Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PLASMODIUM”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 685 records · Page 38Linked to original sources
PubMed2004

New selectable markers and single crossover integration for the highly versatile Plasmodium knowlesi transfection system.

Plasmodium knowlesi provides a highly versatile transfection system for malaria, since it enables rapid genetic modification of the parasite both in vivo as well as in vitro. However, it is not possible to perform multiple genetic manipulations within one parasite line because of a lack of selectable markers. In an effort to develop additional selectable markers for this parasite, positive and negative selectable markers that have recently been successfully used in Plasmodium falciparum were tested. It was shown that the positive selectable markers human dihydrofolate reductase (hdhfr), blasticidin S deaminase (bsd) and neomycin phosphotransferase II (neo) all conferred drug resistance to P. knowlesi when introduced as episomes. The plasmid containing the hdhfr selectable marker was not only successfully introduced as circular form, but also as linear fragment, demonstrating for the first time single crossover integration in P. knowlesi. Thymidine kinase was tested for its potential as negative selectable marker and it was shown that recombinant P. knowlesi parasites expressing thymidine kinase from episomes were highly sensitive to ganciclovir compared to wild-type P. knowlesi. The availability of new positive selectable markers and a strong candidate for a negative selectable marker for P. knowlesi, in combination with the opportunity to perform targeted single crossover integration in P. knowlesi, significantly increases the flexibility of this transfection system, making it one of the most versatile systems available for Plasmodium.

Aminohydrolases↗
PubMed2004

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.

3' Untranslated Regions↗
PubMed2005

Multiple replication origins within the inverted repeat region of the Plasmodium falciparum apicoplast genome are differentially activated.

The 35 kb circular genome (plDNA) of the Plasmodium falciparum apicoplast replicates by the bidirectional ori/D-loop mechanism. PlDNA replication was previously shown to initiate within the inverted repeat (IR) region of the apicoplast genome [Williamson DH, Preiser PR, Moore PW, McCready S, Strath M, Wilson RJM (Iain). The plastid DNA of the malaria parasite Plasmodium falciparum is replicated by two mechanisms. Mol Microbiol 2002;45:533-42; Singh D, Chaubey S, Habib S. Replication of the Plasmodium falciparum apicoplast DNA initiates within the inverted repeat region. Mol Biochem Parasitol 2003;126:9-14.] and the presence of at least two ori within each segment of the IR was postulated. Using 5' end-labelled nascent DNA as probe, we now demonstrate the utilization of several putative ori located within the IR for plDNA replication. Quantitation of signals obtained for different segments of the IR as well as determination of the number of molecules emanating from two ori regions by competitive PCR analysis indicated differential strengths of ori during plDNA replication prior to schizogony.

Animals↗
PubMed2005

Expression and characterization of the ATP-binding domain of a malarial Plasmodium vivax gene homologous to the B-subunit of the bacterial topoisomerase DNA gyrase.

We have previously reported the presence of a DNA gyrase-like topoisomerase activity associated with the 35kb apicoplast DNA in the malarial parasite Plasmodium falciparum [Weissig V, Vetro-Widenhouse TS, Rowe TC. Topoisomerase II inhibitors induce cleavage of nuclear and 35kb plastid DNAs in the malarial parasite Plasmodium falciparum. DNA Cell Biol 1997;16:1483]. Sequences encoding polypeptides homologous to both the A and B subunits of bacterial DNA gyrase have been identified in the genome sequence of P. falciparum among data produced by the Malaria Genome Consortium and the University of Florida Malaria Gene Sequence Tag Project. Based on these findings, we have cloned and expressed a region of the Plasmodium vivax GyrB gene encoding a 43kDa polypeptide homologous to the ATP-binding domain of Escherichia coli DNA gyrase. The 43kDa PvGyrB polypeptide was found to have intrinsic ATPase activity with a K(m) of 0.27mM and a k(cat) of 0.051s(-1). The PvGyrB ATPase was also sensitive to the bacterial DNA gyrase inhibitor coumermycin. The implications of these findings are discussed.

Adenosine Triphosphate↗
PubMed2006

Genome-scale protein expression and structural biology of Plasmodium falciparum and related Apicomplexan organisms.

