Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “transcript”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 631 records · Page 35Linked to original sources

Constitutive expression of the gene for the cell-specific p48 DNA-binding subunit of pancreas transcription factor 1 in cultured cells is under control of binding sites for transcription factors Sp1 and alphaCbf.

We have cloned and characterized the rat gene that encodes the p48 DNA-binding subunit of pancreas transcription factor 1 (Ptf1), a cell-specific basic region helix-loop-helix (bHLH) protein. The ptf1-p48 gene measures 1.8 kilobases in size and occurs as a single copy in the haploid genome. Run-on transcription assays suggest that this gene is subject to transcriptional control since no activity of its promoter is detected in nonproducing cells. The gene specifies two mRNAs that encode the same protein and originate from transcription initiation at alternative sites. Expression analysis of hybrid genes bearing deletions of the gene's 5'-flanking region fused to a reporter gene defines a promoter region within the gene-proximal 260 base pairs of DNA. The cis-acting elements that control promoter activity include binding sites for transcription factors Sp1 and alphaCbf, a 60-kDa CCAAT box-binding protein. The gene promoter, however, functions not only in exocrine pancreatic cells but also in cells of other origin. No cell-specific transcriptional control element was detected in as much as 10 kilobases of 5'-flanking region. We discuss models of how the cell-specific expression of the endogenous ptf1-p48 gene might be established during development of the animal.

Animals↗

Transcription of human ABO histo-blood group genes is dependent upon binding of transcription factor CBF/NF-Y to minisatellite sequence.

We have studied the transcriptional regulatory mechanism of the human histo-blood group ABO genes, and identified DNA cis-elements and trans-activating protein that control the expression of these genes which are important in blood transfusion and organ transplantation. We introduced the 5'-upstream sequence of ABO genes into the promoterless reporter vector and characterized the promoter activity of deletion constructs using transient transfection assays with gastric cancer cell line KATO III cells. The sequence just upstream of the transcription start site (cap site), and an enhancer element, which is located further upstream (between -3899 and -3618 base pairs (bp) from the transcription initiation site) and contains 4 tandem copies of a 43-bp repeat unit, were shown in gastric cancer cells to be responsible for the transcriptional activity of the ABO genes. DNA binding studies have demonstrated that a transcription factor, CBF/NF-Y, bound to the 43-bp repeat unit in the minisatellite. Functional importance of these CBF/NF-Y-binding sites in enhancer activity was confirmed by transfection experiments using reporter plasmids with mutated binding sites. Thus, transcriptional regulation of the human ABO genes is dependent upon binding of CBF/NF-Y to the minisatellite.

ABO Blood-Group System↗

Human ZFM1 protein is a transcriptional repressor that interacts with the transcription activation domain of stage-specific activator protein.

Stage-specific activator protein (SSAP) is the transcription factor responsible for the activation of the sea urchin late H1 gene at the mid-blastula stage of embryogenesis. SSAP contains an extremely potent transcription activation domain that functions 4-5-fold better than VP16 in a variety of mammalian cell lines. We used the two-hybrid screening technique to identify human cDNAs from an HL60 cell-derived cDNA library that encode proteins that interact with the transcription activation domain of SSAP. One of these cDNAs encodes ZFM1, a protein previously identified at the locus linked to multiple endocrine neoplasia type 1 (MEN1) and as presplicing factor SF1. Functional assays establish the ZFM1 protein as a transcriptional repressor. ZFM1 protein represses Gal4-GQC-mediated transcription, and this activity requires both a repression domain found in the N-terminal 137 amino acids of the protein, as well as a GQC interaction region. The physiological significance of repression mediated by ZFM1 comes from the ability of its specific repression domain to function when fused to Gal4 and tethered to promoters containing Gal4 binding sites. The activity is unique in that activated but not basal transcription levels are affected.

Amino Acid Sequence↗

Dual blockade of cyclic AMP response element- (CRE) and AP-1-directed transcription by CRE-transcription factor decoy oligonucleotide. gene-specific inhibition of tumor growth.

Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins has important therapeutic potential. Synthetic double-stranded phosphorothioate oligonucleotides with high affinity for a target transcription factor can be introduced into cells as decoy cis-elements to bind the factors and alter gene expression. The CRE (cyclic AMP response element)-transcription factor complex is a pleiotropic activator that participates in the induction of a wide variety of cellular and viral genes. Because the CRE cis-element, TGACGTCA, is palindromic, a synthetic single-stranded oligonucleotide composed of the CRE sequence self-hybridizes to form a duplex/hairpin. Herein we report that the CRE-palindromic oligonucleotide can penetrate into cells, compete with CRE enhancers for binding transcription factors, and specifically interfere with CRE- and AP-1-directed transcription in vivo. These oligonucleotides restrained tumor cell proliferation, without affecting the growth of noncancerous cells. This decoy oligonucleotide approach offers great promise as a tool for defining cellular regulatory processes and treating cancer and other diseases.

Blotting, Western↗

p53 negatively regulates cdc2 transcription via the CCAAT-binding NF-Y transcription factor.

The p53 tumor suppressor protein regulates the transcription of regulatory genes involved in cell cycle arrest and apoptosis. We have reported previously that inducible expression of the p53 gene leads to the cell cycle arrest both at G(1) and G(2)/M in association with induction of p21 and reduction of mitotic cyclins (cyclin A and B) and cdc2 mRNA. In this study, we investigated the mechanism by which p53 regulates transcription of the cdc2 gene. Transient transfection analysis showed that wild type p53 represses whereas various dominant negative mutants of p53 increase cdc2 transcription. The cdc2 promoter activity is not repressed in cells transfected with a transactivation mutant, p53(22/23). An adenovirus oncoprotein, E1B-55K inhibits the p53-mediated repression of the cdc2 promoter, while E1B-19K does not. Since the cdc2 promoter does not contain a TATA sequence, we performed deletion and point mutation analyses and identified the inverted CCAAT sequence located at -76 as a cis-acting element for the p53-mediated regulation. We found that a specific DNA-protein complex is formed at the CCAAT sequence and that this complex contains the NF-Y transcription factor. Consistently, a dominant negative mutant of the NF-YA subunit, NF-YAm29, decreases the cdc2 promoter, and p53 does not further decrease the promoter activity in the presence of NF-YAm29. These results suggest that p53 negatively regulates cdc2 transcription and that the NF-Y transcription factor is required for the p53-mediated regulation.

Base Sequence↗

Characterization of human constitutive photomorphogenesis protein 1, a RING finger ubiquitin ligase that interacts with Jun transcription factors and modulates their transcriptional activity.

RING finger proteins have been implicated in many fundamental cellular processes, including the control of gene expression. A key regulator of light-dependent development in Arabidopsis thaliana is the constitutive photomorphogenesis protein 1 (atCOP1), a RING finger protein that plays an essential role in translating light/dark signals into specific changes in gene transcription. atCOP1 binds the basic leucine zipper factor HY5 and suppresses its transcriptional activity through a yet undefined mechanism that results in HY5 degradation in response to darkness. Furthermore, the pleiotropic phenotype of atCOP1 mutants indicates that atCOP1 may be a central regulator of several transcriptional pathways. Here we report the cloning and characterization of the human orthologue of atCOP1. Human COP1 (huCOP1) distributes both to the cytoplasm and the nucleus of cells and shows a striking degree of sequence conservation with atCOP1, suggesting the possibility of a functional conservation as well. In co-immunoprecipitation assays huCOP1 specifically binds basic leucine zipper factors of the Jun family. As a functional consequence of this interaction, expression of huCOP1 in mammalian cells down-regulates c-Jun-dependent transcription and the expression of the AP-1 target genes, urokinase and matrix metalloproteinase 1. The RING domain of huCOP1 displays ubiquitin ligase activity in an autoubiquitination assay in vitro; however, suppression of AP-1-dependent transcription by huCOP1 occurs in the absence of changes in c-Jun protein levels, suggesting that this inhibitory effect is independent of c-Jun degradation. Our findings indicate that huCOP1 is a novel regulator of AP-1-dependent transcription sharing the important properties of Arabidopsis COP1 in the control of gene expression.

