Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Open Reading Frames”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 649 records · Page 36Linked to original sources
PubMed1994

Varicella-zoster virus open reading frame 4 protein is functionally distinct from and does not complement its herpes simplex virus type 1 homolog, ICP27.

Varicella-zoster virus (VZV) open reading frame 4 (ORF4) encodes a putative immediate-early protein which is homologous to herpes simplex virus type 1 (HSV-1) ICP27 on the basis of gene location and similarity in amino acid sequence. In transient expression assays, however, ORF4 and ICP27 exhibit different properties. ICP27 alone has little activity on target plasmids, but it acts as a transactivator or a transrepressor in the presence of other HSV-1 transactivators. In contrast, ORF4 directly transactivates plasmids containing homologous or heterologous promoters and has no apparent transrepressing activity. To further illuminate the functional similarities and differences between ORF4 and ICP27, Vero cell lines which express ORF4 under the inducible metallothionein promoter were constructed. Cell lines expressing functionally active ORF4 protein upregulated the expression of transfected VZV target plasmids but were unable to efficiently complement HSV-1 ICP27 mutants. These results indicate that, despite structural similarities, VZV ORF4 and HSV-1 ICP27 behave differently in transient expression assays and may play different roles in virus replication.

Animals↗
PubMed2002

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements.

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

Base Sequence↗
PubMed1998

Extraordinary features in the Chlamydomonas reinhardtii chloroplast genome: (1). rps2 as part of a large open reading frame; (2). A C. reinhardtii specific repeat sequence.

We have determined the DNA sequence of the 3574-bp chloroplast DNA fragment of Chlamydomonas reinhardtii formed by the overlap of BamHI fragment 3 and EcoRI fragment 5. This sequence encodes most of rps18 and orf570, an unidentified open reading frame that contains a 150 amino acid domain with high homology to the N-terminal part of 30 S ribosomal protein S2 of other chloroplast, cyanobacterial and bacterial genomes. Between these two sequences lies a highly repetitive sequence element of 500 bp, that is composed of multiple direct and inverted repeat sequences that occur in rearranged, but highly conserved form in at least 36 locations in the C. reinhardtii chloroplast genome. Among the conserved repeat sequences in the C. reinhardtii chloroplast genome we identified the borders of the inverted repeats near atpB and rps4. This might indicate that the conserved sequence elements are remainders of gene rearrangements in the chloroplast genome that occurred by relocations of the inverted repeats.

Amino Acid Sequence↗
PubMed1997

Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes.

An essential oncogenic determinant of subgroup D human adenovirus type 9 (Ad9), which uniquely elicits estrogen-dependent mammary tumors in rats, is encoded by early region 4 open reading frame 1 (E4 ORF1). Whereas Ad9 E4 ORF1 efficiently induces transformed foci on the established rat embryo fibroblast cell line CREF, the related subgroup A Ad12 and subgroup C Ad5 E4 ORF1s do not (R. T. Javier, J. Virol. 68:3917-3924, 1994). In this study, we found that the lack of transforming activity associated with non-subgroup D adenovirus E4 ORF1s in CREF cells correlated with significantly reduced protein levels compared to Ad9 E4 ORF1 in these cells. In the human cell line TE85, however, the non-subgroup D adenovirus E4 ORF1s produced protein levels higher than those seen in CREF cells as well as transforming activities similar to that of Ad9 E4 ORF1, suggesting that all adenovirus E4 ORF1 polypeptides possess comparable cellular growth-transforming activities. In addition, searches for known proteins related to these novel viral transforming proteins revealed that the E4 ORF1 proteins had weak sequence similarity, over the entire length of the E4 ORF1 polypeptides, with a variety of organismal and viral dUTP pyrophosphatase (dUTPase) enzymes. Even though adenovirus E4 ORF1 proteins lacked conserved protein motifs of dUTPase enzymes or detectable enzymatic activity, E4 ORF1 and dUTPase proteins were predicted to possess strikingly similar secondary structure arrangements. It was also established that an avian adenovirus protein, encoded within a genomic location analogous to that of the human adenovirus E4 ORF1s, was a genuine dUTPase enzyme. Although no functional similarity was found for the E4 ORF1 and dUTPase proteins, we propose that human adenovirus E4 ORF1 genes have evolved from an ancestral adenovirus dUTPase and, from this structural framework, developed novel transforming properties.

