SEARCH · Search PubMed

Results for “Response Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 595 records · Page 33Linked to original sources

PubMed2002

The gene encoding the Acyl-CoA-binding protein is activated by peroxisome proliferator-activated receptor gamma through an intronic response element functionally conserved between humans and rodents.

The acyl-CoA-binding protein (ACBP) is a 10-kDa intracellular protein that specifically binds acyl-CoA esters with high affinity and is structurally and functionally conserved from yeast to mammals. In vitro studies indicate that ACBP may regulate the availability of acyl-CoA esters for various metabolic and regulatory purposes. The protein is particularly abundant in cells with a high level of lipogenesis and de novo fatty acid synthesis and is significantly induced during adipocyte differentiation. However, the molecular mechanisms underlying the regulation of ACBP expression in mammalian cells have remained largely unknown. Here we report that ACBP is a novel peroxisome proliferator-activated receptor (PPAR)gamma target gene. The rat ACBP gene is directly activated by PPARgamma/retinoid X receptor alpha (RXRalpha) and PPARalpha/RXRalpha, but not by PPARdelta/RXRalpha, through a PPAR-response element in intron 1, which is functionally conserved in the human ACBP gene. The intronic PPAR-response element (PPRE) mediates induction by endogenous PPARgamma in murine adipocytes and confers responsiveness to the PPARgamma-selective ligand BRL49653. Finally, we have used chromatin immunoprecipitation to demonstrate that the intronic PPRE efficiently binds PPARgamma/RXR in its natural chromatin context in adipocytes. Thus, the PPRE in intron 1 of the ACBP gene is a bona fide PPARgamma-response element.

3T3 Cells↗

PubMed1993

Functional divergence of protein kinase C (PKC) family members. PKC gamma differs from PKC alpha and -beta II and nPKC epsilon in its competence to mediate-12-O-tetradecanoyl phorbol 13-acetate (TPA)-responsive transcriptional activation through a TPA-response element.

We have established an assay system where overexpression of a specific protein kinase C (PKC) type caused by introduction of the respective cDNA results in the enhancement of a cell response: the transcriptional activation of a set of genes in response to PKC activators such as 12-O-tetradecanoylphorbol 13-acetate (TPA). When monitored by the expression of a reporter gene containing the chloramphenicol acetyltransferase gene fused downstream of a synthetic TPA response element (TRE) or a serum response element (SRE), the overexpression of cPKC alpha and -beta II or nPKC epsilon all resulted in the enhancement of transcriptional activation through both TRE and SRE. On the other hand, PKC gamma activates TRE only very weakly, although it activates SRE in a similar manner to the other PKC members examined. The overexpression of cPKC alpha and -beta II or nPKC epsilon, but not cPKC gamma, resulted in the enhanced expression of the endogenous c-jun gene, which contains TRE in the 5'-upstream, promoter region. The gel mobility shift assay showed that the activation of PKC gamma, as well as PKC alpha and -beta II and nPKC epsilon, causes the increase in TRE-binding proteins, suggesting that transcriptional activation through TRE requires an additional step, which is not activated by PKC gamma, such as a qualitative change in TRE-binding or in TRE-associating proteins. This finding provides not only a rationale to explain the presence of multiple PKC family members, but also permits the dissection of the complex cellular signaling cascade involving PKC family members.

Amino Acid Sequence↗

PubMed2006

Neuronal nitric oxide synthase-derived nitric oxide inhibits neurogenesis in the adult dentate gyrus by down-regulating cyclic AMP response element binding protein phosphorylation.

