Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Inverted Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 631 records · Page 35Linked to original sources
PubMed1999

Autogenous regulation of the Bacillus anthracis pag operon.

Protective antigen (PA) is an important component of the edema and lethal toxins produced by Bacillus anthracis. PA is essential for binding the toxins to the target cell receptor and for facilitating translocation of the enzymatic toxin components, edema factor and lethal factor, across the target cell membrane. The structural gene for PA, pagA (previously known as pag), is located on the 182-kb virulence plasmid pXO1 at a locus distinct from the edema factor and lethal factor genes. Here we show that a 300-bp gene located downstream of pagA is cotranscribed with pagA and represses expression of the operon. We have designated this gene pagR (for protective antigen repressor). Two pagA mRNA transcripts were detected in cells producing PA: a short, 2.7-kb transcript corresponding to the pagA gene, and a longer, 4.2-kb transcript representing a bicistronic message derived from pagA and pagR. The 3' end of the short transcript mapped adjacent to an inverted repeat sequence, suggesting that the sequence can act as a transcription terminator. Attenuation of termination at this site results in transcription of pagR. A pagR mutant exhibited increased steady-state levels of pagA mRNA, indicating that pagR negatively controls expression of the operon. Autogenous control of the operon may involve atxA, a trans-acting positive regulator of pagA. The steady-state level of atxA mRNA was also increased in the pagR mutant. The mutant phenotype was complemented by addition of pagR in trans on a multicopy plasmid.

Amino Acid Sequence↗
PubMed1999

Regulation of hexuronate utilization in Bacillus subtilis.

We have identified a locus essential for galacturonate utilization in Bacillus subtilis. Genes homologous to Escherichia coli and Erwinia chrysanthemi glucuronate and galacturonate metabolic genes were found in a cluster consisting of 10 open reading frames (ORFs) in the B. subtilis chromosome. A mutant of B. subtilis containing a replacement of the second and third ORFs was unable to grow with galacturonate as its primary carbon source. Galacturonate induced expression from a sigmaA-dependent promoter, exuP1, located upstream from the first ORF. The eighth ORF in this cluster (the exu locus) encodes a LacI and GalR homolog that negatively regulated expression from exuP1. A 26-bp inverted repeat sequence centered 15 bp downstream from the exuP1 start point of transcription acted in cis to negatively regulate expression from exuP1 under noninducing conditions. Expression from the exuP1 promoter was repressed by high levels of glucose, which is probably mediated by CcpA (catabolite control protein A). A sigmaE-dependent promoter, exuP2, was localized between the second and third ORFs and was active during sporulation.

Aldose-Ketose Isomerases↗
PubMed1999

Partition of the linear plasmid N15: interactions of N15 partition functions with the sop locus of the F plasmid.

A locus close to one end of the linear N15 prophage closely resembles the sop operon which governs partition of the F plasmid; the promoter region contains similar operator sites, and the two putative gene products have extensive amino acid identity with the SopA and -B proteins of F. Our aim was to ascertain whether the N15 sop homologue functions in partition, to identify the centromere site, and to examine possible interchangeability of function with the F Sop system. When expressed at a moderate level, N15 SopA and -B proteins partly stabilize mini-F which lacks its own sop operon but retains the sopC centromere. The stabilization does not depend on increased copy number. Likewise, an N15 mutant with most of its sop operon deleted is partly stabilized by F Sop proteins and fully stabilized by its own. Four inverted repeat sequences similar to those of sopC were located in N15. They are distant from the sop operon and from each other. Two of these were shown to stabilize a mini-F sop deletion mutant when N15 Sop proteins were provided. Provision of the SopA homologue to plasmids with a sopA deletion resulted in further destabilization of the plasmid. The N15 Sop proteins exert effective, but incomplete, repression at the F sop promoter. We conclude that the N15 sop locus determines stable inheritance of the prophage by using dispersed centromere sites. The SopB-centromere and SopA-operator interactions show partial functional overlap between N15 and F. SopA of each plasmid appears to interact with SopB of the other, but in a way that is detrimental to plasmid maintenance.

Amino Acid Sequence↗
PubMed2001

OhrR is a repressor of ohrA, a key organic hydroperoxide resistance determinant in Bacillus subtilis.