Adenovirus E4 Proteins↗
PubMed1996

Sequencing and analysis of a 35.4 kb region on the right [corrected] arm of chromosome IV from Saccharomyces cerevisiae reveal 23 open reading frames.

The complete DNA sequence of cosmid clone 31A5 containing a 35 452 bp segment from the right [corrected] arm of chromosome IV from Saccharomyces cerevisiae, was determined from an ordered set of subclones in combination with primer walking on the cosmid. The sequence contains 23 open reading frames (ORFs) of more than 100 amino acid residues and the tRNA-Va12a gene. Five ORFs corresponded to the known yeast genes SNQ2, SES1, GCV1, RPL2B and RPS18A. The DNA sequence for RPS18A is interrupted by an intron. One ORF corresponded to a part of the yeast gene HEX2 at the end of the cosmid insert. Four ORFs encoded putative proteins which showed strong homologies to other previously known proteins, three of yeast origin and one of non-yeast origin. Two ORFs were classified as having borderline homologies: one had similarity to two protein families and another to two protein products of unknown function from other species. The remaining 11 ORFs bore no significant similarity to any published protein.

Amino Acid Sequence↗
PubMed1992

The sequence of a 9.3 kb segment located on the left arm of the yeast chromosome XI reveals five open reading frames including the CCE1 gene and putative products related to MYO2 and to the ribosomal protein L10.

We report here the sequence of a 9.3 kb DNA segment of chromosome XI of Saccharomyces cerevisiae, located between the MAK11 locus and the centromere. This sequence contains four long open reading frames (ORFs), YKL160, YKL162, YKL164, YKL165 and part of another ORF, YKL166, covering altogether 90% of the entire sequence. One of these ORFs, YKL164, corresponds to CCE1. Translation products of two other ORFs, YKL160 and YKL165, exhibit homology with previously known S. cerevisiae proteins: the ribosomal protein L10, and the MYO2 gene product, respectively.

Amino Acid Sequence↗
PubMed1994

Nucleotide sequence and organization of eight 3' open reading frames of the citrus tristeza closterovirus genome.

The citrus tristeza closterovirus (CTV) RNA genome was cloned as cDNA generated from both CTV-specific double-stranded RNA and genomic RNA, and the sequence of the 3' 7292 nucleotides was determined. The sequenced portion contained eight open reading frames potentially encoding, in the 5' to 3' direction, proteins with the apparent molecular weights of 65, 61, 27, 25 (capsid protein, CP), 18, 13, 20, and 23 kDa, and a potential noncoding region of 277 nucleotides. The 65-kDa protein is a viral homolog of cellular hsp70 heat shock proteins (hsp), the 61-kDa protein is distantly related to the hsp90 proteins, and the 27-kDa protein is a diverged copy of the CP. Database searches did not identify any protein sequences of significant similarity to the remaining four ORFs downstream of the CP. A specific four-gene module consisting of the hsp70 protein, the hsp90-related protein, the diverged copy of the CP, and the CP itself was found to be common in organization between CTV and beet yellows closterovirus. All four proteins in this module were highly conserved, indicating that these viruses probably have evolved from a common ancestor.

Amino Acid Sequence↗
PubMed2003

The translation of an antiapoptotic protein HIAP2 is regulated by an upstream open reading frame.

HIAP2 is a multifunctional protein that is critically involved in the regulation of cell survival and apoptosis. Here, we show that HIAP2 5' untranslated region functions as a strong inhibitor of translation. Sequence analysis of human, mouse and rat sequences revealed that there exists a short open reading frame (ORF) that is located just upstream of the HIAP2 coding sequence. The translation of this uORF severely inhibited translation of the downstream reporter gene in vivo but not in vitro. Point mutation that destroys the CUG initiating codon of uORF markedly enhanced translation of the reporter gene without affecting the mRNA levels. Our results identify a novel translational regulatory mechanism that controls the expression of HIAP2 and point to the importance of tight regulation of antiapoptotic gene expression.