Neuronal nitric oxide synthase, the major nitric oxide synthase isoform in the mammalian brain, is implicated in some developmental processes, including neuronal survival, precursor proliferation and differentiation. However, reports about the role of neuronal nitric oxide synthase in neurogenesis in the adult dentate gyrus are conflicting. Here we show that 5-bromodeoxyuridine-labeled dividing progenitor cells in the dentate gyrus were significantly increased in mice receiving 7-nitroindazole, a selective neuronal nitric oxide synthase inhibitor, and in null mutant mice lacking neuronal nitric oxide synthase gene (nNOS-/-) 6 h and 4 weeks after 5-bromodeoxyuridine incorporation. The increase in 5-bromodeoxyuridine positive cells in 7-nitroindazole-treated mice was accompanied by activation of cyclic AMP response element binding protein phosphorylation in the dentate gyrus. Pretreatment with N-methyl-D-aspartate receptor antagonist MK-801 fully abolished the effects of 7-nitroindazole on neurogenesis and cyclic AMP response element binding protein phosphorylation. Furthermore, neuronal nitric oxide synthase inhibition significantly enhanced the survival of newborn cells and the number of 5-bromodeoxyuridine positive/NeuN positive cells in the dentate gyrus. These results indicate that neuronal nitric oxide synthase-derived nitric oxide suppresses neurogenesis in the adult dentate gyrus, in which N-methyl-D-aspartate receptor functions and cyclic AMP response element binding protein phosphorylation may be involved.

Animals↗

PubMed1995

Novel location and function of a thyroid hormone response element.

We describe a novel thyroid hormone response element (TRE)-containing sequence, clone 144, isolated by immunoprecipitation of nuclear thyroid hormone receptor (TR)-DNA complexes from the rat pituitary tumor cell line GH4. These cells express several mRNAs of approximately 10 kb that hybridize to the TRE-containing genomic clone 144. These mRNAs are up-regulated at the transcriptional level in the absence of thyroid hormone (T3) and repressed in its presence. The sequence protected from DNase I digestion by TR in clone 144 contains two consensus TRE half-sites arranged as inverted palindromes. The clone 144 TRE is located in the 3' untranslated region (UTR) of several related mRNAs. A reporter construct transfected into 293 cells was responsive to TR regulation when the clone 144 TRE was inserted in the 3' UTR but not when inserted upstream of the promoter. As found for the endogenous 144 mRNAs, the 144 TRE reporter construct is activated by TR in the absence of T3, but not in its presence. Deletion analysis showed that clone 144 sequences flanking the TRE were necessary for TR-mediated regulation, suggesting that the mechanism by which TR regulates transcription through a TRE in the 3' UTR is different from that through the TREs located in the promoter region.

Animals↗

PubMed2006

Quantitative relationship of dioxin-responsive gene expression to dioxin response element in Hep3B and HepG2 human hepatocarcinoma cell lines.

Dioxin response element (DRE) is a cis-acting DNA sequence mediating the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced gene expression. The present study was undertaken to elucidate TCDD-responsive gene expression profiles and their relationships to the number of DREs in liver cancer cells. Hep3B and HepG2 human hepatocarcinoma cells were exposed to 50-nM TCDD for 0, 1, 2 and 4h in culture, after which gene expression profiles were analyzed by the microarray hybridization using a chip containing 24,000 cDNAs prepared from the human liver. The TCDD-responsive expression levels in each gene were calculated by dividing the densitometric values of the hybridization signal for h1, h2 and h4 by that of h0, followed by transformation of the resulting data into a log scale with the base of 2. Up- and down-regulated gene expressions were defined as >0.585 and <-0.585 by the log scale (>1.5 and <1/1.5 arithmetically), respectively, exhibited at any time after h0. Hep3B and HepG2 cells had 27 and 58 TCDD-responsive, up-regulated genes, respectively, of which 78% (21/27) and 62% (36/58) had one or more DREs. Of these 85, 80 genes were up-regulated exclusively in one of the two lines, with CYP1A1 and PPP1R15A being so regulated in both lines. Expression levels of the up-regulated genes at h1, h2 and h4 were correlated with each other (P<0.01) and the mean of these regressed to the number of DRE(s) in both lines (P<0.01). However, expression of a total of 93 TCDD-responsive, down-regulated genes, of which 46% contained DRE(s), had no relation to the number of DRE(s). In conclusion, results suggest that DREs may cooperatively mediate the expression of TCDD-responsive genes in liver cancer cells.

