SEARCH · Search PubMed

Results for “Chorionic Villi Sampling”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 703 records · Page 39Linked to original sources

PubMedDate not supplied

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.

Chorionic Villi Sampling↗

PubMed1989

Pregnancy loss in a small chorionic villus sampling series.

Two previous reports have suggested that the pregnancy loss rate with chorionic villus biopsy is high in the initial 100 to 300 cases. In the initial 211 cases of this study, the total pregnancy loss rate (7.1%) and losses not attributed to induced abortion or cytogenetic abnormality (2.8%) do not support this contention.

Abortion, Spontaneous↗

PubMed2002

Teratogen-induced limb defects.

Limb abnormalities are one of the most common and visible phenotypic effects of several human teratogens. The specific effects are different for most teratogens and include effects on limb morphogenesis (thalidomide, warfarin, phenytoin, valproic acid) and the effect of vascular disruption on a limb that had formed normally (misoprostol, chorionic villus sampling, and phenytoin). Either duplication (preaxial polydactyly of hands and feet) or deficiency (absence of thumb) is a common effect of thalidomide; no other human teratogen identified to date has this effect on the developing limb. Procedures during pregnancy, including chorionic villus sampling and dilation and curettage, produce defects of vascular disruption. For common exposures, such as alcohol and cocaine, it has been difficult to confirm objectively the exposure during embryogenesis and to ascribe specific limb defects that are produced. The molecular basis for the limb defects produced by the recognized human teratogens remains unknown.

Chorionic Villi Sampling↗

PubMed2004

Preimplantation genetic diagnosis for beta-thalassaemia: the Sardinian experience.

OBJECTIVES: To report the experiences on preimplantation genetic diagnosis (PGD) in couples at risk for beta-thalassaemia in Sardinia. METHODS: 23 couples at risk for beta-thalassaemia were included in the PGD programme with a total of 42 cycles performed. Among these, 11 couples were fertile, while the remaining 12 had associated fertility problems. In vitro Fertilization (IVF), PGD and prenatal genetic molecular confirmation protocols and results are reported. RESULTS: All the patients followed the protocol of ovarian stimulation, oocyte retrieval, intracytoplasmic sperm injection (ICSI), embryo biopsy and genetic analysis. A total of 272 oocytes were fertilized in the regular way, and embryo biopsy was performed on 202 embryos. Out of these 202 embryos, 192 (95%) were successful. The genetic diagnosis was performed on 150 embryos (78.1%). Ninety-eight were identified as unaffected and 75 were transferred in 31 cycles. In the infertile patient group, two biochemical pregnancies (11.1% per transfer), in the fertile patient group, four clinical pregnancies, two twin and two singleton pregnancies (30.8% per transfer), were obtained. The genetic molecular results were confirmed in all pregnancies by first-trimester chorionic villus sampling (CVS). CONCLUSION: Our study shows that PGD for beta-thalassaemia is an available procedure for couples who wish to avoid termination of pregnancy, except in cases where the IVF cycle efficiency is very poor.

Biopsy↗

PubMed1994

[Is chorionic biopsy a dangerous and outdated method?].

The authors evaluated the risk of chorion biopsy used within the framework of prenatal diagnosis of the foetus. The incidence of abortions following transabdominal CVS (0.6%) did not differ from abortions after amniocentesis in the second trimester (0.5%). In a group of 1002 diagnostic biopsies of the chorion the authors did not record in the born infants reduction deformities of the extremities. Chorion biopsies were performed in 98% between the 10th and 12th week of gestation. The incidence of mosaicism--1.59%--was not significantly higher than reported in the literature. The authors recommend: to increase the size of the sample of chorion tissue by the use of a manual aspirator, the use of a 30 ml plastic syringe or the double needle method. They consider CVS a suitable method which serves the diagnosis of IUGR and the prenatal diagnosis of the foetus before the 20th week of gestation when cordocentesis involves risk.

Abortion, Spontaneous↗

PubMed1999

Sex chromosome pentasomy (49,XXXXY) presenting as cystic hygroma at 16 weeks' gestation.

