Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “algae”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 613 records · Page 34Linked to original sources
PubMed1996

Chronic toxicity of fenitrothion to an algae (Nannochloris oculata), a rotifer (Brachionus calyciflorus), and the cladoceran (Daphnia magna).

Chronic toxicity studies were conducted with an algae (Nannochloris oculata), a rotifer (Brachionus calyciflorus), and a cladoceran (Daphnia magna) to determine their relative sensitivities to the organophosphorus insecticide fenitrothion. The cladoceran D. magna was the most sensitive of the three species. The no observed effect concentrations (NOECs) for the study with the algae (1.0 mg/liter) and for the rotifer (1.0 mg/liter) were higher than the NOEC (0.009 microgram/liter) and the LC50 of 24 hr (0.067 microgram/liter) for D. magna. Most of the algal populations were not initially affected by exposure to fenitrothion. Pesticide concentrations higher than 1.0 mg/liter significantly reduced algal densities after 72 hr exposure. The effects of chronic exposure of the rotifer B. calyciflorus to fenitrothion were evaluated using some demographic parameters: intrinsic rate of natural increase (r), generation time, net reproductive rate, and life expectancy. All the parameters studied decreased with increasing toxicant concentrations. The parameters used to determine the effect of the pesticide on D. magna reproduction were mean total young per female, mean brood size, mean time to first reproduction, and r. The r and the rest of the studied parameters were affected at 0.011-microgram/liter and higher fenitrothion concentrations. Growth, as measured by body length, was only depressed significantly at 0.011 microgram/liter pesticide.

Animals↗
PubMed2000

Comparison of four chronic toxicity tests using algae, bacteria, and invertebrates assessed with sixteen chemicals.

The performances of four chronic toxicity tests, comprising the Daphnia magna 21-day (d) (crustacean), Brachionus calyciflorus 2-d (rotifer), Pseudokirchneriella subcapitata 72-h (green algae), and the Microtox chronic 22-h (bacteria) tests, were compared. Sixteen chemicals with toxicity covering 6 orders of magnitude were studied. Very high correlations were found between the NOEC/EC(10) Pseudokirchneriella 72-h, NOEC/EC(10) Brachionus 2-d, and the NOEC Daphnia 21-d tests. The toxicological response of rotifers and microalgae were within the same order of magnitude as the response of Daphnia in 80% of cases (13/16 chemicals). The Microtox chronic test also anticipated the overall results of the Daphnia 21-d test, but the prediction was rather imprecise, compared with microalgae and rotifers. The test measuring the algal growth inhibition of P. subcapitata after 72h was the most sensitive bioassay. Toxicity on microalgae after 72h could be estimated after 5h by measuring either the direct fluorescence of either photosynthetic pigments or fluorescein diacetate in 56 and 43% of cases, respectively. The median value of the ratio between EC(10) and EC(50) was 3.75, 2, and 1.5 with the algae, the rotifers, and the bacteria, respectively.

Algorithms↗
PubMed2002

Kinetic study of metal biosorption to a brown alga, Kjellmaniella crassiforia.

A kinetic study of cadmium and lead biosorption to a brown alga, Kjellmaniella crassiforia, was carried out. The shrinking core model derived by M. Gopala Rao and A. K. Gupta (Chem. Eng. J.24, 181, (1982)) was modified and adapted for description of the rate process of cadmium and lead biosorption to the alga. The biosorption rate process was well described and average apparent diffusion coefficient of about 9 x 10(-6) cm(2) s(-1) was found for both cadmium and lead ions. The value was 20 to 50 times higher than the apparent diffusion coefficients of cadmium and lead ions in strong-acid resins like Dowex 50W-X8.

Adsorption↗
PubMed1998

Witnessing the evolution of transcription in mitochondria: the mitochondrial genome of the primitive brown alga Pylaiella littoralis (L.) Kjellm. Encodes a T7-like RNA polymerase.

A region of the mitochondrial genome of the primitive brown alga Pylaiella littoralis containing a plasmid-like insert which contains a transcribed T7-phage-type RNA polymerase gene is described. This is a first report of a phage-type RNA polymerase gene integrated in a mitochondrial genome. As the mitochondrial genome of this alga also contains sigma-70 proteobacterial promoter regions, i.e. traces of the ancestral alpha2betabeta'sigma-70 proteobacterial RNA polymerase, this genome witnesses two types of RNA polymerases. As such the mitochondrial genome of P. littoralis represents a unique stage in the evolution of transcription in mitochondria, which contrasts with that of the primitive protist Reclinomonas americana, which still retains the ancestral alpha2betabeta'sigma-70 proteobacterial RNA polymerase genes, and with animals, land plants and fungi, which use phage-type polymerases.

