Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA Fragmentation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 631 records · Page 35Linked to original sources
PubMed1989

Attachment of a 40-base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes.

Denaturing gradient gel electrophoresis (DGGE) can be used to distinguish two DNA molecules that differ by as little as a single-base substitution. This method detects approximately 50% of all possible single-base changes in DNA fragments ranging from 50 to approximately 1000 base pairs. To increase the number of single-base changes that can be distinguished by DGGE, we used the polymerase chain reaction to attach a 40-base-pair G + C-rich sequence, designated a GC-clamp, to one end of amplified DNA fragments that encompass regions of the mouse and human beta-globin genes. We show that this GC-clamp allows the detection of mutations, including the hemoglobin sickle (HbS) and hemoglobin C (HbC) mutations within the human beta-globin gene, that were previously indistinguishable by DGGE. In addition to providing an easy way to attach a GC-clamp to genomic DNA fragments, the polymerase chain reaction technique greatly increases the sensitivity of DGGE. With this approach, DNA fragments derived from less than 5 ng of human genomic DNA can be detected by ethidium bromide staining of the gel, obviating the need for radioactive probes. These improvements extend the applicability of DGGE for the detection of polymorphisms and mutations in genomic and cloned DNA.

Animals↗
PubMed2007

Activation of Prn-p gene and stable transfection of Prn-p cDNA in leukemia MEL and neuroblastoma N2a cells increased production of PrP(C) but not prevented DNA fragmentation initiated by serum deprivation.

Prion protein (PrP(C)) via its isoform PrP(SC) is involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). We observed that murine erythroleukemia (MEL) cells arrested in phase G(1) undergo transcriptional activation of Prn-p gene. Here, we explored the potential role of activation of Prn-p gene and cytosolic accumulation of PrP(C) in growth arrest, differentiation, and apoptotic DNA fragmentation by stably transfecting MEL and N2a cells with Prn-p cDNA. Stably transfected MEL cells (clones # 6, 12, 20, 38, and 42) were assessed for growth and differentiation, while clones N2a13 and N2a8 of N2a cells for growth and apoptosis by flow cytometry using Annexin V and propidium iodide (PI). Our results indicate that (a) Induction of terminal differentiation of stably transfected MEL cells led to growth arrest, activation of Prn-p gene, concomitant expression of transfected Prn-p cDNA, suppression of bax gene, cytosolic accumulation of PrP(C), and DNA fragmentation. The latter was also induced in non-differentiated MEL cells growing under serum-free conditions; (b) similarly, serum deprivation promoted growth arrest, apoptosis/necrosis associated with DNA fragmentation in parental N2a and N2a13 cells that produced relative high level of PrP(C) and not PrP(SC). These data indicate that activation of Prn-p gene and expression of transfected Prn-p cDNA in cells of both hematopoietic and neuronal origin occurred concomitantly, and led to cytosolic accumulation of PrP(C) and DNA damage induced by serum deprivation. PrP(C) production failed to protect DNA fragmentation induced by serum deprivation. The question how does PrP(C) contribute to growth arrest and DNA fragmentation is discussed.

Animals↗
PubMed2001

Caspase 3 inhibition attenuates hydrogen peroxide-induced DNA fragmentation but not cell death in neuronal PC12 cells.

Exposure of neurons to H(2)O(2) results in both necrosis and apoptosis. Caspases play a pivotal role in apoptosis, but exactly how they are involved in H(2)O(2)-mediated cell death is unknown. We examined H(2)O(2)-induced toxicity in neuronal PC12 cells and the effects of inducible overexpression of the H(2)O(2)-scavenging enzyme catalase on this process. H(2)O(2) caused cell death in a time- and concentration-dependent manner. Cell death induced by H(2)O(2) was found to be mediated in part through an apoptotic pathway as H(2)O(2)-treated cells exhibited cell shrinkage, nuclear condensation and marked DNA fragmentation. H(2)O(2) also triggered activation of caspase 3. Genetic up-regulation of catalase not only significantly reduced cell death but also suppressed caspase 3 activity and DNA fragmentation. While the caspase 3 inhibitor DEVD inhibited both caspase 3 activity and DNA fragmentation induced by H(2)O(2) it did not prevent cell death. Treatment with the general caspase inhibitor ZVAD, however, resulted in complete attenuation of H(2)O(2)-mediated cellular toxicity. These results suggest that DNA fragmentation induced by H(2)O(2) is attributable to caspase 3 activation and that H(2)O(2) may be critical for signaling leading to apoptosis. However, unlike inducibly increased catalase expression and general caspase inhibition both of which protect cells from cytotoxicity, caspase 3 inhibition alone did not improve cell survival suggesting that prevention of DNA fragmentation is insufficient to prevent H(2)O(2)-mediated cell death.

