Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA Aggregation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources
PubMedDate not supplied

[Characteristics of 24S and 35S virus-specific RNA in cells infected with Newcastle disease virus].

The properties of 24S and 35S virus-specific RNAs of Newcastle disease virus were studied after denaturation. It was shown that 60-80% of 24S and 35SRNA consisted of agglomerates of molecules of virus-specific 18S RNA. Undissociable upon denaturation, 24S RNA contained mainly the same components as undenaturated RNA and consisted completely of sequences of virus-specifis 18S RNA. Undissociable 35S RNA contained no "heavy" heterogenous material present in the intact undenaturated RNA and 75% of it consisted os sequences of 18S virus-specific RNA. Some sequences present in undissociable 24S RNA were absent in undissociable 35S RNA. The aggregation of virus-specific na-transcripts and subsequent formation of covalent bonds between transcripts as well as possible formation of "solid" transcripts of the adjacent genes are discussed.

Newcastle disease virus↗
PubMed1975

Transcription of the genome of adenovirus type 12. I. Viral mRNA in abortively infected and transformed cells.

In baby hamster kidney (BKH-21) cells abortively infected with adenovirus type 12, polysome-associated, virus-specific RNA could be detected starting 5 to 7 h after infection. The amount of this RNA reached a maximum between 10 to 12 h after infection and continued to be synthesized at a reduced level until late in infection (48 to 50 h.). In BHK-21 cells transformed by adenovirus type 12 (HB cells), 0.26% of the polysome-associated mRNA was virus specific. The size of the virus-specific mRNA isolated from polysomes of BHK-21 cells abortively infected with, or transformed by adenovirus type 12 was determined by electrophoresis in polyacrylamide gels in 98% formamide, i.e., under conditions which eliminated secondary structure or aggregation of RNA. In abortively infected hamster cells viral mRNA size classes of molecular weights 0.9 times 10-6 and 0.65 times 10-6 to 0.67 times 10-6 were predominant. A minor fraction of 1.5 times 10-6 daltons was consistently found and increased with time after infection. Late after infection (24 to 26 h), viral mRNA of 1.9 times 10-6 daltons was also observed. The size distribution of adenovirus type 12-specific mRNA from transformed hamster cells (HB line) was very similar to that in abortively infected cells, except that the relative amount of the viral mRNA fraction of 1.5 times 10-6 daltons was much higher. It is uncertain whether the viral mRNA of high-molecular-weight represents mixed transcripts derived from integrated viral genomes and adjacent host genes.

Adenoviridae↗
PubMed1973

Characteristics of membrane-bound and free hepatic ribosomes from insulin-deficient rats. I. Acute experimental diabetes mellitus.

Membrane-bound and free ribosomes were prepared by discontinuous density gradient centrifugation from livers of rats 2-3 days after receiving alloxan (75 mg/kg) or streptozotocin (100 mg/kg). Hepatocytes from these animals were also examined by electron microscopy and subjected to quantitative morphometric analysis. The results indicated that the two populations of hepatic ribosomes respond differently to acute insulin deficiency. There was an overall reduction (P < 0.001) in total number of bound ribosomes per volume cytoplasm: the remaining bound ribosomes underwent a shift to smaller-sized ribosomal messenger RNA (mRNA) aggregates (P < 0.02); and the proteinsynthetic activity of these bound ribosomes was less than normal (P < 0.02) when protein synthesis was directed by endogenous mRNA. However, there was no difference between bound ribosomes from livers of normal and diabetic rats when protein synthesis was directed by polyuridylic acid. In contrast, free ribosomes were unchanged in number and degree of ribosomal mRNA aggregation, but displayed a significantly increased rate of in vitro protein synthesis (P < 0.01) as compared to normal controls. This increased protein-synthetic activity occurred when amino acid incorporation was directed by endogenous mRNA or polyuridylic acid. These changes in structure and function of bound and free hepatic ribosomes were prevented by the concomitant administration of insulin. The decrease in protein-synthetic activity of bound hepatic ribosomes from acutely diabetic rats seems to be secondary to marked disruption and disaggregation of the rough endoplasmic reticulum (RER) with production of smaller ribosomal mRNA aggregates which incorporate less amino acids into protein. Increased protein synthetic activity of free ribosome appears to be related to the ability of these ribosomes to copy mRNA more efficiently.

Amino Acids↗
PubMed1996

Origins of binding specificity of the A1 heterogeneous nuclear ribonucleoprotein.