Chromosome Mapping↗
PubMed1998

The origin of red algae and cryptomonad nucleomorphs: A comparative phylogeny based on small and large subunit rRNA sequences of Palmaria palmata, Gracilaria verrucosa, and the Guillardia theta nucleomorph.

The complete large subunit rRNA sequences from the red algae Palmaria palmata and Gracilaria verrucosa, and from the nucleomorph of the cryptomonad Guillardia theta, were determined in order to assess their phylogenetic relationships relative to each other and to other eukaryotes. Neighbor-joining, maximum-parsimony, and maximum-likelihood trees were constructed on the basis of small subunit rRNA, large subunit rRNA, and a combination of both molecules. Our results support the hypothesis that the cryptomonad plastid is derived from a primitive red alga, in that an ancient common ancestor of rhodophytes and cryptomonad nucleomorphs is indicated. This cluster shows some affinity with chlorobionts, which could point to a monophyletic origin of green and red plastids. However, the exact branching order of the crown eukaryotes remains uncertain and further research is required.

Base Sequence↗
PubMed1995

The marine red alga Chondrus crispus has a highly divergent beta-tubulin gene with a characteristic 5' intron: functional and evolutionary implications.

We characterized a nuclear gene and its corresponding cDNA encoding beta-tubulin (gene TubB1) of the marine red alga Chondrus crispus. The deduced TubB1 protein is the most divergent beta-tubulin so far reported with only 64 to 69% amino acid identity relative to other beta-tubulins from higher and lower eukaryotes. Our analysis reveals that TubB1 has an accelerated evolutionary rate probably due to a release of functional constraints in connexion with a specialization of microtubular structures in rhodophytes. It further indicates that isoform diversity and functional differentiation of tubulins in eukaryotic cells may be controlled by independent selective constraints. TubB1 has a short spliceosomal intron at its 5' end which seems to be a characteristic feature of nuclear protein-coding genes from rhodophytes. The splice junctions of the four known rhodophyte introns comply well with the corresponding consensus sequences of higher plants in agreement with previous suggestions from phylogenetic inference that red algae and green plants may be sister groups. The paucity and asymmetrical location of introns in rhodophyte genes can be explained by differential intron loss due to conversion of genes by homologous recombination with cDNAs corresponding to reverse transcribed mRNAs or partially spliced pre-mRNAs, respectively. The identification of an intron containing TubB1 cDNA in C. crispus confirms that pre-mRNAs can escape both splicing and degradation in the nucleus prior to transport into the cytoplasm. Differential Southern hybridizations under non-stringent conditions with homologous and heterologous probes suggest that C. crispus contains a second degenerate beta-tubulin gene (or pseudogene?) which, however, is only distantly related to TubB1 as it is to the more conserved homologues of other organisms.

Amino Acid Sequence↗
PubMed1995

Characterization of the nuclear gene encoding mitochondrial aconitase in the marine red alga Gracilaria verrucosa.

We have cloned a nuclear gene from the marine red alga Gracilaria verrucosa that encodes the complete 779 amino-acid mitochondrial aconitase (m-ACN), the first characterized from a photosynthetic organism. The N-terminal 28 deduced amino acids are predicted to constitute the mitochondrial transit peptide, the first described from a red alga. Putative transcriptional cis-acting elements were identified in the upstream untranslated region. The G. verrucosa m-ACN gene (m-ACN) is present in a single copy and is located ca. 1.5 kb upstream from the single-copy polyubiquitin gene. The single spliceosomal intron is located near the 5' end of the region encoding the mature m-ACN in precisely the same location and phase as intron 2 in Caenorhabditis elegans m-ACN; sequences at its 3' and 5' splice junctions and at the predicted lariat branch point conform well to the eukaryote consensus sequences. Multiple protein-sequence alignment of m-ACN, bacterial aconitase (b-ACN) and iron-responsive element-binding protein (IRE-BP), and phylogenetic analyses, revealed that m-ACN does not share a recent common ancestry with either b-ACN or IRE-BP.

Aconitate Hydratase↗
PubMed1996

Small G proteins of two green algae are localized to exocytic compartments and to flagella.