Bacillus subtilis displays a complex adaptive response to the presence of reactive oxygen species. To date, most proteins that protect against reactive oxygen species are members of the peroxide-inducible PerR and sigma(B) regulons. We investigated the function of two B. subtilis homologs of the Xanthomonas campestris organic hydroperoxide resistance (ohr) gene. Mutational analyses indicate that both ohrA and ohrB contribute to organic peroxide resistance in B. subtilis, with the OhrA protein playing the more important role in growing cells. Expression of ohrA, but not ohrB, is strongly and specifically induced by organic peroxides. Regulation of ohrA requires the convergently transcribed gene, ohrR, which encodes a member of the MarR family of transcriptional repressors. In an ohrR mutant, ohrA expression is constitutive, whereas expression of the neighboring ohrB gene is unaffected. Selection for mutant strains that are derepressed for ohrA transcription identifies a perfect inverted repeat sequence that is required for OhrR-mediated regulation and likely defines an OhrR binding site. Thus, B. subtilis contains at least three regulons (sigma(B), PerR, and OhrR) that contribute to peroxide stress responses.

Amino Acid Sequence↗
PubMed2002

Identification and physical characterization of the HbpR binding sites of the hbpC and hbpD promoters.

Pseudomonas azelaica HBP1 can use 2-hydroxybiphenyl (2-HBP) and 2,2'-dihydroxybiphenyl as sole carbon and energy sources by means of the hbp regulon. This regulon is composed of three genes, hbpCA and hbpD, coding for enzymes of a meta-cleavage pathway and the hbpR gene, which codes for a XylR/DmpR-type transcription regulator. It was previously shown that HbpR activates transcription from two sigma(54)-dependent promoters, P(hbpC) and P(hbpD), in the presence of 2-HBP. In this study, by using gel mobility shift assays with a purified fusion protein containing calmodulin binding protein (CBP) and HbpR, we detected two binding regions for HbpR in P(hbpC) and one binding region in P(hbpD). DNase I footprints of the proximal binding region of P(hbpC) and of the binding region in P(hbpD) showed that CBP-HbpR protected a region composed of two inverted repeat sequences which were homologous to the binding sites identified for XylR. Unlike the situation in the XylR/P(u) system, we observed simultaneous binding of CBP-HbpR on the two upstream activating sequences (UASs). Fragments with only one UAS did not show an interaction with HbpR, indicating that both pairs of UASs are needed for HbpR binding. The addition of both ATP and 2-HBP increased the DNA binding affinity of HbpR. These results showed for the first time that, for regulators of the XylR/DmpR type, the effector positively affects the recruitment of the regulatory protein on the enhancer DNA.

Adenosine Triphosphate↗
PubMed2002

Characterization of interactions between the transcriptional repressor PhlF and its binding site at the phlA promoter in Pseudomonas fluorescens F113.

The phlACBD genes responsible for the biosynthesis of the antifungal metabolite 2,4-diacetylphloroglucinol (PHL) by the biocontrol strain Pseudomonas fluorescens F113 are regulated at the transcriptional level by the pathway-specific repressor PhlF. Strong evidence suggests that this regulation occurs mainly in the early logarithmic phase of growth. First, the expression of the phlF gene is relatively high between 3 and 13 h of growth and relatively low thereafter, with the phlACBD operon following an opposite expression profile. Second, the kinetics of PHL biosynthesis are specifically altered in the logarithmic phase in a P. fluorescens F113 phlF mutant. The phlA-phlF intergenic region presents a complex organization in that phlACBD is transcribed from a sigma(70) RNA polymerase-dependent promoter that is likely to overlap the promoter of the divergently transcribed phlF gene. The repression by PhlF is due to its interaction with an inverted repeated sequence, phO, located downstream of the phlA transcriptional start site. Cross-linking experiments indicate that PhlF can dimerize in solution, and thus PhlF may bind phO as a dimer or higher-order complex. Furthermore, it is now demonstrated that certain regulators of PHL synthesis act by modulating PhlF binding to phO. PHL, which has previously been shown to be an autoinducer of PHL biosynthesis, interacts with PhlF to destabilize the PhlF-phO complex. Conversely, the PhlF-phO complex is stabilized by the presence of salicylate, which has been shown to be an inhibitor of phlA expression.

Bacterial Proteins↗
PubMed2002

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Amino Acid Sequence↗
PubMed1978

Mapping early transcripts of herpes simplex virus type 1 by electron microscopy.

RNA displacement loop patterns in intact herpes simplex virus DNA and herpes simplex virus DNA restriction fragments indicate that viral RNA associated with polyribosomes early after infection is transcribed from three major areas of the genome. One area of early transcription is in the short segment of the viral DNA and is roughly delineated by the inverted repeat sequences bounding this segment. The other two areas of early mRNA transcription map in the long segment. Each of three major areas of early mRNA transcription can be further resolved into several regions of freqent looping bordered by regions in which RNA displacement loops are rare. These regions range in size from about 1.5 kilobases to about 9 kilobases with a mean size of about 3.5 kilobases. Although the data do not allow precise assignment of individual early gene locations, it is seen, even at the lowest level of resolution, that the early genes are not completely contiguous but are distributed along the length of the herpes simplex type 1 viral genome.

