Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Nucleotide Mapping”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 649 records · Page 36Linked to original sources
PubMed1988

Identification of the promoters of the Bacillus subtilis spoIIA and spoVA operons.

Nuclease S1 mapping was used to identify the transcription start points of the spoIIA and spoVA operons of Bacillus subtilis. The spoIIA operon has been shown to be transcribed from two promoters separated by about 850 bp of DNA. The downstream of the two promoters has -10 and -35 regions characteristic of promoters recognised by the sigma-B form of RNA polymerase and it gives rise to a transcript with a 45-base 5' untranslated leader sequence. Studies on the upstream spoIIA promoter are still in progress and preliminary results indicate the presence of an open reading frame between the two promoters. In the case of the spoVA operon the promoter shows homology to promoters recognised by the sigma-E form of RNA polymerase; the 5' untranslated sequence on the spoVA mRNA is 14 bases.

Bacillus subtilis↗
PubMed1991

Cloning and characterization of the carp prolactin gene.

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.

Amino Acid Sequence↗
PubMed1994

Analysis of deletion of the integrated human papillomavirus 16 sequence in cervical cancer: a rapid multiplex polymerase chain reaction approach.

A protocol for a rapid physical mapping of the integrated type 16 human papillomavirus (HPV16) sequences in biopsied and paraffin-embedded archival cervical cancer samples is described. The procedure involves the use of an anchor primer and a mixture of indicator primers in a multiplex polymerase chain reaction (PCR). A minimal conserved region of viral integration of 2,745 bp in length has been mapped between nucleotide (nt) 6102-941, containing the entire regulatory region and the E6 and E7 open reading frames (ORFs). A general deletion domain of 1,465 bp in the integrated viral genome has been defined between nt 1417-2881, covering most of the E1 ORF at the 3'-half and 60 bp at the 5' terminus of the E2 ORF. This common deleted sequence contains an ATPase active domain speculated to be associated with a DNA helicase function essential for the viral replication, and it also falls within the actively spliced E1-E2 segment of the primary RNA transcripts. Detection of the loss of the 3'-half of the E1 ORF would be an ideal marker for PCR-based rapid determination of HPV integration in cervical cancer cells.

Chromosome Mapping↗
PubMed1989

Sigma-G RNA polymerase controls forespore-specific expression of the glucose dehydrogenase operon in Bacillus subtilis.

The gene encoding glucose dehydrogenase (gdh) is part of an operon whose expression is transcriptionally activated specifically in the developing forespore of Bacillus subtilis at stage III of sporulation. The in vivo startpoint of gdh transcription was determined using primer extension analysis. Deletion mapping and site-specific mutagenesis experiments indicated that the region responsible for regulated expression of gdh in vivo was limited to the "-35" and "-10" regions preceding the transcriptional start site. RNA polymerase containing omega G (E omega G) transcribed gdh in vitro with a start site identical to that found in vivo, and transcription of gdh by E omega G in vitro also did not require any specific sequences upstream from "-35" region. These results suggest that the appearance of E omega G in the forespore at stage III of sporulation is sufficient to cause temporal and compartment-specific expression of the gdh operon.

Bacillus subtilis↗
PubMed1990

Detailed analysis of the site 3 region of the human beta-globin dominant control region.

Four DNase I hypersensitive sites characterize the human beta-globin Dominant Control Region (DCR) providing position independent, high levels of erythroid specific expression to linked homologous and heterologous genes when introduced into cultured cells or in transgenic mice. We have delineated the hypersensitive site located 10.5 kbp upstream of the epsilon-globin gene by short range DNase I sensitivity mapping to a 600 bp region. Using transgenic mice and MEL cells the functional part of this region was further mapped to a 300 bp central core, which provides position independent, high level expression. It contains a number of ubiquitous and erythroid specific protein binding sites, including the previously described factors NF-E1 (GF1) and NF-E2. The latter binds to a dimer of the consensus binding sequence for jun/fos. The presence of this sequence is required for the function of the element, but single or multimerized copies of this site failed to give position independent, high levels of expression in transgenic mice or MEL cells. We therefore conclude that a combination of factor binding sites is necessary to allow site 3 to function as a strong transcriptional activator, resulting in position independent expression of the beta-globin gene.