Animals↗
PubMed1995

Fas antigen-mediated DNA fragmentation and apoptotic morphologic changes are regulated by elevated cytosolic Ca2+ level.

More than 80% of cells of the human B cell line FMO, which expresses the Fas Ag, underwent apoptosis within 2 h after addition of an anti-Fas mAb. Rises in cytosolic Ca2+ concentration ([Ca2+]i) and their effects were investigated by imaging individual cells continuously and introducing Ca2+ chelators to the outside and/or inside of the cell. The typical Ca2+ response consisted of 1) an early [Ca2+]i rise (basal [Ca2+]i, 85 to 110 nM; peak, 140 to 200 nM; duration, 15 to 20 min), 2) sustained elevation of [Ca2+]i at 140 to 150 nM, 3) a second Ca2+ rise (200 to 500 nM, 15 to 30 min) between 1.5 and 2 h, and 4) a large [Ca2+]i rise (1.2 to 2.0 microM) between 2 and 4 h after addition of mAb. Responses 1, 3, and 4 were mainly caused by Ca2+ entry, and response 2 involved intracellular Ca2+ release from stores. Apoptosis could be induced by mAb even in Ca(2+)-deprived external medium. Chelating cytosolic Ca2+ revealed that the [Ca2+]i rise is a prerequisite for fragmentation of DNA and chromatin, and is also necessary for fragmentation of cells. The critical [Ca2+]i was 140 to 150 nM and a sustained [Ca2+]i rise was more effective. A [Ca2+]i rise itself (without mAb) was ineffective. About 20% of mAb-treated cells showed chromatin condensation at the periphery of the nucleus (possibly an earlier stage of nuclear change) and a bubble-like cell shape even when [Ca2+]i was held below 100 nM. Thus, Ca2+ is mobilized immediately after Fas stimulation and functions as a key factor causing advanced apoptotic changes. Response 4 was related to secondary necrosis.

Antibodies, Monoclonal↗
PubMed1992

Ca(++)-activated DNA fragmentation and dimethylnitrosamine-induced hepatic necrosis: effects of Ca(++)-endonuclease and poly(ADP-ribose) polymerase inhibitors in mice.

Several hepatotoxic agents damage Ca++ regulation and produce toxic cell death in a manner consistent with a cause-and-effect relationship; however, vital targets of Ca++ remain unidentified. Recent results show that DNA may be the chief Ca++ target during apoptosis, a form of cell death considered distinct from toxic cell death or necrosis. The present studies explored whether nuclear Ca++ regulation is lost before dimethylnitrosamine-induced necrosis, whether DNA is attacked by Ca(++)-dependent endonucleases and whether inhibitors of Ca(++)-endonuclease activity and the DNA repair enzyme poly(ADP-ribose)polymerase affect necrosis. Adult male ICR mice received 100 mg/kg of dimethylnitrosamine i.p. By 2 to 4 hr, total nuclear Ca++ reached 150 to 180% of control and DNA fragmentation was 140 to 170% of control. Electrophoresis of DNA revealed a sharp decline in genomic DNA with the appearance of DNA fragments in a ladder-like pattern. Ca++ elevation and DNA fragmentation preceded toxic cell death by 4 hr or more and reached peak values at 18 to 24 hr, coincident with maximal alanine aminotransferase leakage. Aurintricarboxylic acid, a Ca(++)-endonuclease inhibitor, reduced toxicity 67%. 3-Aminobenzamide, nicotinamide adenine dinucleotide and theophylline, inhibitors of poly(ADP-ribose)polymerase-mediated DNA repair, potentiated liver damage 2-fold. These results support the hypothesis that DNA fragmentation plays a contributing role in toxic cell death induced by dimethylnitrosamine. Furthermore, the findings suggest that new opportunities may exist to moderate the toxicity of alkylating hepatotoxins by altering DNA regulation.