Antigens, Differentiation↗

PubMed2002

Potentiation of Fas- and TRAIL-mediated apoptosis by IFN-gamma in A549 lung epithelial cells: enhancement of caspase-8 expression through IFN-response element.

Epithelial cell apoptosis triggered cooperatively by multiple cytokines contributes to the injury induced by inflammatory responses in the lung and elsewhere. Here we show that interferon-gamma (IFN-gamma) sensitizes A549 cells, human lung epithelial cells, to cytokine-mediated apoptosis by upregulating caspase-8 expression. Pretreating the cells with IFN-gamma potentiated Fas- and TNF-related apoptosis inducing ligand (TRAIL)-induced cell death, but other forms of apoptosis, not mediated via receptors, were unaffected. Western blotting and inhibitor assays showed that IFN-gamma selectively increased expression of caspases-7 and -8, but not caspases-2, -3, -9, or -10, as a necessary step leading to apoptosis. Assaying promoter activity using a luciferase reporter gene indicated that an IFN-gamma response element was located in the 5'-flanking region of the caspase-8 gene, spanning positions -227 to -219. Taken together, these findings suggest that IFN-gamma potentiates Fas- and TRAIL-mediated apoptosis by increasing caspase-8 expression via an IFN-gamma response element in A549 cells.

5' Flanking Region↗

PubMed1993

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

PubMed1994

Distinct properties of the cAMP-responsive element of the rat insulin I gene.

The cAMP response element (CRE)-binding transcription factor CREB can mediate induction of gene transcription in response to calcium as well as to cAMP. Since the rat insulin I gene 5'-flanking region contains a CRE with an octamer-like motif (TGACGTCC), CREB binding and cAMP/calcium responsiveness of the insulin CRE were investigated. In an electrophoretic mobility shift assay and in Southwestern blot experiments, bacterially expressed recombinant CREB bound to the insulin CRE as it did to the rat glucagon and rat somatostatin gene CREs. However, in nuclear extracts of the pancreatic islet cell line HIT, protein complexes binding to the insulin CRE did not contain proteins with CREB-like immunoreactivity, although these bound to the glucagon and somatostatin CREs. When reporter fusion genes were transfected into HIT cells, the isolated insulin CRE increased basal activity and mediated transcriptional activation by cAMP. However, cAMP stimulation of transcription through the insulin CRE was weak when compared with the response through the glucagon and somatostatin CREs. Furthermore, the insulin CRE did not confer responsiveness to membrane depolarization and calcium influx, in contrast to the glucagon and somatostatin CREs. These results demonstrate that the functional properties of the rat insulin I gene CRE are different from those of the rat glucagon and somatostatin CREs which may be explained by a distinct pattern of nuclear protein binding and suggest the existence of post-translational mechanisms that decrease the binding of cellular CREB to the insulin CRE.

Animals↗

PubMed1995

Identification of a cAMP-response element on the human proopiomelanocortin gene upstream promoter.

Proopiomelanocortin (POMC) is an example of a gene that is stimulated by cAMP without containing the classical cAMP-responsive element on its promoter. To characterize POMC sequences conferring cAMP responsiveness, we used mouse pituitary AtT-20 cells for transient expression of chloramphenicol acetyltransferase reporter gene constructs containing 5'-flanking sequences of the human POMC gene. A novel POMC-cAMP-responsive element (POMC-CRE) was identified, which is located between nucleotides -344 and -319 and which lacks the classical CRE core motif (CGTCA). Using gel retardation assays in combination with antibodies against CREB, we provided evidence that both AtT-20 cell derived and in vitro translated CREB proteins bind to the POMC-CRE and thus may be involved in the stimulation of the gene.

Animals↗

PubMed1991

The vitamin D-responsive element in the rat bone Gla protein gene is an imperfect direct repeat that cooperates with other cis-elements in 1,25-dihydroxyvitamin D3- mediated transcriptional activation.