Parasites from the protozoan phylum Apicomplexa are responsible for diseases, such as malaria, toxoplasmosis and cryptosporidiosis, all of which have significantly higher rates of mortality and morbidity in economically underdeveloped regions of the world. Advances in vaccine development and drug discovery are urgently needed to control these diseases and can be facilitated by production of purified recombinant proteins from Apicomplexan genomes and determination of their 3D structures. To date, both heterologous expression and crystallization of Apicomplexan proteins have seen only limited success. In an effort to explore the effectiveness of producing and crystallizing proteins on a genome-scale using a standardized methodology, over 400 distinct Plasmodium falciparum target genes were chosen representing different cellular classes, along with select orthologues from four other Plasmodium species as well as Cryptosporidium parvum and Toxoplasma gondii. From a total of 1008 genes from the seven genomes, 304 (30.2%) produced purified soluble proteins and 97 (9.6%) crystallized, culminating in 36 crystal structures. These results demonstrate that, contrary to previous findings, a standardized platform using Escherichia coli can be effective for genome-scale production and crystallography of Apicomplexan proteins. Predictably, orthologous proteins from different Apicomplexan genomes behaved differently in expression, purification and crystallization, although the overall success rates of Plasmodium orthologues do not differ significantly. Their differences were effectively exploited to elevate the overall productivity to levels comparable to the most successful ongoing structural genomics projects: 229 of the 468 target genes produced purified soluble protein from one or more organisms, with 80 and 32 of the purified targets, respectively, leading to crystals and ultimately structures from one or more orthologues.

Animals↗
PubMed2004

Targeting Plasmodium host cells: survival within hepatocytes.

Upon entering their host, Plasmodium sporozoites travel directly to the liver. Once there, they migrate through several hepatocytes before they infect a final one. During migration, sporozoites breach the plasma membrane of traversed hepatocytes, but to infect they must form a parasitophorous vacuole, in which the intra-hepatic form of the parasite grows and multiplies. During this period there is a remarkable parasite multiplication, but little is known about the requirements and strategies that are developed to be successful. Hepatocyte growth factor and its receptor on hepatocytes might enhance early Plasmodium development within these cells. We anticipate that this might be the basis for further studies on host-cell requirements for Plasmodium development.

Animals↗
PubMed2005

A glycine-cleavage complex as part of the folate one-carbon metabolism of Plasmodium falciparum.

The glycine-cleavage complex (GCV) and serine hydroxymethyltransferase represent the two systems of one-carbon transfer that are employed in the biosynthesis of active folate cofactors in eukaryotes. Although the understanding of this area of metabolism in Plasmodium falciparum is still at an early stage, we discuss evidence that genes and transcription products of the GCV are present and expressed in this parasite. The potential role of the GCV and its relevance to the life cycle and pathogenesis of the malaria erythrocytic stages are also considered. According to its expression profile, the GCV seems to be particularly active in gametocytes. The GCV enzyme dihydrolipoamide dehydrogenase has two isoforms encoded by two different genes. It has been demonstrated recently that both genes are functional, with one of them identified as being part of a pyruvate dehydrogenase complex that is present exclusively in the apicoplast of Plasmodium species. The other isoform probably forms part of the Plasmodium GCV. The GCV is the first enzyme complex involved in folate metabolism in this parasite that can be assumed, with a good degree of certainty, to be located in the mitochondria.

Amino Acid Oxidoreductases↗
PubMed2005

Can mosquitoes help to unravel the community structure of Plasmodium species?

There has been a recent revival in attempts to understand changes in patterns of abundance of Plasmodium spp. that infect humans. This has been driven by the purportedly beneficial effects of co-infection on clinical pathology and the recognition of Plasmodium vivax as a public health problem in its own right. In contrast to the attention given to mixed-species infections in humans, parasite infections and interactions within the mosquito vector remain poorly documented, even though the distribution of vector-borne parasites such as Plasmodium spp. depends on vector-vertebrate and, crucially, vector-parasite interactions. To understand malaria epidemiology and to design appropriate control measures, this gap must be re-addressed.

Animals↗
PubMed2005

Plasmodium research in the postgenomic era.

The complete genomic sequence of Plasmodium falciparum strain 3D7 was published in October 2002. At the Next Steps in Malaria Research meeting in April 2005, the next practical steps were considered and the priorities ranked for postgenomic research in Plasmodium. The high-throughput approaches that will help to answer the major biological questions regarding Plasmodium should, like the genome project itself, build community-shared resources, and efforts must be made to help researchers ready themselves to use the tools that will become available.

Animals↗
PubMed2005

Escheriosome entrapped soluble blood stage antigens impart protective immunity against a multi-drug resistant isolate of Plasmodium yoelii nigeriensis in BALB/c mice.