Animals↗
PubMed2003

Protein kinase C inhibition induces DNA fragmentation in COLO 205 cells which is blocked by cysteine protease inhibition but not mediated through caspase-3.

Enhancing apoptosis to remove abnormal cells has potential in reversing cancerous processes. Caspase-3 activation generally accompanies apoptosis and its substrates include enzymes responsible for DNA fragmentation and isozymes of protein kinase C (PKC). Recent data, however, question its obligatory role in apoptosis. We have examined whether modulation of PKC activity induces apoptosis in COLO 205 cells and the role of caspase-3. Proliferation ([3H]thymidine) and apoptosis (DNA fragmentation and FACS) of COLO 205 cells were measured in response to PKC activation and inhibition. Caspase-3 activity was assayed and the effects of its inhibition with Ac-DEVD-cmk, and the effect of other protease inhibitors, on apoptosis were determined. PKC activation and inhibition both reduced DNA synthesis and induced DNA fragmentation. As PKC inhibitors induced DNA fragmentation more rapidly than PKC activators and failed to block activator effects, we conclude that it is PKC down-regulation (i.e., inhibition) after activator exposure that mediates apoptosis. Increases in caspase-3 activity occurred during apoptosis but apoptosis was not blocked by caspase inhibition. By contrast, the cysteine protease inhibitor, E-64d, blocked apoptosis. Cysteine proteases not of the caspase family may either act more closely to the apoptotic process than caspases or lie on an alternative, more active pathway.

Aged↗
PubMed1994

Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco.

Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.

Base Sequence↗
PubMed1998

Exogenous nitric oxide enhances neutrophil cell death and DNA fragmentation.

Inhaled nitric oxide (NO) is an important new therapeutic agent used to treat pulmonary arterial hypertension in a variety of disease states. However, the effects of NO on cells in the lung are uncertain. Previously, we have shown that NO gas depresses neutrophil oxidative cell function and increases neutrophil cell death. The purpose of this in vitro study was to determine the mechanism of neutrophil death. We hypothesized that NO hastened cell death by inducing apoptosis. To mimic the clinical environment of patients with respiratory failure, we also studied the effects of hyperoxia on neutrophil cell viability and apoptosis. Isolated human neutrophils were exposed to 80% O2 (O2), NO at 20 ppm in room air (NO/RA), 20 ppm NO blended with 80% O2 (NO/O2), or RA alone (control) for 2 to 24 h. Experiments were repeated with NO concentrations of 5 and 50 ppm and with 20 ppm in the presence of superoxide dismutase (SOD). Neutrophils were also incubated in the absence or presence of neutrophil stimulant fMLP (10 nM). Neutrophil cell viability was measured by fluorescence viability/cytotoxicity assay. Neutrophil apoptosis was assessed by cell death detection ELISA for histone-associated DNA fragments, TdT transferase-mediated fluorescence-labeled dUTP nick end labeling (TUNEL) assay, and DNA fragmentation gel electrophoresis. NO/O2-exposed neutrophils showed decreased viability at 2 h (31.7 +/- 3.7%, mean % viability +/- SD) compared with control (94.7 +/- 4.7%), O2 (75.6 +/- 9.3%), and NO/RA (62.8 +/- 14.9%; P < 0.05 by ANOVA; n = 9). Although control neutrophils demonstrated marked apoptosis at 24 h, there was no significant apoptosis at 2, 4, or 6 h (P < 0.001 by Kruskal-Wallis, n = 20) as assessed by ELISA and TUNEL assays. When compared with RA controls at 2 h, neutrophils exposed to NO/O2 showed significantly more apoptosis (292% of control, range: 106 to 2,488%, P < 0.001 by ANOVA and Kruskal-Wallis) but not with exposure to NO/RA or O2 alone. These findings were confirmed by TUNEL assay (n = 4, P < 0.05). NO/ RA and NO/O2-exposed neutrophils demonstrated both evidence of necrosis and enhanced DNA fragmentation at 2 h by gel electrophoresis (n = 2). Fifty parts per million NO produced similar findings, but exposure to 5 ppm NO did not induce significant DNA fragmentation. Coincubation with SOD inhibited NO/ O2-associated apoptosis, suggesting peroxynitrite contributed to cell death. Stimulation with fMLP did not alter apoptosis induced in neutrophils exposed to NO/RA or NO/O2. We conclude that exogenous NO gas, at clinically relevant concentrations under hyperoxic conditions, induces cell death in neutrophils in part by enhancing DNA fragmentation.

