Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA structure”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources
PubMed1975

Formaldehyde as a probe of DNA structure. I. Reaction with exocyclic amino groups of DNA bases.

A comprehensive description is given of both the equilibrium and the kinetic aspects of the reaction of formaldehyde with the exocyclic amino groups of derivatives of adenine, cytosine, and guanine; the results extend previous data in the literature to the point where formaldehyde can now be used as a quantitative probe of DNA structure and dynamic behavior. The main results are: (i) the reaction product is proven (by isolation followed by nuclear magnetic resonance (NMR) spectroscopy) to be a hydroxymethyl group; (ii) a dihydroxymethyl adduct is shown to exist at high formaldehyde concentrations; (iii) equilibrium constants at 25 degrees for forming the monoadduct with adenine and cytosine compounds are about 12 (M-1), while those for forming the dihydroxymethyl adduct are about 0.4 (M-1); (iv) the standard enthalpies for forming the monoadducts with adenine and cytosine compounds are about minus 4 to minus 6 kcal/mol; (v) indirect evidence is presented suggesting that a monohydroxymethyl group on adenine or cytosine derivatives exists preferentially as that rotational isomer which blocks Watson-Crick hydrogen bonding; (vi) in derivatives of guanine, it is shown that the N-1 endocyclic imino group can react with formaldehyde, as well as the amino group, the overall equilibrium constant being about 6 (M-1); (vii) all rate constants are reported, as well as their response to temperature, pH, and various solvent additives known to perturb DNA structure; (viii) using a series of substituted anilines, a linear free energy relation is obtained between the logarithm of both the forward and the reverse rate constant for the formaldehyde reaction and the amine pK, over a range of 10-8 change in amie basicity; (ix) using this relation, the pK's for protonating the nucleoside amino groups are estimated to lie in the range of minus 2 to minus 4; (x) a reaction mechanism is proposed; and (xi) some implications of these results forpolynucleotide studies are discussed.

Adenine↗
PubMed1998

Activation of gene expression by a novel DNA structural transmission mechanism that requires supercoiling-induced DNA duplex destabilization in an upstream activating sequence.

We have previously demonstrated that integration host factor (IHF)-mediated activation of transcription from the ilvPG promoter of Escherichia coli requires a supercoiled DNA template and occurs in the absence of specific interactions between IHF and RNA polymerase. In this report, we describe a novel, supercoiling-dependent, DNA structural transmission mechanism for this activation. We provide theoretical evidence for a supercoiling-induced DNA duplex destabilized (SIDD) structure in the A + T-rich, ilvPG regulatory region between base pair positions +1 and -160. We show that the region of this SIDD sequence immediately upstream of an IHF binding site centered at base pair position -92 is, in fact, destabilized by superhelical stress and that this duplex destabilization is inhibited by IHF binding. Thus, in the presence of IHF, the negative superhelical twist normally absorbed by this DNA structure in the promoter distal half of the SIDD sequence is transferred to the downstream portion of the SIDD sequence containing the ilvPG promoter site. This IHF-mediated translocation of superhelical energy facilitates duplex destabilization in the -10 region of the downstream ilvPG promoter and activates transcription by increasing the rate of open complex formation.

Bacterial Proteins↗
PubMed1971

Heterochromatin, satellite DNA, and cell function. Structural DNA of eucaryotes may support and protect genes and aid in speciation.