Animals↗
PubMed1983

Relationships among DNA sequences of the 1.3 kb EcoRI family of mouse DNA.

The genome of the mouse (Mus musculus) contains a family of repeated DNA sequences defined by a 1.3 kb EcoRI fragment. Restriction maps of ten cloned fragments from this family have been determined. The fragments were of seven different types, based on the patterns of digestion obtained with AvaII, HindIII, and TaqI restriction enzymes. These seven unique sets of sequences fell into two classes, as defined by the position of a single HindIII site. Portions of fragments from each of the two classes were sequenced. Although certain regions of the repeat were highly conserved between classes, there was more intraspecific sequence divergence among the sequenced regions than has been observed for the short interspersed Alu family of repeated sequences in mammals. Sequences of both HindIII classes were found to be present within the mouse X chromosome; we can conclude that both classes must also be present on other mouse chromosomes.

Animals↗
PubMed1990

Mapping sequences required for productive replication of beet necrotic yellow vein virus RNA 3.

Of the four genome components of beet necrotic yellow vein virus only RNAs 1 and 2 are essential for viral replication in leaves. We have mapped cis-regulatory elements on RNA 3 by introducing deletions into expressible cDNA clones and inoculating leaves with the altered transcripts along with RNAs 1 and 2. Transcripts carrying internal deletions extending to within 69 residues of the 3' poly(A) tail or to within about 300 residues of the 5' terminus were efficiently amplified and encapsidated in vivo. The 3' terminal cis-essential domain can be folded into a secondary structure which is conserved among all four genomic RNAs and which probably contains the minus-strand promoter. RNA 3 transcripts with 75% of the central core of the sequence deleted or replaced by the beta-glucuronidase (GUS) gene were also viable. GUS activity was detected in infected tissue in the latter case.

Base Sequence↗
PubMed1994

A novel c-myc-activating reciprocal T(12;15) chromosomal translocation juxtaposes S alpha to Pvt-1 in a mouse plasmacytoma.

Oil-induced murine plasmacytomas typically carry c-myc-activating non-random reciprocal chromosomal translocations that take the form of either a T(12;15) that fuses the c-myc proto-oncogene to an immunoglobulin heavy chain switch region or a T(6;15) that juxtaposes the Pvt-1 locus, located 220 kb 3' of c-myc, to the immunoglobulin light china locus, C kappa. In this report we show that the plasmacytoma ABPC 60 harbors a novel c-myc-activating T(12;15) in which the chromosome 15 breakpoint occurs in the Pvt-1 region, resulting in the head-to-tail juxtaposition of the Pvt-1 major breakpoint cluster to the IgA switch region. Restriction mapping and nucleotide sequencing of this atypical translocation indicate that a paracentric inversion in chromosome 12 must have preceeded the translocation. This is the first example of a T(12;15) with a break 3' of the c-myc gene. The rearrangement places the 3' C alpha enhancer (3' alpha E) greater than 200 kb downstream of the c-myc promoters, however c-myc mRNA levels are similar to those observed in plasmacytomas with typical T(12;15)s that translocate 3' alpha E much closer (15-25 kb) and upstream of c-myc. The up regulation of c-myc that results from this rearrangement is thought to be brought about by the interaction of the c-myc promoters with the IgA enhancer element that has been strategically relocated into the Pvt-1 region.

Animals↗
PubMed1990

Rapid cloning and characterization of new chromosome 10 DNA markers by Alu element-mediated PCR.