The Plasmodium yoelii nigeriensis murine model was used to evaluate the potential of liposome entrapped soluble blood stage antigens (sAg) based vaccine against malaria infection in BALB/c mice. Results from the present study revealed that immunization with E. coli lipid liposome (escheriosome) entrapped sAg provided strong protective immune responses that successfully suppressed drug resistant strain of Plasmodium yoelii, whereas other forms of sAg such as, egg PC/Chol liposomes entrapped, or its emulsion form with incomplete Freund's adjuvant (IFA) failed to impart significant level of protection. The immune responses, involved with escheriosome-sAg protection, were found to be associated with enhanced antigen specific CD4(+) and CD8(+) T-cell populations. Analysis of cytokine profiles in immunized animals revealed that the protective response was associated with the induction of a Th-1 (IL-2 and IFN-gamma) cells. Furthermore, vaccination with escheriosome entrapped sAg elicited high IgGl and IgG2a isotype response that played important role in imparting protection against blood stage infection of Plasmodium yoelii (MDR) in BALB/c mice.

Animals↗
PubMed2005

Immunogenicity and protective efficacy of Escherichia coli expressed Plasmodium falciparum merozoite surface protein-1(42) using human compatible adjuvants.

The C-terminal 42-kDa fragment of the merozoite surface protein-1 of Plasmodium falciparum (PfMSP-1(42)) was expressed as a recombinant protein in Escherichia coli and purified to near homogeneity. We tested the immunogenicity of recombinant PfMSP-1(42) in three clinically acceptable adjuvants (Montanide ISA 720, alum and MF59) in mice and in rabbits. High antibody responses were obtained with two adjuvant formulations with IgGl being the predominant immunoglobulin isotype. Significant T-cell proliferation responses were also observed. Competitive enzyme linked immunosorbant assay (ELISA) showed the presence of both invasion and processing inhibitory antibodies in sera obtained from the immunized rabbits. Passive immunizations of mice with anti-PfMSP-1(42) IgG purified from the rabbit-sera were found to be protective against a parasite challenge with P. berghei/P. falciparum chimeric line (Pb-PfM19) that expresses Plasmodium falciparum MSP-1(19). These findings may be useful for the development of a malaria vaccine based on Plasmodium falciparum MSP-1(42).

Adjuvants, Immunologic↗
PubMed1997

Direct PCR amplification and sequence analysis of extrachromosomal Plasmodium DNA from dried blood spots.

The Plasmodium parasite possesses two extrachromosomal genomes; the mitochondrial genetic element and the extrachromosomal plastid-like DNA. The latter has only been fully described for one culture strain of P. falciparum. In this study, a rapid procedure for amplifying plastid DNA from dried blood spots of blood infected with different malaria species was developed. PCR amplification of a 595 bp fragment within the plastid-like large subunit ribosomal-RNA (LSU-rRNA) gene was achieved using primers derived from the P. falciparum sequence. The PCR product was observed in all Plasmodium species examined. Sequence analysis of amplified products homologous to an LSU-rRNA fragment of the plastid-like extrachromosomal circle revealed extensive conservation between Plasmodium species including P. falciparum, P. vivax, P. malariae and P. berghei.

Animals↗
PubMed2002

Plasmodium berghei: analysis of the gamma-glutamylcysteine synthetase gene in drug-resistant lines.

The rapid emergence of multidrug-resistant Plasmodium falciparum is a worldwide concern. Despite the magnitude of the problem, the mechanisms involved in this phenomenon are not well understood. One current proposal suggests that toxic heme molecules are degraded by glutathione (GSH), and that anti-malarial drugs, such as chloroquine (CQ), inhibit this degradation, thus implicating GSH in drug resistance. Furthermore, in some strains of Plasmodium berghei and P. falciparum, chloroquine resistance is accompanied by an increase in glutathione levels and increased activity in GSH-related enzymes. We are investigating the relationship between the gamma-glutamylcysteine synthetase (ggcs) gene, the rate-limiting enzyme in de novo synthesis of GSH, and drug resistance in P. berghei at the molecular level. In this report, we have demonstrated an increase in pbggcs mRNA levels associated with CQ and mefloquine (MFQ) resistance. In addition, the pbggcs gene locus structure was shown to be similar and localized to chromosome 8 in four parasite lines of P. berghei with different drug resistance profiles. This work suggests a link between increased GSH levels and drug resistance in Plasmodium.

Animals↗
PubMed1992

Plastid origin of an extrachromosomal DNA molecule from Plasmodium, the causative agent of malaria.

