Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.
Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.