Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RIBOSOMES”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 667 records · Page 37Linked to original sources
PubMed2006

Ribosomal protein S1 induces a conformational change of the 30S ribosomal subunit.

A comparative study of the 30S ribosomal subunit in the complex with protein S1 and the subunit depleted of this protein has been carried out by the hot tritium bombardment method. Differences in exposure of some ribosomal proteins within the 30S subunit depleted of S1 and within the 30S-S1 complex were found. It was concluded that protein S1 binds in the region of the neck of the 30S ribosomal subunit inducing a conformational change of its structure.

Electrophoresis, Gel, Two-Dimensional↗
PubMed2003

The ribosomal A site-bound sense and stop codons are similarly positioned towards the A1823-A1824 dinucleotide of the 18S ribosomal RNA.

Positioning of the mRNA codon towards the 18S ribosomal RNA in the A site of human 80S ribosomes has been studied applying short mRNA analogs containing either the stop codon UAA or the sense codon UCA with a perfluoroaryl azide group at the uridine residue. Bound to the ribosomal A site, a modified codon crosslinks exclusively to the 40S subunits under mild UV irradiation. This result is inconsistent with the hypothesis [Ivanov et al. (2001) RNA 7, 1683-1692] which requires direct contact between the large rRNA and the stop codon of the mRNA as recognition step at translation termination. Both sense and stop codons crosslink to the same A1823/A1824 invariant dinucleotide in helix 44 of 18S rRNA. The data point to the resemblance between the ternary complexes formed at elongation (sense codon.aminoacyl-tRNA.AA dinucleotide of 18S rRNA) and termination (stop codon.eRF1.AA dinucleotide of 18S rRNA) steps of protein synthesis and support the view that eRF1 may be considered as a functional mimic of aminoacyl-tRNA.

Azides↗
PubMed2002

Vitamin B12 stalls the 80 S ribosomal complex on the hepatitis C internal ribosome entry site.

The effect of cyanocobalamin (CNCbl, vitamin B12) on hepatitis C virus internal ribosome entry site (HCV IRES)-dependent initiation of translation was studied by ribosomal toeprinting and sucrose gradient centrifugation analysis. These results suggested that CNCbl did not inhibit HCV IRES-dependent translation by a competitive binding mechanism. CNCbl allowed 80 S elongation complex formation on the mRNA, but stalled the initiation at that point, effectively trapping the 80 S ribosomal complexes on the HCV IRES. CNCbl had no effect on cap-dependent mRNA, consistent with the known mRNA specificity of this translational inhibitor. To help elucidate the mechanism, comparative data were collected for the well-characterised translation inhibitors cycloheximide and 5'-guanylyl-imidophosphate. Although CNCbl stalled HCV IRES-dependent translation at approximately the same step in initiation as cycloheximide, the mechanisms of these two inhibitors are distinct.

Base Sequence↗
PubMed2002

NMR structure of bacterial ribosomal protein l20: implications for ribosome assembly and translational control.

L20 is a specific protein of the bacterial ribosome, which is involved in the early assembly steps of the 50S subunit and in the feedback control of the expression of its own gene. This dual function involves specific interactions with either the 23S rRNA or its messenger RNA. The solution structure of the free Aquifex aeolicus L20 has been solved. It is composed of an unstructured N-terminal domain comprising residues 1-58 and a C-terminal alpha-helical domain. This is in contrast with what is observed in the bacterial 50S subunit, where the N-terminal region folds as an elongated alpha-helical region. The solution structure of the C-terminal domain shows that several solvent-accessible, conserved residues are clustered on the surface of the molecule and are probably involved in RNA recognition. In vivo studies show that this domain is sufficient to repress the expression of the cistrons encoding L35 and L20 in the IF3 operon. The ability of L20 C-terminal domain to specifically recognise RNA suggests an assembly mechanism for L20 into the ribosome. The pre-folded C-terminal domain would make a primary interaction with a specific site on the 23S rRNA. The N-terminal domain would then fold within the ribosome, participating in its correct 3D assembly.

Amino Acid Sequence↗
PubMed1983

Initiation, processing and termination of ribosomal RNA from a hybrid 5 S ribosomal RNA gene in a plasmid.

