine-rich, COOH terminal domain of A1 that extends from residue 196 to 319. Nonetheless, most of the overall energy of binding for the A1 winner complex results from determinants that are resident within the first 195 residues of A1. The unique ability of the winner sequence (but not its sequence-randomized control) to form a higher-order aggregate, which may correspond to a G-tetrad, appears to facilitate the additional ionic interactions with the COOH terminal domain. Taken together, these data suggest the need to reevaluate possible and probable functions of A1 in vivo.