Apoptosis↗
PubMed1998

Alzheimer disease: DNA fragmentation indicates increased neuronal vulnerability, but not apoptosis.

Although nerve cell loss is prominent in certain brain regions in Alzheimer disease (AD), it is currently unresolved how these cells die. Recent studies unanimously agree that there are more neurons displaying DNA fragmentation in AD compared with normal controls. However, controversy remains as to whether cell death is mediated by apoptosis or necrosis. We addressed this question by comparing AD lesions with those from cases with pontosubicular neuron necrosis (PSNN), a human pathological condition with unequivocal neuronal apoptosis, with regard to cell and nuclear morphology, immunohistochemistry, and in situ tailing. Immunohistochemistry was performed for an array of proteins with presumptive roles in the apoptotic process or the protection thereof, i.e. a recently described apoptosis-specific protein (ASP), the transcription factor c-Jun, Bcl-2, and various stress proteins: alpha B-Crystallin, heat shock protein (HSP) 27, HSP 65, HSP 70, HSP 90, and ubiquitin. Apoptotic neurons in PSNN displayed chromatin condensation, nuclear fragmentation, and cytoplasmic condensation. They were labeled with the in situ tailing technique and stained for the ASP. Despite the large numbers of cells with DNA fragmentation identified in the hippocampus of AD brains, only exceptional cells displayed the morphological characteristics of apoptosis or labeled for the ASP. We suggest that the increased rate of neuronal DNA fragmentation in AD patients indicates a higher susceptibility of the cells to metabolic disturbances compared with normal controls. The large number of cells with DNA fragmentation most likely reflects metabolic disturbances in the premortem period, and cell destruction is mediated through necrosis rather than apoptosis.

Aged↗
PubMed2003

DNA fragmentation and detachment of enterocytes induced by anti-CD3 mAb-activated intraepithelial lymphocytes.

To elucidate the role of intraepithelial lymphocytes (IEL) and enterocytes in the defense mechanism of the small intestine, we designed experiments to stimulate the IEL by anti-CD3epsilon, anti-TCRalphabeta, or anti-TCRgammadelta monoclonal antibodies (mAbs), and to examine the subsequent changes to the enterocytes. The enterocytes of the duodenum and jejunum, but not of the ileum, showed massive DNA fragmentation 30 min after intraperitoneal injection of anti-CD3 mAb. These responses were also induced by anti-TCRgammadelta mAb, but not by anti-TCRalphabeta mAb, and were completely inhibited by cyclosporin A. Nearly half of the enterocytes of the villi in the duodenum and jejunum were exfoliated into the lumen 4 h after the injection of the mAb. Administration of anti-CD3 mAb also induced DNA fragmentation in Fas-deficient MRL/lpr mice, indicating that the Fas-Fas ligand system was not involved in these events. The anti-CD3 mAb treatment also induced massive DNA fragmentation in the intestinal epithelium of the duodenum and jejunum in TNF-receptor-1-deficient mice, whereas TNF-alpha induced only the detachment of intestinal epithelium of wild-type mice, implying the dissociation of two independent factors and/or mechanisms for DNA fragmentation and the subsequent epithelial cell detachment in the murine duodenum and jejunum. The mAb failed to exfoliate the epithelium in TNF-R1-deficient mice. Thus, TCRgammadelta(+) IEL, when treated with anti-CD3 or anti-TCRgammadelta mAbs, induced rapid DNA fragmentation and subsequent detachment of the duodenal and jejunal epithelia, but not in the ileum ("the silent ileum"), partly because of the paucity of TCRgammadelta(+) IELs in the ileum.