Transformation of an RNA-processing mutant (rne, RNase E-) of Escherichia coli with a recombinant plasmid containing the promoter region of the ribosomal cluster rrnA and portions from the 3' region of the rrnD cluster results in the accumulation of the precursors to 5 S ribosomal RNAs at the permissive as well as that of two full-length transcripts and a processing intermediate at the nonpermissive temperature. The two full-length transcripts start from the two rrnA promoters, which are about 120 nucleotides apart. This plasmid, pJR3 delta, contains an intact 5 S rRNA gene and portions from the 16 S and 23 S rRNA genes. Analysis of the major plasmid-specific RNA species revealed that RNA molecules initiated in vivo from the first promoter (P1) start with pppA, while transcripts from the second promoter (P2) contain either pppG or pppC at their 5' ends. Termination occurs mainly at the first available termination site. Full-length transcripts initiated from both promoters are processed to precursors of 5 S rRNAs in vivo at the permissive temperature, but only about 20% of these transcripts are processed to mature 5 S rRNA. RNA1 and RNA2 (the transcripts initiated from P1 and P2, respectively) and RNA3 (an RNA-processing intermediate containing the entire 5 S region and the 3' end of the transcripts) can be cleaved in vitro by cell extracts of wild type strains resulting in precursor and mature 5 S rRNAs in a reaction that is RNase E dependent but not ribosome dependent. The 5' end of the processed 5 S rRNA can correspond to the 5' end of mature 5 S rRNA or it can contain one to three additional nucleotides.

Base Composition↗
PubMed1977

Rotational diffusion of Escherichia coli ribosomes. II. - Ribosome attachment to polyurydilic acid.

Ribosome attachment to poly(U) has been studied by following the rotational diffusion of polyribosomes in solution. On the average, 13-17 and 50 nucleotides are found to be associated with 30S and 70S ribosome respectively. For an equal length of poly(U), the number of particles in a 30S polysome is four times that in a 70S polysome. The results are consistent with a structure of the polysome in which individual ribosomes are in close contact.

Diffusion↗
PubMed1975

Ribosomal subunit interaction as studied by light scattering. Evidence of different classes of ribosome preparations.

The Mg2+-dependent equilibrium of ribosomal subunits was studied by light scattering in the absence of any other factor of protein synthesis. The difference of intensity in the light scattered by dissociated 30S-50S couples and by 70S particles was used as a method to measure the percentage of association as a function of Mg2+ under conditions of nonperturbation of the equilibrium. We found that pressure-resistant (type A) and non-pressure-resistant (type B) ribosomes may be characterized by the different behavior of their association equilibrium curves. The thermodynamic parameters of this equilibrium and their comparison for the two classes of ribosomes were calculated from experiments at different temperatures.

Cell Fractionation↗
PubMed1978

Binding of chloramphenicol and a fragment of aminoacyl-transfer ribonucleic acid to ribosomes and a ribosome precursor from a mutant of Escherichia coli.

During exponential growth, the mutatn strain Escherichia coli 15-28 accumulates 47S particles, which are unusual precursors to 50S ribosomal subunits. The 47S particles have little ability to bind chloramphenicol, but binding of a fragment of aminoacyl-tRNA is about half that by completed subunits. The 70S (and 50S) ribosomes of strain 15-28 and its parent (strain 15TP) do not differ in chloramphenicol binding. Although ribosomes from the mutant are less able than those from the parent to bind the fragment, this difference is not as marked as was found previously [Sims & Wild (1976) Biochem. J. 160, 721-726] for the binding of an analogue of peptidyl-tRNA and for peptidyltransferase activity. The altered activities may arise because strain 15-28 misassembles 50S subunits of altered conformation and because the few proteins that 47S patricles lack have vital functions in some of the partial reactions of protein synthesis.

Binding Sites↗
PubMed1969

Studies on the formation of transfer ribonucleic acid-ribosome complexes. XI. Antibiotic effects on phenylalanyl-oligonucleotide binding to ribosomes.

The effect of antibiotics on the binding of phenylalanyl-oligonucleotide to ribosomes has been examined. The results show that many classes of antibiotics can interfere with binding of the aminoacyl-oligonucleotide terminus of tRNA to ribosomes: chloramphenicol, sparsomycin, D-WIN-5094, vernamycin A, PA114A, streptogramin, amicetin, gougerotin, tylosin, and spiramycin III. The results are consistent with the hypothesis that these antibiotics inhibit protein synthesis by interfering with the binding of the aminoacyl-end of aminoacyl-tRNA to ribosomes.

Amino Acid Sequence↗
PubMed1972

Location of ribosomal protein binding sites on 16S ribosomal RNA.

The distribution of ribosomal protein binding sites on the 16S ribosomal RNA molecule has been analyzed by limited ribonuclease hydrolysis of RNA-protein complexes, as well as by the interaction of individual proteins with RNA fragments purified from partial enzymatic digests. Of the six 30S subunit proteins known to interact directly with 16S RNA, proteins S4, S8, S15, S20, and, probably, S13 bind within a fragment produced by T(1) RNase (12S RNA) that comprises some 900 nucleotides and covers almost the entire 5'-terminal half of the 16S molecule. A fragment of 500-600 nucleotides (8S RNA) that is contiguous with 12S RNA and arises from the 3'-terminal portion of the 16S molecule is believed to contain the binding site for protein S7. Protein S15 interacts specifically with a sequence of about 135 nucleotides (4S RNA) that derives from 12S RNA after more extensive hydrolysis. Protein S4, but none of the other ribosomal proteins, binds to a 500-nucleotide fragment (9S RNA), generated by pancreatic RNase, that lies at the 5'-terminus of 16S RNA and is completely overlapped by the 12S fragment. A preliminary map of the binding sites is presented.