Amino Acid Sequence↗

Transcription factors, cAMP-responsive element modulator (CREM) and Tisp40, act in concert in postmeiotic transcriptional regulation.

We previously isolated 80 TISP (transcript induced in spermiogenesis) genes whose transcription is dramatically induced during spermiogenesis. Our analysis here of the expression of these genes in the testis of the cAMP-responsive element modulator (CREM)-null mouse revealed that 54 TISP genes are under the transcriptional regulation of CREM. One CREM-regulated gene is TISP40, which encodes a basic leucine zipper (bZip)-type transcription factor bearing a transmembrane domain that generates the two proteins Tisp40alpha and Tisp40beta. Both of these proteins function by binding to UPRE (unfolded protein-response element) but do not recognize CRE motifs. We show here that Tisp40alpha mRNA is generated under the direct transcriptional regulation of CREM. CREMtau and Tisp40 form a heterodimer, which functions through CRE but not through UPRE. Furthermore, binding ability of CREM to CRE is dramatically up-regulated by forming a heterodimer with Tisp40alphaDeltaTM, a truncated form of Tisp40alpha that lacks the transmembrane domain. We confirmed that Tisp40 and CREM actually bind to the Tisp40 promoter in vivo by chromatin immunoprecipitation assay. Finally, we demonstrate that the Tisp40DeltaTM-CREMtau heterodimer acts as a recruiter of HIRA, a histone chaperone, to CRE. Taken together, we propose that Tisp40 is an important transcriptional regulator during spermiogenesis.

Animals↗

Transcriptional and post-transcriptional control of tubulin gene expression in Trypanosoma cruzi.

We have shown that tubulin mRNA accumulation is regulated at the transcriptional level during metacyclogenesis of Trypanosoma cruzi, although the contribution of post-transcriptional mechanisms is also indicated. mRNA heterogeneity is not restricted to beta-tubulin, and differential regulation of alpha-tubulin mRNAs is observed during this stage of the parasite's life cycle. Treatment of epimastigotes with the microtubule-depolymerizing agent vinblastine resulted in growth inhibition and morphological alterations. Vinblastine also induced a rise in the pool of free tubulin subunits, concomitant with diminished tubulin synthesis and reduced mRNA levels. Tubulin gene transcription remained unaltered during vinblastine treatment, suggesting post-transcriptional control. These observations are in agreement with the autoregulatory model of tubulin gene expression described for a variety of cell types. We conclude that T. cruzi utilizes transcriptional and post-transcriptional control mechanisms for tubulin gene expression.

Animals↗

Identification of a transcript release activity acting on ternary transcription complexes containing murine RNA polymerase I.

Termination of mammalian ribosomal gene transcription by RNA polymerase I (Pol I) requires binding of the nucleolar factor TTF-I (transcription termination factor for Pol I) to specific rDNA terminator elements. We have used recombinant murine TTF-I in an immobilized tailed template assay to analyze individual steps of the termination reaction. We demonstrate that, besides the TTF-I-DNA complex which stops elongating Pol I, an additional activity is required to release both the nascent transcript and Pol I from the template. Moreover, transcript release, but not TTF-I-directed pausing, depends on upstream sequences directly flanking the terminator element. Together, complete termination of Pol I transcription requires TTF-I bound to the terminator DNA, a stretch of thymidine residues upstream of the TTF-I-mediated pause site and an activity which releases the RNA transcript and Pol I from the DNA template.

Animals↗

Determinants of chromatin disruption and transcriptional regulation instigated by the thyroid hormone receptor: hormone-regulated chromatin disruption is not sufficient for transcriptional activation.