The gene for rat bone gla protein (BGP) was isolated and 1250 basepairs (bp), including 1100 bp of 5' flanking DNA, were placed up-stream of the human GH reporter gene. After transient transfection into the osteoblast-like rat osteosarcoma cell line ROS 17/2.8, the BGP promoter demonstrated a low level of basal activity that was increased approximately 10-fold by the addition of 10(-8) M 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3]. A single 250-bp fragment (-523 to -274) was sufficient to confer hormone inducibility upon both heterologous and homologous promoters. Deletion studies, complemented by evaluation with synthetic oligomers, enabled localization of the 1,25-(OH)2D3 response element to within 19 bp (-456 to -438), containing an element with an imperfect direct repeat [GGTGA(N4)GGACA] and homology to other steroid-responsive elements. Gel retardation assays demonstrated that partially purified chick intestinal 1,25-(OH)2D3 receptor bound specifically and with high affinity to a DNA fragment containing the putative 1,25-(OH)2D3 response element, and this binding was perturbed by monoclonal antibodies to the 1,25-(OH)2D3 receptor. Surprisingly, the 250-bp fragment, when linked in an antisense orientation with respect to the BGP promoter, blocked basal and hormone-dependent gene expression. However, a 246-bp fragment 5' to the 250-bp element (-1100 to -855) restored 20-fold inducibility when linked to the first fragment in the same orientation, suggesting cooperativity between at least two elements to achieve the hormonal regulation observed in this gene.

Animals↗

PubMed2002

CART gene promoter transcription is regulated by a cyclic adenosine monophosphate response element.

OBJECTIVE: To define the regulatory DNA sequence controlling the expression of the cocaine-amphetamine-regulated transcript (CART) gene expression. RESEARCH METHODS AND PROCEDURES: A rat genomic library was screened for genomic clones containing the CART gene and upstream DNA sequence. A clone containing exons 1 and 2 of the rat CART gene plus 1.2 kb of upstream sequence was isolated. The 1.2-kb upstream sequence and truncated segments of this sequence were cloned into a luciferase reporter vector for analysis of transcriptional activity in the CART expressing pituitary GH3 cell line. Luciferase reporter assays, gel shift assays, and site-directed mutagenesis were used to analyze potential regulatory regions in the 1.2-kb 5' DNA sequence. RESULTS: Sequence analysis of the 1.2-kb upstream sequence reveals several potential regulatory elements. Luciferase reporter assays demonstrate that within the first 162 bp of the start codon is a functional cyclic adenosine monophosphate (cAMP) response element that can induce cAMP-regulated gene expression of the CART promoter in GH3 cells. Mutation of this cAMP response element abolishes cAMP-stimulated transcription [corrected]. Furthermore, the promoter is active in a neuronal cell line where it also demonstrates cAMP responsiveness. DISCUSSION: cAMP-mediated transcription of the CART promoter may be an important aspect of the regulation of the CART gene. However, the cellular context of expression is also important because the CART promoter is not responsive to cAMP stimulation in all cell types. Other transcription factor binding sequences are likely to play a key role in CART promoter regulation.

Animals↗

PubMed1992

A retinoic acid response element from the rat CRBPI promoter is activated by an RAR/RXR heterodimer.

The expression of the rat cellular retinol binding protein I (rCRBPI) can be upregulated in vivo by retinoic acid (RA). Here we have analyzed the rCRBPI promoter region and compared it to the corresponding mouse sequence. We find that the CRBPI 5' flanking region has been highly conserved between rat and mouse, including a RA response element (RARE) approximately 1 kb upstream of the start of transcription. The RARE is of the direct repeat type with a two nucleotide spacer. Like other direct repeat RAREs, this response element is activated by RAR alpha and beta but not by RAR gamma 1. Furthermore, the rCRBPI-RARE is most effectively activated when both RAR and RXR are present. In addition RAR/RXR heterodimers are required for efficient binding to the rCRBPI-RARE, while RARs or RXR alone do not interact effectively with this response element. The rCRBPI gene is therefore most likely activated in vitro by a RAR/RXR heterodimer.