Bacterial Proteins↗
PubMed1981

Specific binding of a prokaryotic ribosomal protein to a eukaryotic ribosomal RNA: implications for evolution and autoregulation.

Ribosomal protein L1 from the prokaryote Escherichia coli has been shown to form a specific complex with 26S ribosomal RNA from the eukaryote Dictyostelium discoideum. The segment of Dictyostelium rRNA protected from ribonuclease digestion by L1 and the corresponding region in Dictyostelium rDNA were investigated by nucleotide sequence analysis, and an analogous section in rDNA from Xenopus laevis was identified. When the L1-specific segments from eukaryotic rRNA were compared with those from prokaryotic rRNA, striking similarities in both primary and secondary structure were apparent. These conserved features suggest a common structural basis for protein recognition and indicate that such regions became fixed at a very early stage in rRNA evolution. In addition, certain structural elements of the L1 binding sites in rRNA are also found in the initial segment of the polycistronic L11-L1 mRNA, providing support for the hypothesis that L1 participates in the regulation of ribosomal protein synthesis by specific interaction with its own mRNA.

Base Sequence↗
PubMed2005

Selective SecA association with signal sequences in ribosome-bound nascent chains: a potential role for SecA in ribosome targeting to the bacterial membrane.

The role of SecA in selecting bacterial proteins for export was examined using a heterologous system that lacks endogenous SecA and other bacterial proteins. This approach allowed us to assess the interaction of SecA with ribosome-bound photoreactive nascent chains in the absence of trigger factor, SecB, Ffh (the bacterial protein component of the signal recognition particle), and the SecYEG translocon in the bacterial plasma membrane. In the absence of membranes, SecA photocross-linked efficiently to nascent translocation substrate OmpA in ribosome-nascent chain (RNC) complexes in an interaction that was independent of both ATP and SecB. However, no photocross-linking to a nascent membrane protein that is normally targeted by a signal recognition particle was observed. Modification of the signal sequence revealed that its affinity for SecA and Ffh varied inversely. Gel filtration showed that SecA binds tightly to both translating and non-translating ribosomes. When purified SecA.RNC complexes containing nascent OmpA were exposed to inner membrane vesicles lacking functional SecA, the nascent chains were successfully targeted to SecYEG translocons. However, purified RNCs lacking SecA were unable to target to the same membranes. Taken together, these data strongly suggest that cytosolic SecA participates in the selection of proteins for export by co-translationally binding to the signal sequences of non-membrane proteins and directing those nascent chains to the translocon.

Adenosine Triphosphatases↗
PubMed1972

Ribosome crystallization in chicken embryos. II. Conditions for the formation of ribosome tetramers in vitro.

Slow cooling of fertilized chicken eggs permits the elongation and termination of nascen(t) polypeptides in the polysomes but prevents the initiation of new protein chains. This leads to polysome disaggregation during the first 30 min of cooling, and to the formation, of a pool of inactive ribosomes prone to crystallization. After 2 hr these ribosomes began to form tetramers, which do not contain any labeled proteins synthesized during cooling. If protein synthesis is inhibited by cycloheximide, added to eggs before cooling, tetramer formation in the embryos is prevented. Puromycin, on the other hand, leads to polysome disassembly and does not prevent tetramer formation. Rapid cooling of explanted embryos after short incubation at 37 degrees C, with or without cycloheximide, largely prevents polysome disaggregation and the formation of tetramers. On the other hand, the addition of puromycin to explanted embryos promotes tetramer formation after rapid cooling. When cooled eggs are rewarmed, tetramers are disassembled into monomers, even if protein synthesis is inhibited. When those embryos were rapidly recooled tetramers reformed spontaneously from tetramer-derived monomers, even in the presence of cycloheximide. We conclude that the formation of tetramers at low temperature is an inherent property of the normal ribosomes.

Animals↗
PubMed1984

Segregation of the polypeptide translocation apparatus to regions of the endoplasmic reticulum containing ribophorins and ribosomes. II. Rat liver microsomal subfractions contain equimolar amounts of ribophorins and ribosomes.