The A1 heterogeneous nuclear ribonucleoprotein (hnRNP) is the best studied of the "core" hnRNP proteins that are tightly associated with heterogeneous nuclear RNA (hnRNA) within eukaryotic nuclei. Previous studies suggested that hnRNP A1 preferentially binds (under nonequilibrium conditions) to the pyrimidine-rich span of sequence at the 3'splice site of most introns [Swanson, M.S., & Dreyfuss, G. (1988) EMBO J. 11, 3519-3529; Buvoli et al. (1990) Nucleic Acids Res. 18, 6595-6600; Ishikawa et al. (1993) Mol. Cell. Biol. 13, 4301-4310]. Recently, Burd and Dreyfuss [(1994) EMBO J. 13, 1197-1204] used selection/amplification from pools of random sequence RNA to uncover an even higher-affinity A1 oligo that contained two copies of a high-affinity consensus sequence, UAGGGU/A. We have extended these studies by using a fluorescence assay to characterize the equilibrium binding properties of A1 to each of these oligonucleotides. By also characterizing the binding of A1 to sequence-randomized control oligonucleotides, we have been able to better evaluate the inherent "sequence-specific" binding properties of A1. Although these studies indicate that under equilibrium conditions A1 cannot specifically recognize the beta-globin, 3'-splice site DNA oligo analogue studied by Buvoli et al. (1990), they confirmed the high-affinity binding to the "winner" 20-mer RNA that was uncovered via selection/amplification and that has the sequence UAUGAUAGGGACUUAGGGUG (Burd & Dreyfuss, 1994). In 0.1 M NaCl, we found that A1 has approximately 100-fold higher affinity for this winner sequence sequence than it does for either a randomized version of this sequence or a 20-mer oligo corresponding to an unrelated beta-globin intron sequence. This winner RNA oligo aggregates in solution to form an apparent dimer that may represent a G-quartet resulting from dimerization of two Hoogsteen base-paired hairpins. On the basis of salt sensitivity studies carried out with various fragments of A1, the ability of A1 to discriminate the winner sequence from its randomized control results primarily from increased ionic interactions with the glycine-rich, COOH terminal domain of A1 that extends from residue 196 to 319. Nonetheless, most of the overall energy of binding for the A1 winner complex results from determinants that are resident within the first 195 residues of A1. The unique ability of the winner sequence (but not its sequence-randomized control) to form a higher-order aggregate, which may correspond to a G-tetrad, appears to facilitate the additional ionic interactions with the COOH terminal domain. Taken together, these data suggest the need to reevaluate possible and probable functions of A1 in vivo.

Amino Acid Sequence↗
PubMed1979

Structural states of dictyostelium myosin.

Myosin purified from Dictyostelium amoebae has approximately 10% by weight of RNA associated with it, unless specific steps (DEAE cellulose chromatography or RNase digestion) are taken to remove it. This RNA has significant effects on the structural states formed by the myosin at low ionic strength in the presence of Mg2+. Rapid precipitation of RNA-free myosin by dilution generates bipolar thick filaments (540 nm long, 33 nm thick), often with a bare zone and a 15-nm transverse repeat. Rapid precipitation of myosin with copurified RNA yields linear aggregates of bipolar filaments, showing some lateral association. Slow precipitation of RNA-free myosin by dialysis yields very long filaments or ribbons (greater than 5 micrometer, 30--60 nm wide) in which the myosin may be packed diagonally across the filament, similar to the "side-polar" aggregates formed by other nonmuscle myosins and by smooth muscle myosin (Craig R, Megerman J: J Cell Biol 75:990, 1977; Hinssen H, D'Haese J, Small JV, Sobieszek A: J Ultrastruct Res 64:282, 1978). Slow precipitation of myosin with copurified RNA generates linear filaments with repeat intervals of 290 and 650 nm. Other polyanions were tested for their effects on myosin aggregation. Total RNA and ribosomal RNA from Dictyostelium, when added to RNA-free myosin, also induced the extensive linear aggregation seen with the copurified RNA/myosin complex, although higher concentrations of RNA were required to obtain quantitatively the same effect. DNA and heparin were also effective inducers of linear aggregation, whereas homopolymers of nucleotides and of acidic or basic amino acids were poorly effective.

Dictyostelium↗
PubMed2000

Identification of lysophospholipid receptors in human platelets: the relation of two agonists, lysophosphatidic acid and sphingosine 1-phosphate.