The pentasomy 49,XXXXY is one of the rarest sex chromosome defects, occurring with an estimated incidence of 1 in 85 000 male births. This condition is associated with pre- and postnatal growth deficiency, severe mental retardation, hypogenitalism, and other skeletal, facial and cardio-vascular anomalies. In this report we present such a case diagnosed prenatally by chorionic villus sampling after the ultrasound detection of cystic hygroma at 16 weeks' gestation. Although the prenatal diagnosis of cystic hygroma and its association with aneuploidy has been documented in numerous reports, sex chromosome aneuploidy, other than the 45,X karyotype, accounts for only 0.3 per cent of cases.

Adult↗

PubMed1994

Prenatal diagnosis of fragile X syndrome: management of the male fetus with a premutation.

Direct detection of the fragile X mutation by DNA analysis has greatly simplified prenatal diagnosis of this disease. However, women carrying a fragile X premutation may pass their expanded trinucleotide repeat to sons without expansion to a full mutation. Such sons are predicted to be intellectually normal. In this situation, the accuracy with which the fetal status can be inferred from analysis of chorionic villus sample (CVS) DNA is unclear. We describe such a case, in which it was felt necessary to proceed to fetal blood sampling despite technically unambiguous DNA results from the CVS. The lack of prospective data means that this dilemma may be expected to recur over the next few years when performing prenatal diagnosis on fragile X premutation carriers.

Adult↗

PubMed1997

Prenatal diagnosis of Prader-Willi syndrome using PW71 methylation analysis--uniparental disomy and the significance of residual trisomy 15.

Chorionic villus sampling (CVS) was performed on a 38-year-old woman at 10 weeks' gestation for advanced maternal age. Two long-term cultures showed true mosaicism of cells with a normal karyotype and cells with trisomy 15. Follow-up amniocentesis showed only cells with a normal karyotype. Methylation analysis of amniocyte DNA using the probe PW71B showed a result consistent with a diagnosis of Prader-Willi syndrome. This result was confirmed using dinucleotide microsatellite polymorphism analysis, which showed that the fetus had maternal uniparental heterodisomy for chromosome 15. This report describes the use of methylation analysis for prenatal diagnosis of uniparental disomy 15 but also indicates that there is some doubt regarding the methylation status of all amniocyte samples, as one of nine controls showed hypomethylation. Fetal skin was found to show low-level mosaicism for trisomy 15, indicating a prolonged persistence of mosaic trisomy 15, which raises questions regarding the management of pregnancies found to be mosaic for trisomy 15.

Adult↗

PubMed1991

Completed follow-up of 1,000 consecutive transcervical chorionic villus samplings performed by a single operator.

Completed follow-up data on 1,000 patients undergoing transcervical chorionic villus sampling (CVS) performed by a single operator at the Royal Hospital for Women is presented. Prior to the introduction of CVS, approximately 750 amniocenteses were performed annually in this unit. Over the past 5 years the total number of patients having CVS or amniocentesis has increased by 1/3 and almost 1/2 of procedures are now done by CVS. We have persisted with the transcervical route believing that once the learning curve is past, this route compares favourably with the transabdominal method in loss rate and perinatal outcome. We feel the transcervical approach is better tolerated by our patients and that less procedural difficulties are encountered. With increasing operator experience the total fetal loss rate to 20 weeks' gestation in our series declined to 2.1% and late complications were no more frequent than expected. In 98.4% of patients, sufficient villi were obtained for analysis. Culture failure was extremely uncommon, occurring only twice in our series. In 1.5% of patients, a follow-up amniocentesis was required, which compares favourably with other published series. It appears that many units abandoned the transcervical route before loss rates were stabilized. In units where transcervical CVS is still performed the transabdominal route is also utilized. The reverse is not true. The authors feel that both procedures have a role in modern antenatal diagnosis.

Abortion, Induced↗

PubMed1989

Trisomy 16 detected at chorion villus sampling.

Trisomy 16 detected at chorion villus sampling (CVS) may reflect the placental but not the fetal karyotype. We describe a case in which the pregnancy continued until intrauterine death at 37 weeks. Cytogenetic study of two placental samples showed 47, + 16 and 46,XX; the fetus was morphologically grossly normal, but fetal tissue culture was unsuccessful. Conservative management may be appropriate when trisomy 16 is detected at CVS and the pregnancy is normal ultrasonographically.

Adult↗

PubMed2001

Denaturing high-performance liquid chromatography (DHPLC)-based prenatal diagnosis for tuberous sclerosis.