DNA Restriction Enzymes↗
PubMed1979

Intermolecular duplexes formed from polyadenylylated vaccinia virus RNA.

Approximately 15% of the polyadenylic acid-containing cytoplasmic RNA labeled from 5 to 7 h after vaccinia virus infection formed intermolecular duplex structures characterized as double-stranded RNA by RNase resistance, density in Cs2SO4, base composition, chromatography on cellulose, and ability to inhibit reticulocyte cell-free protein synthesis. Both sucrose gradient sedimentation and electron microscopic analysis indicated that the double-stranded regions were several hundred to more than a thousand nucleotide base pairs long. The double-stranded RNA, after denaturation, hybridized to approximately 25% of the vaccinia virus genome, whereas total late RNA hybridized to 42%. The finding that the duplex RNA, after denaturation, hybridized to most HindIII restriction endonuclease fragments of vaccinia virus DNA indicated that symmetrical transcription is not confined to the terminal inverted repeat sequence or to one contiguous region of the genome. Although relatively little labeled, early, polyadenylic acid-containing RNA formed RNase-resistant hybrids upon self-annealing, the percentage increased upon addition of unlabeled late RNA, indicating that the latter contains "anti-early" sequences.

HeLa Cells↗
PubMed1985

Genomic expansion of Marek's disease virus DNA is associated with serial in vitro passage.

An EcoRI restriction endonuclease pattern of Md11 virus DNA, a very virulent strain of Marek's disease virus (MDV), was obtained by using total cellular DNA from infected cells. With the EcoRI restriction endonuclease pattern and a published BamHI map of MDV (Fukuchi et al., J. Virol. 51:102-109), we constructed a partial EcoRI map of a series of MDV clones (gift from H. J. Kung). The clones were used to identify a region of the Md11 genome which is altered as the oncogenic virus is passaged in vitro. This region was mapped into a 1.8-kilobase segment in the inverted-repeat sequences flanking the long unique region of the virus genome. The alteration appeared to result from multiple DNA insertions that produced an increase of 0.6 to 5.4 kilobases. Although the expansion of this region did not diminish the ability of MDV to replicate in vitro, it may be associated with the loss of Marek's disease oncogenicity.

Animals↗
PubMed1985

Formation of a cruciform structure at the simian virus 40 replication origin abolishes T-antigen binding to the origin in vitro.

Heteroduplex DNA molecules were formed by annealing an intact simian virus replication origin-containing fragment to a mutant derivative lacking the indigenous wild-type 27-base-pair (bp) inverted repeat within this structure and containing a nonhomologous 26-bp inverted repeat sequence in its place. Results of restriction enzyme and S1 endonuclease cleavage analyses strongly suggested that a 13-bp stem-loop structure formed at the site of nonhomology between these two DNAs. This structure lies within the boundary of simian virus 40 T-antigen-binding site 2, and its presence inhibited T-antigen binding to that sequence but not to an adjacent higher-affinity binding site (site 1). Therefore, the conformation of sequences within an otherwise intact T-antigen-binding site can have major effects upon T-antigen binding there.

Antigens, Viral, Tumor↗
PubMed1987

Resolution of a polyomavirus-mouse hybrid replicon: release of genomic viral DNA.

RmI is a circular chimera containing 1.03 copies of polyomavirus DNA and 1,628 base pairs of mouse DNA, joined through direct and inverted repeat sequences. It is excised from the chromosome of a transformed cell via a site-specific recombination event that is dependent on the activation of the viral gene coding for large T antigen. RmI is shown here to be highly infectious for normal mouse cells. This infectivity reflects the ability of RmI to effectively yield unit-length viral DNA via intramolecular recombination. The effectiveness with which infectious viral DNA is produced from RmI is consistent with the idea that the underlying recombination event is site specific, rather than homologous or illegitimate.

Animals↗
PubMed1992

In vitro resolution of poxvirus replicative intermediates into linear minichromosomes with hairpin termini by a virally induced Holliday junction endonuclease.