Ribophorins I and II, two transmembrane glycoproteins characteristic of the rough endoplasmic reticulum (ER) are thought to be part of the translocation apparatus for proteins made on membrane bound polysomes. To study the stoichiometry between ribophorins and membrane-bound ribosomes we have determined the RNA and ribophorin content in rat liver microsomes or in microsomal subfractions of different density (i.e., ribosome content). The specificity of antibodies against the ribophorins was demonstrated by Western blot analysis of rat liver rough microsomes separated by 2-dimensional gel electrophoresis. The ribophorin content of microsomal subfractions was determined by indirect immunoprecipitation and for ribophorin I by a radioimmune assay. In the latter assay a molar ratio of ribophorin I/ribosomes approaching one was calculated for total microsomes as well as in the gradient subfractions. We therefore suggest that ribophorins mediate the binding of ribosomes to endoplasmic reticulum membranes or play a role in co-translational process which depend on this binding, such as the insertion of nascent polypeptides into the membrane or their transfer into the cisternal lumen.

Animals↗
PubMed1992

How are tRNAs and mRNA arranged in the ribosome? An attempt to correlate the stereochemistry of the tRNA-mRNA interaction with constraints imposed by the ribosomal topography.

Two tRNA molecules at the ribosomal A- and P-sites, with a relatively small angle between the planes of the L-shaped molecules, can be arranged in two mutually exclusive orientations. In one (the 'R'-configuration), the T-loop of the A-site tRNA faces the D-loop of the P-site tRNA, whereas in the other (the 'S'-configuration) the D-loop of the A-site tRNA faces the T-loop of the P-site tRNA. A number of stereochemical arguments, based on the crystal structure of 'free' tRNA, favour the R-configuration. In the ribosome, the CCA-ends of the tRNA molecules are 'fixed' at the base of the central protuberance (the peptidyl transferase centre) of the 50S subunit, and the anticodon loops lie in the neck region (the decoding site) of the 30S subunit. The translocation step is essentially a rotational movement of the tRNA from the A- to the P-site, and there is convincing evidence that the A-site must be located nearest to the L7/L12 protuberance of the 50S subunit. The mRNA in the two codon-anticodon duplexes lies on the 'inside' of the 'elbows' of the tRNA molecules (in both the S-type and R-type configurations), and runs up between the two molecules from the A- to the P-site in the 3' to 5'-direction. These considerations have the consequence that in the S-configuration the mRNA in the codon-anticodon duplexes is directed towards the 50S subunit, whereas in the R-configuration it is directed towards the 30S subunit. The results of site-directed cross-linking experiments, in particular cross-links to mRNA at positions within or very close to the codons interacting with A- or P-site tRNA, favour the latter situation. This conclusion is in direct contradiction to other current models for the arrangement of mRNA and tRNA on the ribosome.

Cross-Linking Reagents↗
PubMed1976

Extensions of the known sequences at the 3' and 5' ends of 23S ribosomal RNA from Escherichia coli, possible base pairing between these 23S RNA regions and 16S ribosomal RNA.

Extensions of the known sequences at both 3' and 5' ends of 23S ribosomal RNA are presented: The 5' terminal is pG-G-U-U-A-A-G-Cp or pG-G-U... G-U-U-A-A-G-Cp, with a very short sequence between Up and Gp and the 3'terminal is G-A-A-C-C-G-A-(G)-G-C-U-U-A-A-C-C-U-UOH. These two terminal regions exhibit a high degree of complementarity. In addition, extensive complementarities are also found between the 5'terminal sequence of 23S RNA and a sequence contained in section A of the 16S ribosomal RNA, and between the 3'terminal sequence of 23S RNA and sequences in sections O and J in the 16S RNA. The degree of complementarity between the two extremities of 23S RNA, and between these extremities and regions of the 16S RNA, is far greater than would be expected on a random basis suggesting a possible involvement of this base-pairing in the functioning of ribosomes. This possibility is discussed.

Base Sequence↗
PubMed1981

Organization and nucleotide sequence of a new ribosomal operon in Escherichia coli containing the genes for ribosomal protein S2 and elongation factor Ts.

We report the nucleotide sequence of the four min region of the Escherichia coli genetic map that includes the genes for ribosomal protein S2 (rpsB) and translation elongation factor EF-Ts (tsf), and the possible location of regulatory sites within this two gene operon. The data indicate that the gene order is: rpsBp-rpsB-tsf-tsft. One potential regulatory site is a 16 nucleotide sequence in the rpsB leader region encompassing the ribosome binding site and the translation initiation codon. This has a high degree of homology with nucleotides 8 through 23 on the 5' end of 165 ribosomal RNA, and might signify a sequence that is necessary for post-transcriptional control of rpsB expression. The data allow one to infer the amino acid sequences of S2 and EF-Ts.

Amino Acid Sequence↗
PubMed1981

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.

Animals↗