Lysophosphatidic acid (LPA) and sphingosine 1-phosphate (Sph-1-P) are known as structurally related bio-active lipids activating platelets through their respective receptors. Although the receptors for LPA and Sph-1-P have been recently identified in various cells, the identification and characterization of ones in platelets have been reported only preliminarily. In this report, we first investigated the distinct modes of LPA and Sph-1-P actions in platelet activation and found that LPA functioned as a much stronger agonist than Sph-1-P, and high concentrations of Sph-1-P specifically desensitized LPA-induced intracellular Ca(2+) mobilization. In order to identify the responsible receptors underlying these observations, we analyzed the LPA and Sph-1-P receptors which might be expressed in human platelets, by RT-PCR. We found for the first time that Edg2, 4, 6 and 7 mRNA are expressed in human platelets.

Blood Platelets↗
PubMed2002

Effects of amrinone on hepatic ischemia-reperfusion injury in rats.

BACKGROUND/AIMS: The present study was designed to investigate the effect of amrinone, a phosphodiesterase III inhibitor, on hepatic ischemia-reperfusion injury in rats. METHODS: Amrinone was infused at a rate of 20 or 100 microg/kg/min, and 60-min partial ischemia was induced. The effects of amrinone on hemodynamic status, hepatic tissue cyclic adenosine 5'-monophosphate (cAMP), hepatic tissue blood flow, platelet aggregation and plasma levels of transaminase were examined. The expression of intercellular adhesion molecule-1 (ICAM-1) and myeloperoxidase activity were analyzed and histological examination was performed in the injured liver. The cumulative survival rates for 14 days were also examined. RESULTS: Hemodynamic status was not affected by amrinone. The levels of cAMP during reperfusion were significantly higher in rats with amrinone. Hepatic tissue blood flow during reperfusion was increased and platelet aggregation was inhibited by amrinone. The expression of ICAM-1 mRNA and protein in the injured liver was suppressed in rats with amrinone. The levels of transaminase, necrotic changes and myeloperoxidase activity were suppressed after reperfusion and higher survival was achieved in the rats treated with amrinone. CONCLUSIONS: Amrinone protected against ischemia-reperfusion injury of the liver in the present model.

Alanine Transaminase↗
PubMed1979

Kinetics and mechanism of tobacco mosaic virus assembly: direct measurement of relative rates of incorporation of 4S and 20S protein.

The mechanism of assembly of tobacco mosaic virus has been investigated under conditions in which the rates of incorporation of the 4S and 20S proteins can each be directly measured by analytical centfrifugation. Under these conditions, pH 6.5, 6.5 degrees C, 0.10 M ionic strength potassium orthophosphate, the protein can be made to exist as a metastable 20S aggregate that is necessary for efficient reconstitution. The overall assembly process consists of an initiation (nucleation) reaction that requires two to three 20S disk aggregates per RNA molecule and is followed by an elongation (growth) reaction. In the elongation phase of assembly the 4S protein is incorporated 50 to 70 times faster than the 20S disk, calculated on the basis of a steady-state kinetic analysis. Therefore, under these conditions, in which the rate of assembly is about 0.06 of that at pH 7, 20 degrees C, 0.10 M ionic strength orthophosphate, the 4S protein preferentially participates in the elongation phase. At this slow reconstitution rate intermediate assembly states (about 70-168 S) can be observed. The kinetics of both protein incorporation and nucleoprotein formation suggest that the elongation process is composed of at least two different, possibly sequential, rate-limiting reactions.

Kinetics↗
PubMed1985

Regulated expression of ras gene constructs in Dictyostelium transformants.

Constructs were made in which approximately equal to 500 base pairs of the 5' flanking region of the ras gene of Dictyostelium discoideum and variable amounts of the coding region were linked to a ras cDNA in a transformation vector. These constructs then were used to transform Dictyostelium cells and their regulation was examined. In Dictyostelium transformants, transcripts from the ras gene constructs were found at high levels in cells in fast-shaking cultures containing cAMP, whereas transcripts were either not detectable or present at very low levels in cultures lacking exogenous cAMP. In slow-shaking culture, a significantly lower level of ras RNA was detected. When normal developing aggregates were dissociated, RNA from the ras constructs decreased rapidly but then reaccumulated in the presence of cAMP. These results show that the sequences necessary for the response to external cAMP are present within an approximately equal to 650-base-pair region upstream from the ATG start codon and/or within portions of the protein-coding region. Moreover, the proper regulation of ras gene expression in high-copy-number transformants suggests that trans-acting factors which may control transcription are not limiting. Vector constructs were also examined in which the cDNA was present in the opposite orientation compared to the gene fragment (antisense orientation). When these were transfected into cells, no transformants were obtained, suggesting that expression of the ras gene is essential for vegetative growth.