5' Untranslated Regions↗
PubMed1995

Sequence of a 9.8 kb segment of yeast chromosome II including the three genes of the MAL3 locus and three unidentified open reading frames.

We report the DNA sequence of a segment located on the right arm of chromosome II from Saccharomyces cerevisiae S288C near the subtelomeric sequences. The sequence was determined using a random cloning strategy followed by an oligonucleotide-directed sequencing. The segment contains four non-overlapping open reading frames (ORFs) YBR297w, YBR298c, YBR299w and YBR301c, and two overlapping ones (YBR300c and YBR300w). Three of them--YBR297w, YBR298c and YBR299w--are the MAL3R (transcriptional regulatory protein), MAL3T (maltose permease) and MAL3S (maltase) genes of the MAL3 locus previously localized. The three other ORFs are unidentified. Another MAL locus (MALl) has been localized on chromosome VII. The Mal- phenotype of strain S288c cannot be explained by telomeric silencing.

Base Sequence↗
PubMed1991

Equine herpesvirus 1 sequence near the left terminus codes for two open reading frames.

We have previously reported the sequence of the equine herpesvirus one genomic termini that are homologous to the genomic termini of other herpesviruses. In this paper, we present the nucleotide sequence adjacent to the left terminus sequence (map units 0.0087 to 0.0237). This sequence codes for two open reading frames (ORF) which are homologous to ORF2 and ORF3 of the varicella-zoster virus genome and are located at colinear positions. The L region sequence presented here also contains a segment that is involved in the generation of the genome of EHV-1 DI particles through recombination with sequences mapping within the internal portion of the inverted repeat sequences of the short region.

Amino Acid Sequence↗
PubMed2003

Genomic analysis of varicella-zoster virus: primers for individual open reading frames.

The genome of varicella-zoster virus (VZV) contains nearly 125,000 bp. Preliminary genomic analysis has revealed that VZV may be less immutable than once thought. Through the investigation of the VZV genome using specifically designed oligonucleotides, it has been learned that sequence variation within VZV open reading frame 62 can distinguish between vaccine and wild-type virus. Additionally, the presence of single nucleotide polymorphisms within the VZV genome has identified distinct VZV populations originating from circumscribed geographic locations. In order for future studies of VZV genetic diversity to be carried out, amplifying and sequencing primers for individual VZV genes have been catalogued. Additionally, this report will facilitate the selection of VZV primers by which to distinguish clinical VZV isolates from vaccinia virus isolates.

DNA Primers↗
PubMed1992

The complete sequence of a 9,543 bp segment on the left arm of chromosome III reveals five open reading frames including glucokinase and the protein disulfide isomerase.

We report here the DNA sequence of a 9.5 kb segment of chromosome III. The sequence was determined by subcloning the segment into subfragments generated by appropriate restriction enzymes followed by oligonucleotide-directed sequencing. The segment contains at least five open reading frames, YCL311, YCL312, YCL313, YCL314, YCL315. YCL311 and YCL315 extend in the adjacent fragments, A4H and A6C respectively. YCL312 encodes glucokinase, and YCL313 the protein disulfide isomerase. Disruption of YCL311, 314 and 315 by insertion of a URA3 cassette does not lead to a detectable phenotype, whereas disruption of YCL313 provokes cell lethality.

Chromosome Deletion↗
PubMed1999

Rice tungro bacilliform virus open reading frame 3 encodes a single 37-kDa coat protein.