Animals↗
PubMed1988

Cytotoxic lymphocyte-derived lytic granules do not induce DNA fragmentation in target cells.

When target cells are exposed to CTL, they very quickly sustain nuclear damage, including DNA cleavage, and then they lyse. Nuclear damage of this type is not seen when cells are killed by antibody and C. The role of nuclear damage in the T cell-mediated killing process as well as the mechanism by which the killer cell induces this damage are unknown; however, accumulating evidence suggests that cytolysis may depend on induction of nuclear damage. The exocytosed contents of CTL granules are thought by many workers to mediate target cell lysis. We have now determined whether lytic granules also induce nuclear damage (DNA fragmentation) in cells which they lyse. They do not. In addition, no DNA fragmentation was detected in nuclei incubated with lytic granules or activated CTL. In summary, our results suggest that target cell DNA fragmentation induced by CTL is mediated neither by lytic granules nor by a CTL-derived endonuclease and support the view that the target cell is itself responsible for the internal damage it sustains.

Animals↗
PubMed1996

DNA fragmentation and nuclear endonuclease activity in rat brain after severe closed head injury.

Previous studies have suggested that brain cells undergo apoptotic cell death during several neurodegenerative disorders such as Alzheimer's disease, Parkinsonism and ischemic stroke. In the present study, apoptotic DNA fragmentation and activation of nuclear endonuclease were evaluated in rat brain cells after head trauma. Severe closed head injury was induced in rats by the impact of a 450-g weight dropped from a height of 2 m. A 12% mortality was experienced after head trauma. Brain cell nuclei and DNA were isolated at intervals of 3, 10, 24 h, 3 and 10 days after head trauma. DNA fragmentation was measured by the random oligonucleotide-primed synthesis (ROPS) assay and was significantly increased with the maximum level of DNA fragmentation occurring at 10 h after trauma. The DNA and nuclei yields decreased 10 h after injury and remained at a reduced level at all subsequent sampling intervals. The DNA fragmentation induced after severe head trauma was accompanied by an increase in the activity of the Ca/Mg-dependent endonuclease associated with apoptosis. These data indicate that severe head injury is associated with significant brain cell death by apoptosis.

Animals↗
PubMed2001

[A rapid and simple detection of DNA fragment with point mutation by capillary electrophoresis].

OBJECTIVE: To establish a rapid and simple method with high efficiency in detecting point mutation of genomic DNA. METHODS: Four DNA fragments that were different from each other in only one based were amplified by using primers with artificial point mutation based on the sequence of exon 7 of p53 gene, and then were separated by capillary electrophoresis(CE). The neutral coated capillary and 4% linear polyacrylamide gel buffer were used, and the wave length of ultraviolet detector was 254 nm. RESULTS: A homozygous 196 bp DNA fragment can be separated into one dsDNA peak and two ssDNA peaks within 25 minutes, and the heterozygous 196 bp DNA fragments that were made with mixed wild type and mutated DNA can be separated into one dsDNA peak and three ssDNA peaks. The three ssDNA fragments that differ in one nucleotide can be easily separated with good resolution. CONCLUSION: CE technique is rapid, sensitive, accurate and well reproducible. It is an efficient and reliable method for rapidly screening point mutation.

Base Sequence↗
PubMed1986

Solution structure of a short DNA fragment studied by neutron scattering.

The solution structure of a DNA fragment of 130 base pairs and known sequence has been investigated by neutron small-angle scattering. In 0.1 M NaCl, the overall structure of the DNA fragment which contains the strong promoter A1 of the Escherichia coli phage T7 agrees with that expected for B-DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The results were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional inhomogeneity not detected by X-ray small-angle scattering. This inhomogeneity is caused by the hydration layer around the DNA core and not by the helical structure. The primary solvent shell has a density increased by at least 4-9% compared to bulk water.

Base Composition↗
PubMed1997

Internucleosomal DNA fragmentation is not obligatory for castration induced rat ventral prostate cell apoptosis in vivo.