Chromatin disruption and transcriptional activation are both thyroid hormone-dependent processes regulated by the heterodimer of thyroid hormone receptor and 9-cis retinoic acid receptor (TR-RXR). In the absence of hormone, TR-RXR binds to nucleosomal DNA, locally disrupts histone-DNA contacts and generates a DNase I-hypersensitive site. Chromatin-bound unliganded TR-RXR silences transcription of the Xenopus TRbetaA gene within a canonical nucleosomal array. On addition of hormone, the receptor directs the extensive further disruption of chromatin structure over several hundred base pairs of DNA and activates transcription. We define a domain of the TR protein necessary for directing this extensive hormone-dependent chromatin disruption. Particular TR-RXR heterodimers containing mutations in this domain are able to bind both hormone and their thyroid hormone receptor recognition element (TRE) within chromatin, yet are unable to direct the extensive hormone-dependent disruption of chromatin or to activate transcription. We distinguish the hormone-dependent disruption of chromatin and transcriptional activation as independently regulated events through the mutagenesis of basal promoter elements and by altering the position and number of TREs within the TRbetaA promoter. Chromatin disruption alone on a minichromosome is shown to be insufficient for transcriptional activation of the TRbetaA gene.

Amino Acid Sequence↗

T cell CD7 mRNA expression is regulated by both transcriptional and post-transcriptional mechanisms.

The CD7 molecule is a 40 kDa member of the Ig superfamily that is acquired early in human T cell ontogeny. Because of the putative three-dimensional structure of CD7 and its presence on T cell precursors, it has been postulated that CD7 serves as an adhesion molecule that facilitates early T cell maturation. Ligand binding to CD7 on mature peripheral blood (PB) T cells has been reported to deliver a co-mitogenic signal with CD3 mAb for T cell triggering. In previous work, we found that CD7 was upregulated on PB T cells following a non-mitogenic ionomycin-induced transmembrane calcium flux, which induced new T cell CD7 transcription without affecting CD7 mRNA stability. In this report, we have studied the upregulation of CD7 expression on PB T cells following stimulation by ionomycin, phytohemagglutinin (PHA), and CD3 mAb. PHA prolonged T cell CD7 mRNA stability without affecting CD7 transcription, while stimulation of PB T cells with CD3 mAb both increased T cell CD7 transcription and prolonged CD7 mRNA stability. Experiments with cycloheximide demonstrated superinduction of T cell CD7 mRNA and showed that new protein synthesis was not required for ionomycin-induced upregulation of T cell CD7 expression. Cyclosporin A inhibited ionomycin-induced T cell CD7 upregulation at the level of CD7 mRNA transcription and elongation. These data demonstrate that ionomycin, PHA, and CD3 mAb act via different mechanisms to increase T cell CD7 expression, and that both transcriptional and post-transcriptional mechanisms are used to modify CD7 mRNA levels.

Antibodies, Monoclonal↗

Involvement of ClpX protein in the post-transcriptional regulation of a competence specific transcription factor, ComK protein, of Bacillus subtilis.

ComK protein of Bacillus subtilis positively regulates the transcription of several late competence genes as well as comK itself. We constructed a clpX disrupted mutant of B. subtilis and studied its effect on the regulation of ComK activation. When Pspac, which controls the comK gene in a multicopy plasmid, was induced by the addition of IPTG, comK transcripts were detected in both the clpX mutant and the wild type. However, the ComK protein could not be detected in the clpX disrupted mutant. To obtain further information, we constructed several comK-lacZ translational fusions covering different lengths of the comK gene, whose transcription is controlled by an IPTG inducible Pspac promoter. We found that both the expression of comK-lacZ directed beta-galactosidase and the accumulation of ComK-LacZ fused protein, derived from the fusion containing the entire comK open reading frame, were extremely reduced in the clpX mutant compared with the wild type, while the accumulation of comK-lacZ transcripts in the clpX mutant after the addition of IPTG was about half that in the clpX+ background. On the other hand, transcription, translation and activity of comK-lacZ were detected in both the clpX mutant and the wild type when the comK-lacZ fusion lacking the 3' region of the comK gene was induced. These results indicate that ClpX plays an important role in the regulation of ComK at the post-transcriptional level.