Rice tungro bacilliform virus (RTBV) is a plant pararetrovirus and a member of the Caulimoviridae family and closely related to viruses in the Badnavirus genus. The coat protein of RTBV is part of the large polyprotein encoded by open reading frame 3 (ORF3). ORF3 of an RTBV isolate from Malaysia was sequenced (accession no. AF076470) and compared with published sequences for the region that encodes the coat protein or proteins. Molecular mass of virion proteins was determined by mass spectrometry (matrix-assisted laser desorption/ionization-TOF) performed on purified virus particles from three RTBV isolates from Malaysia. The N- and C-terminal amino acid sequences of the coat protein were deduced from the mass spectral analysis, leading to the conclusion that purified virions contain a single coat protein of 37 kDa. The location of the coat protein domain in ORF3 was reinforced as a result of immunodetection reactions using antibodies raised against six different segments of ORF3 using Western immunoblots after SDS-PAGE and isoelectrofocusing of proteins purified from RTBV particles. These studies demonstrate that RTBV coat protein is released from the polyprotein as a single coat protein of 37 kDa.

Animals↗
PubMed1999

Analysis of cDNA expressed sequence tags from Entamoeba histolytica: identification of two highly abundant polyadenylated transcripts with no overt open reading frames.

Upon analysis of 304 expressed sequence tags derived from the protozoan parasite Entamoeba histolytica, a number of novel protein encoding amoeba sequences were isolated. In addition, two unrelated, abundantly expressed transcripts were identified, and designated, ehapt1 and ehapt2. Although these transcripts do not contain any overt open reading frame, both are polyadenylated and together represent about 19% of total polyA+-RNA(11.6% for ehapt1 and 7.5% for ehapt2), thus being the most highly expressed polyA-containing transcripts so far identified in E. histolytica trophozoites. Northern blot and primer extension analyses revealed single-sized transcripts of 0.5 and 0.6 kb for ehapt1 and ehapt2, respectively, and Southern blot analysis suggests that both are encoded by multiple genes, which are distributed throughout the amoeba genome. Comparison between various ehapt1- and ehapt2-derived cDNAs indicated that both transcripts are highly polymorphic. Whereas nucleotide substitutions in ehapt2 are distributed throughout the sequence, variations in ehapt1 are mainly restricted to two regions, one of which comprises a deletion of variable length within an 8 nt tandem repeat unit. At present there is no convincing explanation for the possible role of ehapt1 and ehapt2 in E. histolytica, and analogous sequences have not been described so far for any other organism. Most likely they might represent regulatory RNAs or transcribed transposable elements.

Animals↗
PubMed2000

Functional role of pX open reading frame II of human T-lymphotropic virus type 1 in maintenance of viral loads in vivo.

Human T-lymphotropic virus type 1 (HTLV-1) causes adult T-cell leukemia/lymphoma and is associated with a variety of immune-mediated disorders. The role of four open reading frames (ORFs), located between env and the 3' long terminal repeat of HTLV-1, in mediating disease is not entirely clear. By differential splicing, ORF II encodes two proteins, p13(II) and p30(II), both of which have not been functionally defined. p13(II) localizes to mitochondria and may alter the configuration of the tubular network of this cellular organelle. p30(II) localizes to the nucleolus and shares homology with the transcription factors Oct-1 and -2, Pit-1, and POU-M1. Both p13(II) and p30(II) are dispensable for infection and immortalization of primary human and rabbit lymphocytes in vitro. To test the role of ORF II gene products in vivo, we inoculated rabbits with lethally irradiated cell lines expressing the wild-type molecular clone of HTLV-1 (ACH.1) or a clone containing selected mutations in ORF II (ACH.30/13.1). ACH.1-inoculated animals maintained higher HTLV-1-specific antibody titers than animals inoculated with ACH.30/13.1. Viral p19 antigen was transiently detected in ex vivo cultures of peripheral blood mononuclear cells (PBMC) from only two ACH.30/13.1-inoculated rabbits, while PBMC cultures from all ACH.1-inoculated rabbits routinely produced p19 antigen. In only three of six animals exposed to the ACH. p30(II)/p13(II) clone could provirus be consistently PCR amplified from extracted PBMC DNA and quantitative competitive PCR showed the proviral loads in PBMC from ACH.p30(II)/p13(II)-infected rabbits to be dramatically lower than the proviral loads in rabbits exposed to ACH. Our data indicate selected mutations in pX ORF II diminish the ability of HTLV-1 to maintain high viral loads in vivo and suggest an important function for p13(II) and p30(II) in viral pathogenesis.