Alu element-mediated polymerase chain reaction is a strategy for rapidly cloning and mapping human DNA markers from mixed DNA sources. A novel primer homologous to the 3' end of the human Alu repeat element provides the basis for preferential synthesis of human DNA fragments from human/rodent somatic cell hybrid DNA template. This approach has been used to isolate a series of new markers from chromosome 10. The Alu element-mediated PCR probes were regionally assigned on chromosome 10 by hybridization to Southern blots of Alu PCR-synthesized DNA derived from somatic cell hybrid template DNA. Alu element-mediated PCR is generally applicable and makes possible the analysis of complex genomes with a speed and sensitivity that has not been previously possible.

Animals↗
PubMed1987

The effect of supercoil and temperature on the recognition of palindromic and non-palindromic regions in phi X174 replicative form DNA by S1 and Bal31.

The effect of supercoil and temperature on the topology of phi X174 replicative form (RF) DNA was studied using single-strand specific endonucleases S1 and Bal31 as probes for cruciform extrusion and other structural perturbations of the B-helix. Both enzymes were found to recognize specifically and reproducibly over 30 sites, most of which were cleaved by both enzymes independent of the superhelicity of the genome. A negative superhelical density exceeding 0.06 stabilized a transition in the DNA conformation that generated several new cleavage sites for Bal31. The underlying structures appeared to be only transiently stable and were lost from in vitro supercoiled DNA during brief incubation at 65 degrees C. They were generally absent from in vivo supercoiled RF DNA of equal superhelicity as a consequence of the extraction and storage procedure. Mapping of the cleavage sites suggested that they were preferentially located near the beginnings and ends of genes and that the structural basis for at least some of them was the extrusion of relatively small palindromes into the cruciform state. Insertion of a short synthetic palindromic sequence into the phi X174 genome generated a supercoil-dependent, temperature-sensitive secondary structure that was cleaved in the Bal31 but not the S1 reaction, further supporting the hypothesis that even small cruciforms with stem size of 7 or less base pairs may be transiently stable. Subjecting supercoiled RF DNA to the typical S1 reaction conditions induced a topological shift that diminished all but one of the supercoil-induced Bal31 recognition sites and promoted the formation of one major new site.

Bacteriophage phi X 174↗
PubMed1997

Identification of a promoter region generating Sry circular transcripts both in germ cells from male adult mice and in male mouse embryonal gonads.

The mouse testis determining gene Sry is expressed in somatic cells of the differentiating male gonad as a linear transcript, encoding a transcription factor containing an HMG box. In the adult mouse testis, Sry expression occurs in meiotic and postmeiotic germ cells. The mouse genomic Sry locus is characterized by two arms of a large inverted repeat, flanking a unique region that, between an acceptor and a donor splice site, contains a single exon encoding the Sry protein. In germ cells from the adult mouse testis, Sry RNA is a circular molecule, which is generated by an inverted splicing event that utilizes the above-mentioned splice sites. Thus, a circular exon is spliced out starting from a large linear RNA precursor containing both arms of the inverted repeat, which pair and generate a large stem-loop structure. Using reverse transcription-polymerase chain reaction and an RNase protection assay, we have now mapped the 5' end of this precursor RNA in the 5' arm of the inverted repeat. Gel mobility shift assay and in vitro transcription with nuclear extracts from adult germ cells further confirm that a region immediately 5' upstream of two transcriptional initiation sites of the precursor RNA contains a promoter sequence in which two consensus Sry binding sequences are specifically recognized by nuclear factors present in adult germ cells but not in Sertoli cells. We also show that the linear precursor of the Sry circular transcript and its splicing product are specifically expressed not only in adult germ cells but also in male embryonal gonads between 11.5 and 13.5 days postcoitum, immediately after the expression of the linear transcript starting from the unique region.

Animals↗
PubMed1988

Two new large deletions resulting in epsilon gamma delta beta-thalassemia.