Base Composition↗
PubMed2002

Endothelial nitric oxide synthase pathophysiology after nonocclusive common carotid artery thrombosis in rats.

Although vascular dysregulation has been documented in patients with extracranial vascular disease, transient ischemic attacks, and stroke, the pathomechanisms are poorly understood. To model thromboembolic stroke in rats, photochemically induced nonocclusive common carotid artery thrombosis (CCAT) was used to generate a platelet thrombus in the carotid artery of anesthetized rats. After CCAT, platelet aggregates break off the thrombus, travel to the distal cerebral vasculature, damage blood vessels, and cause small infarctions. The authors hypothesized that deficits in the endothelial nitric oxide synthase (eNOS) pathway may be responsible for vascular dysfunction after embolic stroke. To examine the functional status of the eNOS system, they measured eNOS-dependent dilation after CCAT by applying acetylcholine through a cranial window over the middle cerebral artery. The authors also measured eNOS mRNA and protein in the middle cerebral artery to determine whether functional changes were caused by alterations in expression. eNOS-dependent dilation was reduced at 6 hours, elevated at 24 hours, and returned to baseline 72 hours after CCAT. Endothelial nitric oxide synthase mRNA increased at 2 hours and was followed by a rise in protein 24 hours after CCAT. Changes in the eNOS system may account for some of the observed vascular deficits in patients with cerebrovascular disease.

Acetylcholine↗
PubMed1998

In vitro release of vascular endothelial growth factor during platelet aggregation.

Platelet aggregation is a cardinal feature of both vascular repair and vascular disease. During aggregation platelets release a variety of vasoactive substances; some of these promote angiogenesis, endothelial permeability, and endothelial growth, actions shared by vascular endothelial growth factor (VEGF). This study was undertaken to investigate the hypothesis that VEGF is released by aggregating platelets. We found that VEGF was secreted during the in vitro aggregation of platelet-rich plasma induced by thrombin, collagen, epinephrine, and ADP (range 23-518 pg VEGF/ml). Furthermore, serum VEGF levels were elevated compared with plasma (230 +/- 63 vs. 38 +/- 8 pg VEGF/ml), indicative of VEGF release during whole blood coagulation. Lysates of apheresed, leukocyte-poor platelet units contained significant amounts of VEGF (2.4 +/- 0.8 pg VEGF/mg protein). VEGF message and protein were also present in a megakaryocytic cell line (Dami cell). These results suggest constitutive roles for platelet VEGF in the repair of intimal vessel injury and in the altered permeability and intimal proliferation seen at sites of platelet aggregation and thrombosis.

Adenosine Diphosphate↗
PubMed1994

Insulin-like growth factor I inhibits induction of nitric oxide synthase in vascular smooth muscle cells.

Experiments were designed to examine whether or not insulin-like growth factor I (IGF-I), which is produced by vascular cells in response to injury, affects the production of nitric oxide evoked by the inducible nitric oxide synthase in cultures of smooth muscle cells from the rat aorta. Nitric oxide production was assessed indirectly by the measurement of nitrite accumulation and nitric oxide synthase activity by determining the formation of L-citrulline from L-arginine. Nitric oxide synthase was induced in vascular smooth muscle cells that had been exposed to interleukin-1 beta (IL-1 beta) or tumor necrosis factor-alpha (TNF-alpha). IGF-I inhibited, in a concentration-dependent manner, the production of nitrite and L-citrulline evoked by IL-1 beta or TNF-alpha. The inhibition caused by IGF-I required the presence of the growth factor during the induction of nitric oxide synthase. Two IGF-I-related proteins, IGF-II and insulin, also inhibited, but to a smaller extent, the release of nitrite and the formation of L-citrulline stimulated by IL-1 beta. Under bioassay conditions, the perfusates from columns containing IL-1 beta-treated smooth muscle cells relaxed rings of rat aorta without endothelium that had been contracted with phenylephrine; these relaxations were reversed by nitro-L-arginine. Addition of IL-1 beta-treated vascular smooth muscle cells to indomethacin-treated platelets inhibited their aggregation to thrombin; methylene blue prevented this inhibition. Control smooth muscle cells or cells exposed to IGF-I alone did not have such effects.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Oxidoreductases↗
PubMed2000

Regulation of endothelial nitric oxide synthase expression by albumin-derived advanced glycosylation end products.