With the assumption that a portion that comprises some 10 percent of the genomes in higher organisms cannot be without a raison d'être, an extensive review led us to conclude that a certain amount of constitutive heterochromatin is essential in multicellular organisms at two levels of organization, chromosomal and nuclear. At the chromosomal level, constitutive heterochromatin is present around vital areas within the chromosomes. Around the centromeres, for example, heterochromatin is believed to confer protection and strength to the centromeric chromatin. Around secondary constrictions, heterochromatic blocks may ensure against evolutionary change of ribosomal cistrons by decreasing the frequency of crossing-over in these cistrons in meiosis and absorbing the effects of mutagenic agents. During meiosis heterochromatin may aid in the initial alignment of chromosomes prior to synapsis and may facilitate speciation by allowing chromosomal rearrangement and providing, through the species specificity of its DNA, barriers against cross-fertilization. At the nuclear level of organization, constitutive heterochromatin may help maintain the proper spatial relationships necessary for the efficient operation of the cell through the stages of mitosis and meiosis. In the unicellular procaryotes, the presence of a small amount of genetic information in one chromosome obviates the need for constitutive heterochromatin and a nuclear membrane. At higher levels of organization, with an increase in the size of the genome and with evolution of cellular and sexual differentiation, the need for compartmentalization and structural components in the nucleus became imminent. The portion of the genome that was concerned with synthesis of ribosomal RNA was enlarged and localized in specific chromosomes, and the centromere became part of each chromosome when the mitotic spindle was developed in evolution. Concomitant with these changes in the genome, repetitive sequences in the form of constitutive heterochromatin appeared, probably as a result of large-scale duplication. The repetitive DNA's were kept through natural selection because of their importance in preserving these vital regions and in maintaining the structural and functional integrity of the nucleus. The association of satellite (or highly repetitive) DNA with constitutive heterochromatin is understandable, since it stresses the importance of the structural rather than transcriptional roles of these entities. Nuclear satellite DNA's have one property in common despite their species specificity, namely heterochromatization. In this sense the apparent species specificity of satellite DNA may be the result of natural selection for duplicated short polynucleotide segments that are nontranscriptional and can be utilized in specific structural roles.

Animals↗
PubMed2004

Impact of intrinsic DNA structure on processing of plasmids for gene therapy and DNA vaccines.

Several non-Watson Crick DNA structures have been discovered to date, which may be incorporated into future plasmid constructs for gene therapy and DNA vaccine products. In this study, intrinsic DNA structures were included at a defined point in a 2.9 kb plasmid, and their effects on cell growth rate, total plasmid yield, and topology (i.e. the relative proportions of supercoiled plasmid, open circular and linear forms), were determined. The stability of the inserted sequences were assessed using gel electrophoresis. Z-DNA was shown to be unstable in a batch Escherichia coli DH1 production system grown in complex medium. Encouragingly other sequences studied (triplex, bend and quadruplex) did not cause spontaneous deletions, and no detrimental effect was found on growth rate or on total plasmid yield; indicating that such sequences could be included in future DNA products without any detrimental effect on plasmid yields; although the intra molecular triplex studied significantly decreased the proportion of supercoiled species.

Base Sequence↗
PubMed2000

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.

Base Pairing↗
PubMed1996

Binding of the antitumor drug nogalamycin to bulged DNA structures.

Defects in DNA, e.g., unpaired/bulged nucleotides, are repaired by specific repair enzymes. Understanding the dynamics and structure of DNA defects is important. Two DNA heptamers, CTb-GTACG and CGTACTbG, each containing a bulged T nucleotide embedded in the CpG step, have been studied by NMR. Both duplexes are significantly destabilized, and the bulged T remains intrahelical. Binding of the anthracycline antitumor antibiotic nogalamycin (Ng) to these two heptamers stabilizes the duplex structure. The solution structures of the 2:1 complexes of Ng-d(CTbGTACG) and Ng-d(CGTACTbG) have been determined by the NOE-restrained refinement procedure. In both structures the elongated aglycon of Ng is intercalated between base pairs, and the nogalose and aminoglucose lie in the minor and major grooves, respectively. The bulged T behaves differently upon the binding of Ng. In Ng-CTbGTACG wobble G6:Tb base pairs are formed, leaving two dangling 5'-C1 nucleotides; whereas in Ng-CGTACTbG weak C1:Tb base pairs are formed, leaving two dangling 3'-G6 nucleotides. Thus Ng induces the bulged T and the opposing base in the duplex to stack on the aglycon and causes the base next to Tb to unpair, mimicking a "frame-shift". Such structural rearrangement of a bulged DNA site due to the binding of an intercalator drug may perturb the recognition of DNA defects by repair enzymes or may cause mutation during replication.

Antibiotics, Antineoplastic↗
PubMed1994

Association of a host DNA structure with retroviral integration sites in chromosomal DNA.

Integration of retroviral genomes is a site-specific process with respect to the virus but not the host genome. Numerous chromosomal sites and various sequences can be used as targets. Nevertheless, preferential regions and integration patterns have been observed. Using a functional assay, we investigated if host structural DNA elements could be associated with retroviral integration sites. The results were that 9 of 10 distinct retroviral integration events occurred in close proximity of structural elements behaving like intrinsically bent DNA.