Several species of Plasmodium have been shown to contain a circular extrachromosomal DNA molecule which is widely supposed to be mitochondrial DNA. However, it has recently been shown to have a number of features in common with chloroplast DNA. Here, a phylogenetic analysis of RNA polymerase coding sequences from the Plasmodium molecule has been carried out using distance matrix, maximum likelihood, parsimony and operator invariant methods. The analysis indicates that the molecule is in fact derived from an oxygenic photosynthetic organism and should be regarded as plastid DNA. This suggests that Plasmodium originated from a phototroph that has lost the capacity to photosynthesize.

Amino Acid Sequence↗
PubMed2002

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR).

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or liquid blood collected from Dutch soldiers returning from Goma, Zaire (n = 141), Angola (n = 40), and from Marechaussee (Dutch border police) returning from various parts of the world (n = 161) were examined, together with miscellaneous other material obtained from laboratories and hospitals. The method is based on features of the small subunit nuclear ribosomal ribonucleic acid (RNA) gene (ssrDNA), a multicopy gene which possesses both highly conserved domains and domains characteristic for each of the 4 human malaria parasites. The first reaction of the SnM-PCR includes a universal reverse primer with 2 forward primers specific for Plasmodium and mammals, respectively. The mammalian-specific primer was included as a positive control to distinguish uninfected cases from simple PCR failures. The second PCR reaction includes a Plasmodium-specific forward primer plus species-specific reverse primers for P. vivax, P. ovale, P. falciparum and P. malariae. The technique worked better with samples collected in the field as dried blood spots on filter paper and heparinized blood rather than with frozen pelleted blood; it was more sensitive and more specific than the standard microscopical examination.

Animals↗
PubMed1997

TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites.

Many protozoans of the phylum Apicomplexa are invasive parasites that exhibit a substrate-dependent gliding motility. Plasmodium (malaria) sporozoites, the stage of the parasite that invades the salivary glands of the mosquito vector and the liver of the vertebrate host, express a surface protein called thrombospondin-related anonymous protein (TRAP) that has homologs in other Apicomplexa. By gene targeting in a rodent Plasmodium, we demonstrate that TRAP is critical for sporozoite infection of the mosquito salivary glands and the rat liver, and is essential for sporozoite gliding motility in vitro. This suggests that in Plasmodium sporozoites, and likely in other Apicomplexa, gliding locomotion and cell invasion have a common molecular basis.

Animals↗
PubMed2000

The Toxoplasma homolog of Plasmodium apical membrane antigen-1 (AMA-1) is a microneme protein secreted in response to elevated intracellular calcium levels.

A monoclonal antibody (MAb) has been generated against a novel 63 kDa surface/apical antigen of Toxoplasma gondii tachyzoites which is identified here as TgAMA-1, the Toxoplasma homolog of Plasmodium apical membrane antigen-1 (AMA-1). Sequence analysis, phase partitioning in Triton X-114, and labeling of TgAMA-1 with iodonaphthalene azide all suggest that TgAMA-1 is a type I transmembrane protein. There is a high degree of sequence similarity between TgAMA-1 and Plasmodium AMA-1, most notably in the position of conserved cysteine residues within the protein's predicted extracellular domain. In contrast to full length Plasmodium AMA-1, which has previously been localized to the rhoptries, it is shown here by immunofluorescence and immunoelectron microscopy that intracellular TgAMA-1 is found in the micronemes. A 53 kDa N-terminal proteolytic fragment of TgAMA-1 is constitutively secreted from the parasite at 37 degrees C. As is the case with other microneme proteins, the proteolytic processing and secretion of TgAMA-1 is dramatically enhanced in response to treatments which increase intracellular calcium levels.

Amino Acid Sequence↗
PubMed2000

Pfsbp1, a Maurer's cleft Plasmodium falciparum protein, is associated with the erythrocyte skeleton.

Antibodies from hyperimmune monkey sera, selected by absorption to Plasmodium falciparum-infected erythrocytes, and elution at acidic pH, allowed us to characterize a novel parasite protein, Pfsbp1 (P. falciparum skeleton binding protein 1). Pfsbp1 is an integral membrane protein of parasite-induced membranous structures associated with the erythrocyte plasma membrane and referred to as Maurer's clefts. The carboxy-terminal domain of Pfsbp1, exposed within the cytoplasm of the host cell, interacts with a 35 kDa erythrocyte skeletal protein and might participate in the binding of the Maurer's clefts to the erythrocyte submembrane skeleton. Antibodies to the carboxy- and amino-terminal domains of Pfsbp1 labelled similar vesicular structures in the cytoplasm of Plasmodium chabaudi and Plasmodium berghei-infected murine erythrocytes, suggesting that the protein is conserved among malaria species, consistent with an important role of Maurer's cleft-like structures in the intraerythrocytic development of malaria parasites.

Amino Acid Sequence↗