Available evidence suggests that one or more late viral gene products are involved in processing poxvirus replicative intermediates into mature progeny hairpin-terminated genomes. Cloned versions of the Shope fibroma virus (SFV) replicated telomere in the inverted repeat configuration were used as substrates to assay lysates from poxvirus-infected cells for protein fractions that participate in the resolution of the circular substrate plasmid into a linear minichromosome with viral hairpin termini. An activity in a crude protein fraction obtained from vaccinia virus-infected cells at late times during the replicative cycle was capable of accurately resolving all poxviral inverted repeat replicative intermediates tested. The resolved linear products are identical to the products of in vivo resolution and possessed symmetrical nicks which mapped at the borders of the inverted repeat sequence. Strand-specific nicks were also identified, which mapped within the telomere resolution target sequence known to be required for telomere resolution in vivo. The resolving activity that we have identified is specific to virus-infected cells at late times during replication and cleaves cloned poxviral telomeric substrates in a fashion expected of a classic Holliday junction-resolving enzyme in addition to possessing a telomere resolution target-specific nicking activity. Although a Holliday junction-resolving activity would also be expected to play a role in the recombination induced by poxvirus infection, the appearance of the activity described here only after the commencement of viral late protein synthesis suggests that it functions strictly at late times. Other non-viral Holliday junction analogs can also be cleaved by this extract, suggesting that this component of the resolution activity may also play a role in other viral processes that require cleavage of a branched DNA structure. Thus, we have identified a poxviral activity that may be a part of a protein complex which resolves concatemeric replicative intermediates of viral DNA as well as participate in general recombination late during infection.

Animals↗
PubMed1995

The regulation of synthesis and properties of the protein product of open reading frame P of the herpes simplex virus 1 genome.

Open reading frame P (ORF P) maps in the inverted repeat sequence ab and b'a' flanking the long unique (UL) sequence of the herpes simplex virus 1 genome, within the sequence reported to be transcribed during latent infection of sensory neurons. Both the protein and the RNA were previously reported to be expressed only in cells infected with a deletion mutant or with a mutant carrying a ts lesion in the alpha 4 gene encoding the infected cell protein no. 4 (ICP4), a major regulatory protein of the virus. In this report we show that (i) disruption of the ICP4 DNA binding site by replacement mutagenesis resulted in the overexpression of ORF P protein even at permissive temperatures, leading to productive infection; (ii) the expression of ORF P does not require prior viral protein synthesis; (iii) late in infection the ORF protein P is processed into multiple forms characterized by a slower electrophoretic mobility in denaturing gels; (iv) ORF P protein accumulates in nuclei of infected cells; and (v) in some nuclei of infected cells, ORF P protein is organized in the form of rods traversing the nucleus from the basolateral to the apical side. We conclude that ORF P has many of the properties predictive of a viral gene group, which we designate pre-alpha. Specifically, these could be induced by the alpha transinducing factor (also known as VP16) carried in the virion; they would be firmly shut off by the onset of expression of alpha genes required for productive infection; and in the absence of repressive effects of ICP4, their expression could be dependent on the number of viral DNA copies available for transcription. Finally, the productively infected cell would evolve a way of disposing excess pre-alpha proteins by posttranslational processing.

Base Sequence↗
PubMed1996

Multiple regulatory events influence human cytomegalovirus DNA polymerase (UL54) expression during viral infection.

The human cytomegalovirus (HCMV) DNA polymerase gene (UL54; also called pol) is a prototypical early gene in that expression is mandatory for viral DNA replication. Recently, we have identified the major regulatory element in the UL54 promoter responsive to the major immediate early (MIE) proteins (UL122 and UL123) (J.A. Kerry, M.A. Priddy, and R. M. Stenberg, J. Virol. 68:4167-4176, 1994). Mutation of this element, inverted repeat sequence 1 (IR1), abrogates binding of cellular proteins to the UL54 promoter and reduces promoter activity in response to viral proteins in transient-transfection assays. To extend our studies on the UL54 promoter, we aimed to examine the role of IR1 in UL54 regulation throughout the course of infection. These studies show that viral proteins in addition to the MIE proteins can activate the UL54 promoter. Proteins from UL112-113 and IRS1/TRS1, recently identified as essential loci for transient complementation of HCMV oriLyt-dependent DNA replication, were found to function as transactivators of the UL54 promoter in association with MIE proteins. UL112-113 enhanced UL54 promoter activation by MIE proteins three- to fourfold. Constitutive expression of UL112-113 demonstrated that the MIE protein dependence of UL112-113 transactivational activity was not related to activation of cognate promoter sequences, suggesting that UL112-113 proteins function in cooperation with the MIE proteins. Mutation of IR1 was found to abrogate stimulation of the UL54 promoter by UL112-113, suggesting that this element is also involved in UL112-113 stimulatory activity. These results demonstrate that additional viral proteins influence UL54 promoter expression in transient-transfection assays via the IR1 element. To confirm the biological relevance of IR1 in regulating UL54 promoter activity during viral infection, a recombinant virus construct containing the UL54 promoter with a mutated IR1 element regulating expression of the chloramphenicol acetyltransferase (CAT) reporter gene (RVIRmCAT) was generated. Analysis of RVIRmCAT revealed that mutation of IR1 dramatically reduces UL54 promoter activity at early times after infection. However, at late times after infection CAT expression by RVIRmCAT, as assessed by RNA and protein levels, was approximately equivalent to expression by wild-type RVpolCAT. These data demonstrate IR1-independent regulation of the UL54 promoter at late times after infection. Together these results show that multiple regulatory events affect UL54 promoter expression during the course of infection.