Tuberous sclerosis (TSC) is a frequent autosomal-dominant condition (affecting 1 in 6000 individuals) caused by various mutations in either the hamartin (TSC1) or the tuberin gene (TSC2). This allelic and non-allelic heterogeneity makes genetic counseling and prenatal diagnosis difficult, especially as a significant proportion of TSC cases are due to de novo mutations. For this reason the identification of the disease causing mutation is mandatory for accurate counseling, yet current mutation detection methods such as single-strand conformation polymorphism (SSCP) or denaturing gradient gel electrophoresis (DGGE) are labor intensive with limited detection efficiency. Denaturing high-performance liquid chromatography (DHPLC) is a high-throughput, semi-automated mutation detection system with a reported mutation detection rate close to 100% for PCR fragments of up to 800 bp. We used a recently described DHPLC assay allowing the efficient detection of mutations in TSC1 to analyze the DNA extracted from a chorion villus sample in order to perform a prenatal diagnosis for TSC. The fetus was found not to have inherited the deleterious mutation and the DHPLC diagnosis was confirmed by haplotype analysis. This represents the first DHPLC-based prenatal diagnosis of a genetic disease.

Chorionic Villi↗

PubMed1991

Molecular analysis and chorionic villus sampling (CVS): opportunities for rapid prenatal diagnosis in the military.

Prior to recent advances in the field of molecular biology, prenatal diagnosis of hemoglobinopathies was accomplished by direct analysis of the gene product(s) in samples obtained by fetoscopy or, more recently, percutaneous umbilical blood sampling. The use of the polymerase chain reaction enables quicker diagnosis than with indirect or cumbersome Southern blot techniques. This case, reporting a couple at risk for fetal sickle cell disease, is a model for rapid prenatal diagnosis and demonstrates the capabilities which exist in the military health care referral system. Within 24 hours of a couple's presentation for consultation and accomplishment of chorionic villus sampling (CVS), preliminary results of both cytogenetic and sickle cell status of an at-risk fetus were determined. Final analysis was accomplished by 48 hours. The combination of early referral, early sampling by CVS, and application of advances in DNA laboratory technologies offers tremendous improvements for care heretofore unavailable as a complete "package" in the military. The implications and limitations for prenatal testing for single gene disorders within the military medical health care system will be discussed.

Adult↗

PubMed1999

Molybdenum cofactor deficiency: first prenatal genetic analysis.

Molybdenum cofactor (MoCo) deficiency leads to a combined deficiency of the molybdo-enzymes sulphite oxidase, xanthine dehydrogenase and aldehyde oxidase. No therapy is known for this rare disease, which results in neonatal seizures and other neurological symptoms identical to sulphite oxidase deficiency. It is inherited autosomal-recessively and leads to early childhood death. Prenatal diagnosis has been performed since 1983 by the measurement of sulphite oxidase activity, but no enzymatic carrier diagnosis is possible. The human genes necessary for MoCo biosynthesis have recently been cloned and mutations in the bicistronic MOCS1 gene could be identified in most European patients. In a Danish family we have now performed enzymatic and molecular genetic analysis in parallel after chorionic villus sampling. The sulphite oxidase activity in uncultured CVS material was found to be normal. A MOCS1 splice site mutation, found homozygous in the affected patient, was found in a heterozygous state in cultured chorionic cells. This confirmed that the fetus was not affected, since heterozygous carriers of a MoCo deficiency allele do not display any symptoms.

Carbon-Carbon Lyases↗

PubMed1989

Early prenatal diagnosis of 21-hydroxylase deficiency using amniotic fluid 17-hydroxyprogesterone determination and DNA probes.

The results of early prenatal diagnoses of congenital adrenal hyperplasia are reported. The determination of 17-hydroxyprogesterone values in amniotic fluid taken transabdominally at 11 weeks of gestation enabled prenatal diagnosis of congenital adrenal hyperplasia due to 21-hydroxylase (21-OH) deficiency. There is a clear-cut difference between normal and pathological values at that time of pregnancy. This method of diagnosis can be combined with genotyping of the fetus by HLA-DNA probes on chorionic villus sampling or can be used alone. Prenatal diagnosis with a 21-OH probe is possible when a preliminary study has demonstrated that the index case is homozygous for the deletion.

17-alpha-Hydroxyprogesterone↗

PubMed1990

Clinical applications of a new Fujinon operating fiberoptic hysteroscope.