The Ypt/Rab proteins are small GTPases, which belong to the Ras superfamily and have been shown to be involved in endo- and exocytosis in mammalian cells and yeast. Using affinity-purified antibodies specific for four Ypt proteins, namely Ypt1p, Ypt4p, Ypt5p and Ypt6p, of the multicellular green alga Volvox carteri (YptVp) and its close unicellular relative Chlamydomonas reinhardtii (YptCp), we examined the abundance of the corresponding antigens during the asexual life cycle of Volvox, and their intracellular localization. The YptV proteins were found in all stages throughout the asexual life cycle and are tightly associated with intracellular membranes. Indirect immunofluorescence revealed that YptV4p, YptV5p and YptV6p are present in perinuclear regions of the cell, indicating an association with the Golgi region. Golgi localization of YptV4p and YptV6p in Volvox was confirmed by immunogold electron microscopy. In contrast, we found Ypt1p associated with the contractile vacuole in both V. carteri and C. reinhardtii. Furthermore, the YptV proteins were also detected along the entire length of the flagella of somatic Volvox cells. This flagellar location was substantiated by western blot analysis of extracts prepared from isolated flagella of both algae. While localization to exocytic compartments is in agreement with the established Ypt/Rab function in intracellular vesicle transport of eukaryotic cells, presence in the algal flagellum is the first hint of a possible role for small G proteins also in motility organelles.

Blotting, Western↗
PubMed1993

The GAPDH gene system of the red alga Chondrus crispus: promoter structures, intron/exon organization, genomic complexity and differential expression of genes.

Our previous phylogenetic analysis based on cDNA sequences of chloroplast and cytosolic glyceraldehyde-3-phosphate dehydrogenases (GAPDH; genes GapA and GapC, respectively) of the red alga Chondrus crispus suggested that rhodophytes and green plants are sister groups with respect to plastids and mitochondria and diverged at about the same time or somewhat later than animals and fungi. Here we characterize the genomic sequences of genes GapC and GapA of C. crispus with respect to promotor structures, intron/exon organization, genomic complexity, G + C content, CpG suppression and their transcript levels in gametophytes and protoplasts, respectively. To our knowledge this is the first report on nuclear protein genes of red algae. The GapC gene is G + C-rich, contains no introns and displays a number of classic sequence motifs within its promotor region, such as TATA, CAAT, GC boxes and several elements resembling the plant-specific G-box palindrome. The GapA gene has a moderate G+C content, a single CAAT box motif in its promotor region and a single intron of 115 bp near its 5' end. This intron occupies a conserved position corresponding to that of intron 1 in the transit peptide region of chloroplast GAPDH genes (GapA and GapB) of higher plants. It has consensus sequences similar to those of yeast introns and folds into a conspicuous secondary structure of -61.3 kJ. CpG profiles of genes GapC and GapA and their flanking sequences show no significant CpG depletion suggesting that these genomic sequences are not methylated. Genomic Southern blots hybridized with generic and gene specific probes indicate that both genes are encoded by single loci composed of multiple polymorphic alleles. Northern hybridizations demonstrate that both genes are expressed in gametophytes but not in protoplasts where appreciable amounts of transcripts can only be detected for GapC.

Base Composition↗
PubMed1993

Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

Base Sequence↗
PubMed1992

Nucleotide sequence and phylogenetic implication of the ATPase subunits beta and epsilon encoded in the chloroplast genome of the brown alga Dictyota dichotoma.

We have cloned and sequenced the genes atpB and atpE, coding for CF1 subunits beta and epsilon, respectively, of the chloroplast genome of the brown alga Dictyota dichotoma. Although the coding site of atpE cannot be demonstrated by heterologous Southern hybridizations, a 417 bp reading frame 3' to atpB was identified as the gene atpE by sequence similarities with atpE genes from other sources. A maximum sequence identity of 30% is found between the predicted amino acid sequence of the Dictyota subunit epsilon and the corresponding cyanobacterial subunits. Including conserved amino acid replacements, the Dictyota epsilon subunit exhibits about 70% sequence similarity with the cyanobacterial and land plant subunits. As in cyanobacteria, the atpE gene does not overlap the preceding gene atpB. The deduced amino acid sequence of atpB is 74-79% identical to the corresponding cyanobacterial and chloroplast subunits. Entirely conserved are regions referred to as the catalytic and/or regulatory sites of ATP formation, including interacting regions between subunits alpha and beta. A phylogram predicted from F1/CF1-beta subunits of eleven different organisms suggests a common evolutionary origin of plastids from chlorophytes and brown algae.