ATPases Associated with Diverse Cellular Activitie↗

Indole-3-carbinol and 3-3'-diindolylmethane antiproliferative signaling pathways control cell-cycle gene transcription in human breast cancer cells by regulating promoter-Sp1 transcription factor interactions.

Indole-3-carbinol (I3C), a compound that occurs naturally in Brassica vegetables such as cabbage and broccoli, can induce a G1 cell-cycle arrest of human MCF-7 breast cancer cells that is accompanied by the selective inhibition of cyclin-dependent kinase 6 (Cdk6) expression and stimulation of p21(Waf1/Cip1) gene expression. Construction and transfection of a series of promoter-reporter plasmids demonstrate that the indole-regulated changes in Cdk6 and p21(Waf1/Cip1) levels are due to specific effects on their corresponding promoters. Mutagenic analysis reveals that I3C signaling targets a composite transcriptional element in the Cdk6 promoter that requires both Sp1 and Ets transcription factors for transactivation function. Analysis of protein-DNA complexes formed with nuclear proteins isolated from I3C-treated and -untreated cells demonstrates that the Sp1 DNA element in the Cdk6 promoter interacts with an I3C-inhibited protein-protein complex that contains the Sp1 transcription factor. In indole-treated cells, a fraction of [(3)H]I3C was converted into its natural diindole product (3)H-labeled 3-3'-diindolylmethane ([(3)H]DIM), which accumulates in the nucleus; this suggests that DIM may have a role in the transcriptional activities of I3C. Mutagenic analysis of the p21(Waf1/Cip1) promoter reveals that in transfected breast cancer cells, DIM (as well as I3C) stimulates p21(Waf1/Cip1) transcription through an indole-responsive region of the promoter that contains multiple Sp1 consensus sequences. Furthermore, DIM treatment regulates the presence of a nuclear Sp1 DNA-binding activity. Our results demonstrate that both the Cdk6 and p21(Waf1/Cip1) promoters are newly defined downstream targets of the indole-signaling pathway, and that the observed transcriptional effects are due to a combination of the cellular activities of I3C and DIM.

Breast Neoplasms↗

Transcription of the intergenic regions of the tubulin gene cluster of Trypanosoma brucei: evidence for a polycistronic transcription unit in a eukaryote.

The tubulin genes of T. brucei are clustered in a tightly packed array of alternating alpha- and beta-genes. The steady state mRNA contains one abundant mRNA species each for alpha- and beta-tubulin, both carrying the identical 35 nt mini-exon sequence at their 5'-ends. We have used in vitro run-on transcription assays to investigate the mechanism of tubulin gene transcription in T. brucei. Our results show that the regions between the individual tubulin genes are transcribed at the same rate as are the genes themselves. On the other hand, transcripts containing the intergenic regions could not be detected by Northern analysis or in vivo labelling experiments. We conclude that putative transcripts from the intergenic regions have a half-life of less than one minute. These results suggest that the tubulin gene cluster is transcribed as a single contiguous transcription unit yielding a primary transcript which is rapidly processed into individual mRNAs by the polyadenylation and mini-exon trans splicing machineries.

Animals↗

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.

Base Sequence↗

A factor stimulating transcription of the testis-specific Pgk-2 gene recognizes a sequence similar to the binding site for a transcription inhibitor of the somatic-type Pgk-1 gene.