Animals↗
PubMedDate not supplied

Structural DNA profiles: single sequence queries.

Structural DNA profiles use the structural properties of the constituent octamers either to observe any characteristics of a single sequence that are unusual (a single sequence query) or to visualize a pattern common to a set of sequences (a multiple sequence query). They are an aid in understanding structural reasons for functional DNA activity. Profiles that answer single sequence queries are introduced and Profile Manager (a software application developed to automate profile generation) is presented. Two sequences that are similar by their nucleotide composition but are known to be very different by structure are analyzed, resulting in useful illustrations that agree with the experimental nuclear magnetic resonance structures.

Animals↗
PubMed2005

How sequence defines structure: a crystallographic map of DNA structure and conformation.

The fundamental question of how sequence defines conformation is explicitly answered if the structures of all possible sequences of a macromolecule are determined. We present here a crystallographic screen of all permutations of the inverted repeat DNA sequence d(CCnnnN6N7N8GG), where N6, N7, and N8 are any of the four naturally occurring nucleotides. At this point, 63 of the 64 possible permutations have been crystallized from a defined set of solutions. When combined with previous work, we have assembled a data set of 37 single-crystal structures from 29 of the sequences in this motif, representing three structural classes of DNA (B-DNA, A-DNA, and four-stranded Holliday junctions). This data set includes a unique set of amphimorphic sequence, those that crystallize in two different conformations and serve to bridge the three structural phases. We have thus constructed a map of DNA structures that can be walked through in single nucleotide steps. Finally, the resulting data set allows us to dissect in detail the stabilization of and conformational variations within structural classes and identify significant conformational deviations within a particular structural class that result from sequence rather than crystal or crystallization effects.

Base Sequence↗
PubMed1995

Low molecular weight peptide from calf's liver mitochondrial DNA: structure and effect on DNA as a template.

A peptide fraction from the mitochondrial DNA of calf's liver was isolated using Drouin's method (1). This peptide fraction, which was extracted at pH 9.5 from an extensively purified mitochondrial DNA (2), has been shown to exert an in vitro regulatory role on the transcription and duplication activity of DNA (3). The same fraction also binds with mitochondrial DNA with a high affinity constant and stabilizes DNA from calf's thymus against thermal denaturation. The peptides from mitochondrial DNA have been subfractionated by fingerprinting-like techniques and one of them has been sequenced.

Amino Acid Sequence↗
PubMed1988

Determination of DNA structures by NMR and distance geometry techniques: a computer simulation.

Computer simulations have been performed to determine how accurately and precisely structures of DNA oligomers can be generated from distance data obtained from two-dimensional NMR experiments. A hexamer fragment d(CGAATT) of the Dickerson dodecamer [Drew, H.R., Wing, R.M., Takano, T., Broka, C., Tanaha, S., Itakura, K. & Dickerson, R.E. (1981) Proc. Natl. Acad. Sci. USA 78, 2179-2183] was used as the model structure in these simulations. Protons were added to the coordinates of the original x-ray structure, which was then subjected to a regularization procedure to minimize deviations from standard bond lengths and bond angles. The proton-proton distances normally observed in NMR experiments were measured from this regularized target structure and used as input for a distance geometry algorithm. Distance geometry structures were generated from two distance sets, one with essentially exact distances (+/- 0.005 A) and one set with a precision (+/- 0.2 A) that simulates an optimal NMR experiment. The results of these calculations were used to judge how accurately and precisely the following helical parameters could be reproduced from this simulated NMR distance data: helical twist, helical rise, dislocation, roll, tilt, glycosidic angle, delta torsion angle, and pseudorotation angle. These data provide a basis from which to judge the quality of DNA structures produced from real NMR experiments.

Base Sequence↗
PubMed1989

Structural polymorphism of homopurine--homopyrimidine sequences: the secondary DNA structure adopted by a d(GA.CT)22 sequence in the presence of zinc ions.