Amino Acid Sequence↗
PubMed1993

Organization, expression and nucleotide sequence of the operon encoding R-phycoerythrin alpha and beta subunits from the red alga Polysiphonia boldii.

The characterization of the operon encoding the alpha and beta subunits of rhodophytan (R)-phycoerythrin (PE) from the macrophytic red alga Polysiphonia boldii is reported. This plastid-encoded operon was cloned, its nucleotide sequence determined, and its expression characterized by northern and primer extension analyses. The arrangement and expression of the PE alpha and beta genes, named rpeA and rpeB, are similar to those of the cyanobacterial (C)-PE genes: rpeB is located 5' of rpeA, with an intergenic region of 64 nucleotides. The two genes are transcribed on a 1.25 kb dicistronic transcript, and each coding region is preceded by a prokaryotic ribosome binding site consensus sequence. Transcription is initiated 95 nucleotides upstream of the initiating methionine codon of rpeB. The promoter region resembles that of prokaryotic genes, with an AT-rich -10 sequence. A direct pentanucleotide repeat (5'-TGTTA-3') was found in the -35 region. This pentanucleotide is present upstream of all PE operons that have been characterized thus far. An extensive inverted repeat is present 3' of rpeA; inverted repeats are found downstream of all PE operons sequenced to date, although the sequence is not conserved. The deduced amino acid sequences from these genes provide complete sequences for an R-PE. Of the amino acid residues 85% are identical to those of bangeophycean (B)-PE from the unicellular red alga Porphyridium cruentum. Conserved residues include cysteines at the bilin attachment sites of C- and B-PEs, aspartates at positions postulated to interact with bilin chromophores, and an apparent consensus sequence for N-methylation of an asparagine residue in C-PEs.

Amino Acid Sequence↗
PubMed1992

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Amino Acid Sequence↗
PubMed1995

Phylogenetic relationship of the green alga Nanochlorum eukaryotum deduced from its chloroplast rRNA sequences.

The marine green coccoidal alga Nanochlorum eukaryotum (N.e.) is of small size with an average diameter of 1.5 microns. It is characterized by primitive-appearing biochemical and morphological properties, which are considerably different from those of other green algae. Thus, it has been proposed that N.e. may be an early developed algal form. To prove this hypothesis, DNA of N.e. was isolated by a phenol extraction procedure, and the chloroplast DNA separated by preparative CsCl density-gradient centrifugation. The kinetic complexity of the nuclear and of the chloroplast DNA was evaluated by reassociation kinetics to 3 x 10(7) bp and 9 x 10(4) bp, respectively. Several chloroplast genes, including the rRNA genes, were cloned on distinct fragments. The order of the rRNA genes corresponds to the common prokaryotic pattern. The 16S rRNA gene comprises 1,548 bases and is separated from the 23S rRNA gene with its 2,920 bases by a short spacer of 460 bases, which also includes the tRNA(Ile) and tRNA(Ala) genes. The 5S rRNA gene has not been found; it must start further than 500 bases downstream from the 3'-end of the 23S rRNA gene. From the chloroplast rRNA sequences, we have deduced secondary structures of the 16S and 23S rRNAs, which are in agreement with standard models. The rRNA sequences were aligned with corresponding chloroplast sequences; phylogenetic relationships were calculated by several methods. From these calculations, we conclude that N.e. is most closely related to Chlorella vulgaris. Therefore, N.e. does not represent an early developed algal species; the primitive-appearing morphological and biochemical characteristics of N.e. must rather be explained by secondary losses.

Chlorella↗
PubMed1995

DNA sequence, structure, and phylogenetic relationship of the mitochondrial small-subunit rRNA from the red alga Chondrus crispus (Gigartinales rhodophytes).

The entire nucleotide sequence containing the small-subunit ribosomal RNA gene (SSU rRNA) from the mitochondrial genome of Chondrus crispus was determined. To our knowledge, this is the first sequence of a mitochondrial 16S-like rRNA from a red alga. The length of this gene is 1,376 nucleotides. Its secondary structure was constructed and compared with other known secondary structures from eubacteria and from mitochondria of land plants, green and brown algae, and fungi. Phylogenetic trees were built upon SSU rRNA sequence alignment from mitochondria and eubacteria. The results show that rhodophytes and chromophytes provide additional links in the evolution of mitochondria between the green plant lineage and the "nonplant" lineages.