We examined whether albumin-derived advanced glycosylation end products (AGEs) downregulate the expression of endothelial nitric oxide synthase (NOS). Significant reductions in NOS activity and cGMP levels in bovine aortic endothelial cells were observed when exposed to different concentrations of albumin-derived AGEs. Western and Northern blot analyses showed significant decreases at the protein and transcript levels. Both reductions became evident after 24 hours of exposure. Nuclear run-on assays showed that AGE-BSA did not modify the transcription rate of the NOS III gene; however, AGE-BSA treatment markedly reduced the half-life of NOS III mRNA. In addition, AGE-treated endothelial cells displayed significant reduction on their antiplatelet properties. These results indicate that NOS expression is reduced by AGEs by increasing the rate of mRNA degradation and may be relevant to the impairment of some endothelial functions observed in diabetes and aging. The full text of this article is available at http://www.circresaha.org.

Animals↗
PubMed2001

Increased bleeding tendency and decreased susceptibility to thromboembolism in mice lacking the prostaglandin E receptor subtype EP(3).

BACKGROUND: Among the prostanoids, thromboxane (TX) A(2) is a potent stimulator of platelets, whereas prostaglandin (PG) I(2) inhibits their activation. The roles of PGE(2) in the regulation of platelet function have not been established, however, and the contribution of PGE(2) in hemostasis and thromboembolism is poorly understood. The present study was intended to clarify these roles of PGE(2) by using mice lacking the PGE(2) receptor subtype 3 (EP(3)(-/-) mice). METHODS AND RESULTS: Expression of mRNAs for EP(3) in murine platelets was confirmed by quantitative reverse transcription-polymerase chain reaction. PGE(2) and AE-248, a selective EP(3) agonist, showed concentration-dependent potentiation of platelet aggregation induced by U46619, a TXA(2) receptor agonist, although PGE(2) alone could not induce aggregation. PGE(2) and AE-248 increased cytosolic calcium ion concentration ([Ca(2+)](i)), and AE-248 inhibited the forskolin-induced increase in cytosolic cAMP concentration ([cAMP](i)), suggesting G(i) coupling of EP(3). The potentiating effects of PGE(2) and AE-248 on platelet aggregation along with their effects on [Ca(2+)](i) and [cAMP](i) were absent in EP(3)(-/-) mice. In vivo, the bleeding time was significantly prolonged in EP(3)(-/-) mice. Moreover, when mice were challenged intravenously with arachidonic acid, mortality and thrombus formation in the lung were significantly reduced in EP(3)(-/-) mice. CONCLUSIONS: - PGE(2) potentiated platelet aggregation induced by U46619 via EP(3) by increasing [Ca(2+)](i), decreasing [cAMP](i), or both. This potentiating action of PGE(2) via EP(3) is essential in mediating both physiological and pathological effects of PGE(2) in vivo.

15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5↗
PubMed1999

Protease-activated receptors 1 and 4 mediate activation of human platelets by thrombin.

Because of the role of thrombin and platelets in myocardial infarction and other pathological processes, identifying and blocking the receptors by which thrombin activates platelets has been an important goal. Three protease-activated receptors (PARs) for thrombin -- PAR1, PAR3, and PAR4 -- are now known. PAR1 functions in human platelets, and the recent observation that a PAR4-activating peptide activates human platelets suggests that PAR4 also acts in these cells. Whether PAR1 and PAR4 account for activation of human platelets by thrombin, or whether PAR3 or still other receptors contribute, is unknown. We have examined the roles of PAR1, PAR3, and PAR4 in platelets. PAR1 and PAR4 mRNA and protein were detected in human platelets. Activation of either receptor was sufficient to trigger platelet secretion and aggregation. Inhibition of PAR1 alone by antagonist, blocking antibody, or desensitization blocked platelet activation by 1 nM thrombin but only modestly attenuated platelet activation by 30 nM thrombin. Inhibition of PAR4 alone using a blocking antibody had little effect at either thrombin concentration. Strikingly, simultaneous inhibition of both PAR1 and PAR4 virtually ablated platelet secretion and aggregation, even at 30 nM thrombin. These observations suggest that PAR1 and PAR4 account for most, if not all, thrombin signaling in platelets and that antagonists that block these receptors might be useful antithrombotic agents.

Adenosine Triphosphate↗