Castrated male rats were treated with the reversible S1-phase cell cycle blocking drug, mimosine, and the effects of this drug on prostate cell apoptosis was characterized. At a single dose of mimosine (25 mg/kg/day), we found that the internucleosomal DNA fragmentation associated with apoptosis was partially suppressed in the rat ventral prostate at all early time points (24, 48 and 72 h) analyzed post-castration. This suppression was dose-dependent, and treatment with mimosine up to 150 mg/kg/day was sufficient to reduce the internucleosomal DNA fragmentation in the prostate by 90% at 72 h post-castration. Intriguingly, this drug did not suppress the induction of mRNAs for several apoptosis-associated gene products in the ventral prostate gland (bcl-2, p53, TGF-beta and SGP-2/clusterin). Moreover, this treatment did not suppress the histological appearance of apoptotic bodies in the ventral prostate detectable by fast green staining of thin sections of tissue. The apoptotic bodies present in mimosine-treated regressing ventral prostate tissues, however, were refractory to labeling by the in situ gap labeling method, further demonstrating lack of nuclear DNA fragmentation in the condensed nuclei of apoptotic cells. In summary, the cell cycle-blocking drug mimosine does not appear to affect the rate of apoptosis in the regressing rat ventral prostate gland. However, this drug was capable of suppressing the nuclear DNA fragmentation associated with androgen-regulated prostate cell apoptosis. These results support the concept that nuclear DNA fragmentation is not obligatory for apoptosis. Additionally, they imply that cell cycle movement from the G1/S-phase boundary might be important for the terminal DNA degradation associated with androgen-regulated prostate cell apoptosis.

Journal Article↗
PubMed1995

In situ evidence for DNA fragmentation in Huntington's disease striatum and Alzheimer's disease temporal lobes.

To test the hypothesis that apoptosis is involved in human brain neurodegenerative disorders, we investigated whether DNA fragmentation occurs in Alzheimer's disease (AD). Huntington's disease (HD) and Parkinson's disease, as well as in temporal lobe epilepsy, using neurologically normal post-mortem human brain tissue as a control. Using in situ end labelling of DNA, we found evidence of DNA fragmentation in cells in temporal cortex and hippocampus from patients with AD and in striatum from those with HD. In contrast, only scattered DNA fragmentation positive cells were detected in the pial surfaces of some of the neurologically normal human brains. Thus, cells in the HD striatum and AD temporal cortex exhibited DNA fragmentation, suggesting that apoptosis may be involved in these disorders.

Adult↗
PubMed1993

An image analysis technique for detection of radiation-induced DNA fragmentation after CHEF electrophoresis.

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of 3H-thymidine prelabelled DNA in HeLa S3 cells. It is shown that the image analysis-based fluorescence detection of fragmented DNA after ionizing radiation is as sensitive and reproducible as detection using radioactively prelabelled cells without the putative shortcomings of fluorescence detection methods described earlier (Blöcher and Kuhni 1990). Therefore, the image analysis-based detection of radiation-induced DNA fragmentation after CHEF electrophoresis seems to be the most reliable method for applications to non-cycling cells and biopsy material.

DNA↗
PubMed2002

Analysis of gene expression in Arabidopsis thaliana by array hybridization with genomic DNA fragments aligned along chromosomal regions.

The availability of the entire genomic sequence of the higher plant Arabidopsis thaliana prompted an analysis of chromosomal regions for gene expression with the use of high-density DNA array filters spotted with genomic DNA fragments (genomic DNA array analysis). One TAC and nine P1 clones, each of which contains a genomic DNA insert of approximately 80 kb and was used for sequencing of chromosome 5, were arbitrarily selected for analysis. The total size of the genomic regions corresponding to these clones is 819 kb. A total of 339 DNA fragments (average size, 2.9 kb) that cover contiguously the 10 chromosomal regions was selected and spotted onto nylon filters. The filters were then subjected to hybridization with (33)P-labelled cDNA molecules that had been synthesized from polyadenylated RNA isolated from 3-week-old plants. Quantitative and reproducible measurement of hybridization signals allowed analysis of the transcription of all genes in the targeted regions that were expressed at a level above the limit of detection. The data revealed that the analysed chromosomal regions are rich in active genes, and that they also provided a basis for the identification of novel transcripts whose sequences are not represented in the expressed sequence tag (EST) database.

Arabidopsis↗