Base Sequence↗
PubMed1991

Specific binding of chloroplast proteins in vitro to the 3' untranslated region of spinach chloroplast petD mRNA.

A detailed analysis of RNA-protein complex formation in the 3' untranslated region of spinach chloroplast petD mRNA has been carried out. Five chloroplast proteins that interact with petD RNA in this region, which contains an inverted repeat sequence capable of forming a hairpin structure, have been identified. A 33-kDa protein recognizes specifically the double-stranded stem of the hairpin structure; mutations that disrupt base pairing at the base of the stem reduce or eliminate protein binding. A 57-kDa protein recognizes specifically an AU-rich sequence motif that is highly conserved in petD genes of different higher plant species. The 57-kDa protein and possibly the 33-kDa protein form stable complexes with petD RNA in vitro and may interact with each other. In addition, their interaction with petD RNA is highly sensitive to heparin. The three other proteins, of 100, 32, and 28 kDa, display little sequence or structural binding specificity apart from their preference for uridine-rich sequences. They also interact with the 3' untranslated regions of other chloroplast RNAs such as those of psbA and rbcL. The functions of these proteins in the regulation of petD gene expression, including possible roles in transcription termination and RNA stability, are discussed.

Base Composition↗
PubMed2004

Recruitment of the Swi/Snf complex by Ste12-Tec1 promotes Flo8-Mss11-mediated activation of STA1 expression.

In the yeast Saccharomyces diastaticus, expression of the STA1 gene, which encodes an extracellular glucoamylase, is activated by the specific DNA-binding activators Flo8, Mss11, Ste12, and Tec1 and the Swi/Snf chromatin-remodeling complex. Here we show that Flo8 interacts physically and functionally with Mss11. Flo8 and Mss11 bind cooperatively to the inverted repeat sequence TTTGC-n-GCAAA (n = 97) in UAS1-2 of the STA1 promoter. In addition, Flo8 and Mss11 bind indirectly to UAS2-1 of the STA1 promoter by interacting with Ste12 and Tec1, which bind to the filamentation and invasion response element (FRE) in UAS2-1. Furthermore, our findings indicate that the Ste12, Tec1, Flo8, and Mss11 activators and the Swi/Snf complex bind sequentially to the STA1 promoter, as follows: Ste12 and Tec1 bind first to the FRE, whereby they recruit the Swi/Snf complex to the STA1 promoter. Next, the Swi/Snf complex enhances Flo8 and Mss11 binding to UAS1-2. In the final step, Flo8 and Mss11 directly promote association of RNA polymerase II with the STA1 promoter to activate STA1 expression. In the absence of glucose, the levels of Flo8 and Tec1 are greatly increased, whereas the abundances of two repressors, Nrg1 and Sfl1, are reduced, suggesting that the balance of transcriptional regulators may be important for determining activation or repression of STA1 expression.

DNA, Fungal↗
PubMed1987

Roles of the 2 microns gene products in stable maintenance of the 2 microns plasmid of Saccharomyces cerevisiae.

We have examined the replication and segregation of the Saccharomyces cerevisiae 2 microns circle. The amplification of the plasmid at low copy numbers requires site-specific recombination between the 2 microns inverted repeat sequences catalyzed by the plasmid-encoded FLP gene. No other 2 microns gene products are required. The overexpression of FLP in a strain carrying endogenous 2 microns leads to uncontrolled plasmid replication, longer cell cycles, and cell death. Two different assays show that the level of Flp activity decreases with increasing 2 microns copy number. This regulation requires the products of the REP1 and REP2 genes. These gene products also act together to ensure that 2 microns molecules are randomly segregated between mother and daughter cells at cell division.

DNA Replication↗