A soft and rigid operating fiberoptic hysteroscope (4.8 mm outer diameter) was developed by Lin et al., with the support of a Fuji Photo Optical Company. The functional part of the telescope consists of three sections: a soft, flexible front section, a rigid rotating middle section, and a semirigid, self-retaining rear section. With these features, the intrauterine target can be approached easily, directly, and closely, usually without cervical dilation or anesthesia and with the operator in a comfortable position. Clinical applications were divided into four groups: (1) directed biopsy, (2) transcervical tubocornual recanalization for the management of cornual occlusion, (3) hysteroscopic chorionic villus sampling, and (4) the removal of lost IUDs. Experience with 153 procedures is presented. No complications were encountered. The authors conclude that this new hysteroscope is a very useful tool for the treatment of intrauterine lesions, used easily in the office and the operating room alike.

Adult↗

PubMed1995

Genetic analysis prior to selective fetal reduction in multiple pregnancy: technical aspects and clinical outcome.

Multiple pregnancies resulting from ovarian stimulation are at a higher risk of carrying at least one fetus affected by Mendelian or chromosomal anomalies, the incidence of which is directly related to the order of multiples. Genetic analysis before fetal reduction was offered to both high- and low-risk pregnant women carrying two or more fetuses after ovulation induction. Chorionic villus sampling (CVS) and fetal reduction were achieved by transabdominal needling. The use of short-term culture, the polymerase chain reaction and fresh tissue enzymatic analyses have made it possible for genetic diagnosis to be available in a few days. A total of 100 patients had multifetal pregnancy reduction performed by a single operator; all of them completed pregnancy and none was lost at follow-up. The total fetal loss before 24 weeks was 7% and no statistically significant relationship was found with the final number of fetuses and CVS. Perinatal losses (3.9%) were only present in the series with a final number of two fetuses. Pregnancy duration and birthweight were significantly higher in singletons than in twins, but were not related to CVS. The rate of chromosomal disorders was higher (7.2%) in the study series than in singleton pregnancies not undergoing fetal reduction. Diagnostic error due to incorrect sampling was reported in 1.5% of cases. These data support fetal reduction as a valuable strategy to improve the outcome of multiple pregnancy. The outcome of pregnancies reduced to singletons was significantly better than of those reduced to twins, and was not related to CVS.(ABSTRACT TRUNCATED AT 250 WORDS)

Adult↗

PubMed1990

Chorionic chromosome abnormalities and intrauterine growth retardation.

Chorion, placental membranes, and embryo all arise from the same fertilized oocyte; therefore, chorionic cells are presumed to reflect fetal chromosome status. Progenitor cells of the embryo are selected from the blastocyst, however, at a very early stage of development. If mitotic nondisjunction were to occur in one of the blastocyst cells destined to become trophoblast, the resultant abnormal cell line would be restricted to extraembryonic tissues. Indeed, chromosome mosaicism confined to the placenta has been found repeatedly in diagnostic chorionic villus sampling, and occasionally in third trimester placentas. Cytogenetically abnormal placental cells are morphologically and perhaps functionally abnormal. Such aberrations might result in deficient oxygen or nutrient supply to the fetus, causing intrauterine growth retardation (IUGR). To investigate this hypothesis we studied chorion and cord blood samples after delivery from 11 confirmed IUGR pregnancies. A minimum of 10 cells were analyzed from each cord blood and chorion specimen (mean number of cells from cord blood = 27; from chorion = 17). None of the cases showed true mosaicism for a hyperdiploid line. We conclude from this preliminary study that few, if any, cases of IUGR are likely to be due to chorionic mosaicism.

Adult↗

PubMed2007

Prenatal diagnosis of muscle-eye-brain disease.

OBJECTIVES: To present a family in which it was possible to perform prenatal diagnosis for the recessively inherited muscle-eye-brain disease (MEB) using linkage analysis. METHODS: Linkage analysis and direct sequencing of the POMGNT1 gene were carried out in a Turkish MEB family with one affected individual. Fetal DNA was obtained from an ongoing pregnancy by chorionic villus sampling (CVS). RESULTS: Both linkage analysis of the POMGNT1/1p32-p34 region and direct sequencing for the novel familial mutation (R605H) demonstrated that the fetus did not have MEB. CONCLUSION: We report the first case of prenatal diagnosis in MEB by molecular genetic analysis.

Adolescent↗