Detailed gene mapping data are provided for members of a Yugoslavian and Canadian family with a thalassemia heterozygosity characterized by mild anemia with severe microcytosis and hypochromia, normal levels of Hb A2 and slightly raised Hb F levels. The condition in both families results from large deletions (minimally approximately 148 kb in the Yugoslavian family and minimally approximately 185 kb in the Canadian family), which include all functional and psi genes of the beta globin gene cluster. The Canadian propositus was a newborn baby who has been followed for nearly 2 years; severe anemia developed some 30-40 days after birth when the Hb F level was still 70%; recovery was evident at the age of 90 days when the Hb F level had decreased to 40%.

Adult↗
PubMed2000

Heterogeneity of chicken slow skeletal muscle troponin T mRNA.

The troponin T (TnT) transcripts in chicken slow skeletal muscle were characterized by S1 nuclease mapping and nucleotide sequencing of cDNA produced by RT-PCR and 5'-RACE. We found two kinds of transcripts in the 5'-region, one having the codon for alanine (position 135-137), C (258), and A (262) and the other lacking the codon and having T (258) and G (262) instead of C and A. In the 3'-region, we found four single base substitutions at 703 (T or C), 774 or T), 797 or T), and 827 (G or A). Four of the six substitutions lead to amino acid changes in chicken sTnT isoforms. We determined the genomic structure of the 3'-region of the chicken sTnT gene. The region includes 7 exons corresponding to position 249-891 of the chicken sTnT cDNA and no alternative exon, showing that the 3'-heterogeneity in sTnT transcripts was due to allelic variation. J. Exp. Zool. 286:149-156, 2000.

Amino Acid Sequence↗
PubMed1987

Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria.

We have constructed a series of derivatives of the omega interposon [Prentki and Krisch, Gene 29 (1984) 303-313] that can be used for in vitro insertional mutagenesis. Each of these DNA fragments carries a different antibiotic or Hg2+ resistance gene (ApR, CmR, TcR, KmR or HgR) which is flanked, in inverted orientation, by transcription and translation termination signals and by synthetic polylinkers. The DNA of these interposons can be easily purified and then inserted, by in vitro ligation, into a plasmid linearized either at random by DNase I or at specific sites by restriction enzymes. Plasmid molecules which contain an interposon insertion can be identified by expression of its drug resistance. The position of the interposon can be precisely mapped by the restriction sites in the flanking polylinker. To verify their properties we have used these omega derivatives to mutagenize a broad host range plasmid which contains the entire meta-cleavage pathway of the toluene degradation plasmid pWW0 of Pseudomonas putida. Insertion of these interposons in the plasmid between the promoter and the catechol 2,3-dioxygenase (C23O) gene dramatically reduced the expression of this enzyme in Escherichia coli. We also show that when a plasmid containing an omega interposon is transferred by conjugal mobilization from E. coli to P. putida, Agrobacterium tumefaciens, Erwinia chrysanthemi, Paracoccus denitrificans or Rhizobium leguminosarum, the appropriate interposon drug resistance is usually expressed and, compared to the non-mutated plasmid, much reduced levels of C23O activity are detected. Thus, the selection and/or characterization of omega insertional mutations can be carried out in these bacterial species.

DNA Restriction Enzymes↗
PubMed1986

Sequences coding for the ribosomal protein L14 in Xenopus laevis and Xenopus tropicalis; homologies in the 5' untranslated region are shared with other r-protein mRNAs.

In the haploid genome of Xenopus laevis there are two genes coding for the r-protein L14. It is not known if they are located on the same chromosome. cDNA clones deriving from the transcripts of the two genes have been isolated from an oocyte messenger cDNA bank showing that they are both expressed. We have studied the structure of one of the L14 genes by Electron Microscopy, restriction mapping and sequencing. An allelic form of the L14 gene was also isolated. It contains a large deletion covering the 5' end region up to the middle of the third intron. The 5' end of the X. laevis L14 gene was compared to that of the corresponding gene in the closely related species X. tropicalis and found to be highly conserved. The L14 gene has multiple initiation sites, but the large majority of the transcripts start in the middle of a pyrimidine tract not preceded by a canonical TATA box as in other eukaryotic housekeeping genes. The X. laevis L1 and L14 genes have a common decanucleotide in the first exon in the same position with regard to the initiator ATG which just precedes the first intron. The decanucleotide shows homology with the X. laevis 18S rRNA.