In this paper, we have analysed the conformational behaviour shown by the homopurine--homopyrimidine alternating d(GA.CT)22 sequence cloned into SV40. Our results show that, in the presence of zinc ions, the d(GA.CT)22 sequence adopts an altered secondary DNA structure (*H-DNA) which differs from either B-DNA or H-DNA. Formation of *H-DNA is facilitated by negative supercoiling and does not appear to require base protonation, since it is induced at neutral pH by approximately 0.4 mM ZnCl2. The patterns of OsO4 and DEPC modification obtained in the presence of zinc are compatible with a homopurine--homopurine--homopyridimine triplex, though other structural models for *H-DNA are also possible. The hypersensitivity to S1-cleavage of the d(GA.CT)22 sequence is reinterpreted in terms of the equilibria between the B-, H- and *H-forms of the sequence. These results reveal the high degree of structural polymorphism shown by homopurine-homopyrimidine sequences. Its biological relevance is discussed.

Animals↗
PubMed2002

Triplet repeat DNA structures and human genetic disease: dynamic mutations from dynamic DNA.

Fourteen genetic neurodegenerative diseases and three fragile sites have been associated with the expansion of (CTG)n (CAG)n, (CGG)n (CCG)n, or (GAA)n (TTC)n repeat tracts. Different models have been proposed for the expansion of triplet repeats, most of which presume the formation of alternative DNA structures in repeat tracts. One of the most likely structures, slipped strand DNA, may stably and reproducibly form within triplet repeat sequences. The propensity to form slipped strand DNA is proportional to the length and homogeneity of the repeat tract. The remarkable stability of slipped strand DNA may, in part, be due to loop-loop interactions facilitated by the sequence complementarity of the loops and the dynamic structure of three-way junctions formed at the loop-outs.

DNA↗
PubMed1988

Specific binding of cruciform DNA structures by a protein from human extracts.

A gel electrophoresis binding assay has been used to probe extracts from cultured human lymphoblasts for proteins that bind cruciform structures in duplex DNA. Proteins have been detected that form complexes with synthetic X- and Y-junctions. Several lines of evidence suggest that binding is specific for DNA structure rather than sequence: (1) X- and Y-structures were bound whereas linear duplexes containing identical DNA sequences were not, (2) Binding occurred with equal efficiency to two X-junctions that were constructed from DNA strands of different sequence, (3) One X-junction successfully competed with another for binding whereas linear duplex DNA did not; and (4) protein-DNA complexes were observed at probe:non-specific competitor DNA ratios of 1:10,000.

Base Sequence↗
PubMed2001

G-quadruplex DNA structures--variations on a theme.

To be functional, nucleic acids need to adopt particular three-dimensional structures. For a long time DNA was regarded as a rigid and passive molecule with the sole purpose to store genetic information, but experimental data has now accumulated that indicates the full dynamic repertoire of this macromolecule. During the last decade, four-stranded DNA structures known as G-quadruplexes, or DNA tetraplexes, have emerged as a three-dimensional structure of special interest. Motifs for the formation of G-quadruplex DNA structures are widely dispersed in eukaryotic genomes, and are abundant in regions of biological significance, for example, at telomeres, in the promoters of many important genes, and at recombination hotspots, to name but a few in man. Here I explore the plethora of G-quadruplex DNA structures, and discuss their possible biological functions as well as the proteins that interact with them.

Animals↗
PubMed2001

A common feature shared by bent DNA structures locating in the eukaryotic promoter region.

Eukaryotic promoters often contain a bent DNA structure, suggesting that this structure plays some role in transcription. To reveal the role, we need more information on the promoters that contain or flank a bent DNA structure. In this study, we collected such promoters by the following approach: we first isolated human genomic DNA fragments that contained at least one bent DNA structure, then shotgun cloned them into a promoter trap vector, screened DNA fragments that functioned as a promoter, and finally found the promoters of interest by determining the bent DNA locus and the region expressing promoter activity. From 1,187 recombinant plasmids, we isolated 51 that showed promoter activity. Structural and functional analyses of randomly selected 10 clones with inserts of 548-913 bp demonstrated 11 sequences that could drive transcription. Unexpectedly, all of these clones met our purpose: i.e., each segment that showed a promoter activity (67-179 bp) was very close to the bent DNA structure (spanning about 150 bp in all clones), and in some cases overlapped it. More interestingly, these bent DNA structures all had a superhelical writhe. We propose a hypothesis that in the bent-DNA-containing eukaryotic promoters. bent DNA organizes local chromatin infrastructure appropriately for transcription initiation.

Animals↗