The glycolytic enzyme phosphoglycerate kinase (PGK) consists of two isozymes, somatic-type PGK-1 and testis-specific PGK-2. The isozyme switch from PGK-1 to PGK-2 occurs during spermatogenesis at the mRNA level. The distal upstream region of the gene encoding mouse PGK-2 (Pgk-2) possesses a silencer-like negative cis element. In the present study, a positive cis element located in the proximal upstream region and factor(s) bound to it were analyzed in vitro. Cell-free transcription using nuclear extracts of rat organs demonstrated that the region between nucleotide positions -82 and -64, relative to the most distal transcription initiation site at +1, stimulates transcription in testis extracts. The cis element did not act on the promoter of the thymidine kinase gene, suggesting that it stimulates Pgk-2 transcription in a promoter-specific manner. The cis element bound a nuclear factor(s), which we designated TAP-1. Introducing various base substitutions within the cis element revealed that TAP-1-binding to the element requires the sequence 5'-GGAA-3', which is the binding motif for Ets oncoproteins. We previously reported that TIN-1, a transcription inhibitor of Pgk-1, binds to a sequence similar to the Ets-binding site. The addition of an oligo DNA containing the TIN-1-binding sequence of Pgk-1 prevented TAP-1 from binding to the Pgk-2 cis element, and vice versa. These results suggest that both TIN-1 and TAP-1, which are presumably involved in transcription regulation of the two Pgk genes, recognize DNA sequences related to the Ets-binding motif.

Animals↗

Activation domains of transcription factors mediate replication dependent transcription from a minimal HIV-1 promoter.

Transcription from a minimal HIV-1 promoter containing the three Sp1 binding sites and TATA box can be activated without Tat by template DNA replication. Here we show that this activation can also be mediated by recombinant GAL4 fusion proteins containing the activation domains of Sp1, VP16 or CTF (or by full-length GAL4) targeted to the HIV-1 promoter by replacing the Sp1 sites with five GAL4 binding sites. Thus Sp1 is not unique in its ability to mediate replication activated transcription, although the degree of processivity elicited by the different activators varied significantly from strongly processive (GAL4-VP16) to relatively non-processive (GAL4-Sp1 or -CTF). Processive GAL4-VP16-activated transcription, but not efficient initiation, required multiple GAL4 binding sites. In the presence of Tat, transcription with GAL4-SP1 and GAL4-CTF was further activated (principally at the level of processivity) but GAL4-VP16-potentiated transcription was only slightly stimulated. The Tat-dependent switch from non-processive to fully processive transcription was particularly marked for GAL4-Sp1, an effect which may be relevant to the selection of Sp1 binding sites by the HIV-1 promoter.

Base Sequence↗

A novel snail-related transcription factor Smuc regulates basic helix-loop-helix transcription factor activities via specific E-box motifs.

Snail family proteins are zinc finger transcriptional regulators first identified in Drosophila which play critical roles in cell fate determination. We identified a novel Snail -related gene from murine skeletalmusclecells designated Smuc. Northern blot analysis showed that Smuc was highly expressed in skeletal muscle and thymus. Smuc contains five putative DNA-binding zinc finger domains in its C-terminal half. In electrophoretic mobility shift assays, recombinant zinc finger domains of Smuc specifically bound to CAGGTG and CACCTG E-box motifs (CANNTG). Because basic helix-loop-helix transcription factors (bHLH) bind to the same E-box sequences, we examined whether Smuc competes with the myogenic bHLH factor MyoD for DNA binding. Smuc inhibited the binding of a MyoD-E12 complex to the CACCTG E-box sequence in a dose-dependent manner and suppressed the transcriptional activity of MyoD-E12. When heterologously targeted to the thymidine kinase promoter as fusion proteins with the GAL4 DNA-binding domain, the non-zinc finger domain of Smuc acted as a transcriptional repressor. Furthermore, overexpression of Smuc in myoblasts repressed transactivation of muscle differentiation marker Troponin T. Thus, Smuc might regulate bHLH transcription factors by zinc finger domains competing for E-box binding, and non-zinc finger repressor domains might also confer transcriptional repression to control differentiation processes.

Amino Acid Sequence↗