Base Sequence↗
PubMed1995

Discrete subcellular localization of membrane-bound ATPase activity in marine angiosperms and marine algae.

The subcellular distribution of membrane-bound ATPases was compared among terrestrial plants, seagrasses and marine algae by cytochemical techniques. High ATPase activity was detected in the copiously invaginated plsma membrane that was characteristic of transfer cells but not in the tonoplast of epidermal cells in mature leaves of seagrasses. Magnesium- or Ca(2+)-dependent ATPase activity was induced together with the characteristics of transfer cells during the development of leaf tissues able to resist seawater. Northern hybridization revealed the effective induction of the synthesis of mRNA for plasma-membrane H(+)-ATPase during the development of leaves. Such high ATPase activity was not detected in the smooth plasma membranes of marine macro-algae but was found in the membranes of some cytoplasmic vesicles or microvacuoles, providing evidence of the excretion of salts by exocytosis. It appears, therefore, that two essentially different methods for excreting excess salts have developed separately in these two classes of marine plants. The evolution of mechanisms of salt tolerance in the plant kingdom is discussed in terms of the differential subcellular distribution of ATPase activity.

Adenosine Triphosphatases↗
PubMed1995

Purification and characterisation of an intracellular carbonic anhydrase from the unicellular green alga Coccomyxa.

An intracellular carbonic anhydrase (CA; EC 4.2.1.1) was purified and characterised from the unicellular green alga Coccomyxa sp. Initial studies showed that cultured Coccomyxa cells contain an intracellular CA activity around 100 times higher than that measured in high-CO2-grown cells of Chlamydomonas reinhardtii CW 92. Purification of a protein extract containing the CA activity was carried out using ammonium-sulphate precipitation followed by anion-exchange chromatography. Proteins were then separated by native (non-dissociating) polyacrylamide gel electrophoresis, with each individual protein band excised and assayed for CA activity. Measurements revealed CA activity associated with two discrete protein bands with similar molecular masses of 80 +/- 5 kDa. Dissociation by denaturing polyacrylamide gel electrophoresis showed that both proteins contained a single polypeptide of 26 kDa, suggesting that each 80-kDa native protein was a homogeneous trimer. Isoelectric focusing of the 80-kDa proteins also produced a single protein band at a pH of 6.5. Inhibition studies on the purified CA extract showed that 50% inhibition of CA activity was obtained using 1 microM azetazolamide. Polyclonal antibodies against the 26-kDa CA were produced and shown to have a high specific binding to a single polypeptide in soluble protein extracts from Coccomyxa cells. The same antiserum, however, failed to cross-react with soluble proteins isolated from two different species of green algae, Chlamydomonas reinhardtii and Chlorella vulgaris. Correspondingly, antisera directed against pea chloroplastic CA, extracellular CA from C. reinhardtii and human CAII, showed no cross-hybridisation to the 26-kDa polypeptide in Coccomyxa.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗
PubMed1996

Effects of 2,4-dichlorophenoxyacetic acid on Kentucky algae: simultaneous laboratory and field toxicity testings.

2,4-D was applied to a cove in Kentucky Lake which was highly infested with Myriophllum spicatum (Eurasian watermilfoil). Effects of 2,4-D on nontarget algal communities were monitored concurrently in the field and in laboratory microcosms for eight days. Results indicated that indirect effects of water temperature and increased nutrient concentrations due to lysis in milfoil plants may be more important in the field community dominated by Chlorophyta, Pyrrhophyta, and Bacillariophyta. 2,4-D applied at the label-recommended rate of 2 mg/L or less stimulated total community growth in both laboratory and field indicating a possible hormonal effect of 2,4-D on algae. Reduced community growth and metabolism at high laboratory concentrations of 100 mg/L and 1000 mg/L may indicate an inhibitory effect on photosynthesis and/or respiration in algae. 2,4-D altered the laboratory community structure and function in all concentrations tested. Heterotrophic taxa such as Nitzschia, Euglena, Chlamydomonas, Mallomonas, Anabaena, and Oscillatoria appeared to be least affected by 2,4-D at high concentrations. Scenedesmus, Pediastrum, Characiosiphon, Navicula, Melosira, and Fragilaria appeared to be more sensitive, even in the lowest concentrations.

2,4-Dichlorophenoxyacetic Acid↗