Animals↗
PubMed1996

A putative helicase, the SUA5, PMR1, tRNALys1 genes and four open reading frames have been detected in the DNA sequence of an 8.8 kb fragment of the left arm of chromosome VII of Saccharomyces cerevisiae.

We report the sequence of an 8.8 kb segment of DNA from the left arm of chromosome VII of Saccharomyces cerevisiae. The sequence reveals seven open reading frames (ORFs) G1651, G1654, G1660, G1663, G1666, G1667 and G1669 greater than 100 amino acids in length and the tRNALys1 gene. ORF G1651 shows 100% identity with the ROK1 protein which is a putative RNA helicase of the 'DEAD box' protein family. ORF G1654 exhibits a motif highly conserved in ATP/GTP binding proteins generally referred to as 'P-loop'. From FastA analysis, G1660 and G1666 were found to be previously sequenced genes, respectively SUA5 and PMR1. The three other ORFs identified are partially (G1663) or completely (G1667 and G1669) overlapping with the PMR1 sequence on the complementary strand. This feature, together with their low codon adaptation indexes and the absence of significant homology with known proteins suggest that they do not correspond to real genes.

Amino Acid Sequence↗
PubMed1992

Nucleotide sequence of diatom plasmids: identification of open reading frames with similarity to site-specific recombinases.

We have determined the nucleotide sequence of two small circular DNA plasmids, pCf1 and pCf2 [22], from the marine diatom Cylindrotheca fusiformis. pCf1 is 4273 bp, and pCf2 is 4079 bp in size. In each plasmid, all of the major open reading frames (ORFs) are encoded on the same DNA strand. Two ORFs are similar, comparing the two plasmids. ORF218 (pCf1) and ORF217 (pCf2) share 80% amino acid identity and ORF482 (pCf1) and ORF484 (pCf2) share 54% amino acid identity. ORF218/217 shows significant similarity (28-31% amino acid identity) to the Tn3 class of resolvases. Resolvases are most commonly found in bacterial transposons. However, two other features found in the Tn3 class of transposon are missing in the plasmids; an ORF encoding a transposase and terminal inverted repeat sequences. This, and data mapping the portions of the plasmids that hybridize to genomic chloroplast DNA, suggest that the plasmids do not contain active transposons. By analogy with the R46 plasmid from Enterobacter [5, 6], another potential role for the resolvases encoded by pCf1 and pCf2 is the conversion of multimeric forms of the plasmid to monomers. The similarity of ORF218/217 to resolvases documents the first identification of a potential coding function in an algal plasmid.

Amino Acid Sequence↗
PubMed1990

Mapping of linear epitopes of human papillomavirus type 16: the E1, E2, E4, E5, E6 and E7 open reading frames.

Certain types of human papillomavirus (HPV), especially HPV type 16, are associated with proliferative lesions of the cervix uteri that can progress to malignancy. In order to map the linear epitopes of the HPV-encoded proteins, we have synthesized the predicted amino acid sequences of the open reading frames (ORFs) in the early region of HPV 16, as a set of 94 synthetic 20-residue peptides overlapping each other with 5 amino acids. The peptides were tested for reactivity with IgA, IgG and IgM antibodies in the sera of 30 patients with HPV 16-carrying cervical neoplasia. The EI ORF had only low immunoreactivity, but several relatively minor epitopes were identified in the carboxyterminal part. The E2 ORF was found to contain several epitopes that were highly immunoreactive with a majority (up to 87%) of the cervical cancer patients' sera. The E4 ORF had one major, regularly IgA- and IgG-reactive epitope, whereas the E5 and E6 ORFs had only a few minor epitopes. The E7 ORF had several epitopes that were highly immunoreactive, but only with a minority of patients' sera. The 10 most immunoreactive peptides were also analyzed for immunoreactivity with 60 control sera, of which 22 were derived from patients with parotid gland tumors and 38 were derived from healthy volunteers. Most of the peptides were also immunoreactive with the control sera. However, the IgA antibodies, and to some extent the IgG antibodies, were found at much lower levels among the controls.

Amino Acid Sequence↗