Amino Acid Sequence↗
PubMed1990

Transcription mapping of mouse adenovirus type 1 early region 3.

Early region 3 (E3) of mouse adenovirus type 1 was analyzed using S1 nuclease protection and primer extension assays, cDNA sequencing, and genomic sequencing. We present the genomic sequence from 79 to 83 map units of the viral genome, the precise ends and splice sites of the E3 mRNAs, and the predicted protein sequence encoded by the mRNAs. Three major classes of early mRNAs were identified; all were approximately 1 kb long, consisted of three exons, and shared 5' and 3' ends. The three classes had alternative splicing at the junction between the second and third exon. The three proteins predicted by the three mRNAs were slightly similar to the E3 19K glycoprotein of human adenovirus type 3; the longest of the three was the most similar. Open reading frames corresponding to late proteins were also identified in the translated mouse adenovirus type 1 DNA sequence. In mouse adenovirus, as in the human adenoviruses, L4 overlaps E3, and L5 starts just downstream of the E3 region.

Adenovirus Early Proteins↗
PubMed1989

Analysis of mRNA heterogeneity by ribonuclease H mapping: application to the insulin receptor.

The major species of human insulin receptor mRNA (5.9, 7.5, 8.5 and 10.2 kb) and those in rat tissues (7.4 and 9.6 kb) are each much larger than the 4.2 kb required to encode the insulin receptor precursor. To evaluate the structural basis for this mRNA size heterogeneity, we performed a ribonuclease H mapping technique. A small insulin receptor cDNA insert was annealed to human and rat poly(A) RNA, followed by site-specific enzymatic cleavage with ribonuclease H. Subsequent Northern blot analysis with cDNA probes specific to the 5' end of the cDNA revealed a single fragment from each of the human and rat insulin receptor mRNA species. The size of this fragment indicated that each mRNA contains approximately 0.4 kb of 5' untranslated mRNA. In contrast, a 3' region probe demonstrated multiple mRNA fragments after cleavage. The sizes of these fragments indicated that the human insulin receptor mRNA species contain from 1.5 to 5.4 kb, and the rat insulin receptor mRNAs either 2.8 or 5.3 kb, of 3' untranslated RNA. Thus, the presence of varied, but extensive, 3' untranslated sequences in insulin receptor mRNA transcripts accounts for their size heterogeneity and may affect mRNA stability and/or translation efficiency.

Animals↗
PubMed2005

The positional, structural, and sequence requirements of the Drosophila TLS RNA localization element.

The subcellular localization of mRNAs is a key step in the polarization of cells in organisms from yeast to man. Here, we use a transgenic fly/in situ hybridization assay system to define the positional, structural, and sequence requirements of the TLS, a stem loop RNA sequence element that mediates the subcellular localization of K10 and Orb transcripts in Drosophila oocytes. We find that the TLS is a highly robust and modular element. It mediates efficient RNA localization regardless of sequence context or position within the transcript. Site-specific mutagenesis experiments indicate that the size and shape of the stem and loop regions are critical determinants of TLS activity. Such experiments also identify specific base residues that are important for TLS activity. All such residues map to the stem portion of the structure. Significantly, mutations at these residues interfere with TLS activity only when they alter the stereochemistry of the stem's minor groove. For example, mutation of the A:U base pair at position 3 of the TLS stem to G:C severely reduces TLS activity, while mutation of the same base pair to U:A has no effect. Extensive searches for TLS-like elements in other Drosophila mRNAs using sequence and structural parameters defined by our experiments indicate that the TLS is unique to K10 and Orb mRNAs. This unexpected finding raises important questions as to how the many hundreds of other mRNAs that are known or thought to exhibit K10 and Orb-like localization are localized.

Amino Acid Sequence↗