Animals↗

PubMed2002

Inhibitory effect of AP-1 complex on 5-aminolevulinate synthase gene expression through sequestration of cAMP-response element protein (CRE)-binding protein (CBP) coactivator.

Activation protein-1 (AP-1) transcription factors are early response genes involved in a diverse set of transcriptional regulatory processes. The phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) is often used to induce AP-1 activity. The purpose of this work was to explore the molecular mechanisms involved in the TPA regulation of ubiquitous 5-aminolevulinate synthase (ALAS) gene expression, the first and rate-controlling step of the heme biosynthesis. Previous analysis of the 5'-flanking sequence of ALAS revealed the existence of two cAMP-response elements (CRE) required for basal and cAMP-stimulated expression. The fragment -833 to +42 in the 5'-flanking region of rat ALAS gene was subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector. The expression vector pALAS/CAT produced a significant CAT activity in transiently transfected HepG2 human hepatoma cells, which was repressed by TPA. Sequence and deletion analysis detected a TPA response element (TRE), located between -261 and -255 (TRE-ALAS), that was critical for TPA regulation. We demonstrated that c-Fos, c-Jun, and JunD are involved in TPA inhibitory effect due to their ability to bind TRE-ALAS, evidenced by supershift analysis and their capacity to repress promoter activity in transfection assays. Repression of ALAS promoter activity by TPA treatment or Fos/Jun overexpression was largely relieved when CRE protein-binding protein or p300 was ectopically expressed. When the TRE site was placed in a different context with respect to CRE sites, it appeared to act as a transcriptional enhancer. We propose that the decrease in ALAS basal activity observed in the presence of TPA may reflect a lower ability of this promoter to assemble the productive pre-initiation complex due to CRE protein-binding protein sequestration. We also suggest that the transcriptional properties of this AP-1 site would depend on a spatial-disposition-dependent manner with respect to the CRE sites and to the transcription initiation site.

5-Aminolevulinate Synthetase↗

PubMed2000

Nuclear receptor coactivators facilitate vitamin D receptor homodimer action on direct repeat hormone response elements.

Vitamin D receptor (VDR) is a ligand-dependent transcription factor that regulates target gene expression. Although VDR forms stable heterodimer complex with retinoid X receptors (RXRs) on vitamin D-response elements (VDREs), it is still not clear whether VDR/RXR heterodimers are the only VDR complexes responsible for vitamin D-mediated gene transcription. In this report, we analyzed the effect of nuclear receptor coactivators (SRC-1 and TRAM-1) on VDR homodimer and VDR/RXR heterodimer formation by electrophoretic mobility shift assay. We found that VDR forms stable homodimers after interaction with the coactivators on a VDRE (DR+3). Of particular note, DR+4 and DR+5 hormone-response elements (HREs) may also support such interactions. Cotransfection experiments revealed further that the coactivators enhance ligand-induced VDR transcription on these elements. Our studies suggest the important role of VDR homodimers, in addition to VDR/RXR heterodimers, in vitamin D-induced transactivation. Thus, specific coactivator-VDR interactions on HREs may determine target gene transactivation.

Cell Nucleus↗

PubMed2001

Factor recruitment and TIF2/GRIP1 corepressor activity at a collagenase-3 response element that mediates regulation by phorbol esters and hormones.

To investigate determinants of specific transcriptional regulation, we measured factor occupancy and function at a response element, col3A, associated with the collagenase-3 gene in human U2OS osteosarcoma cells; col3A confers activation by phorbol esters, and repression by glucocorticoid and thyroid hormones. The subunit composition and activity of AP-1, which binds col3A, paralleled the intracellular level of cFos, which is modulated by phorbol esters and glucocorticoids. In contrast, a similar AP-1 site at the collagenase-1 gene, not inducible in U2OS cells, was not bound by AP-1. The glucocorticoid receptor (GR) associated with col3A through protein-protein interactions with AP-1, regardless of AP-1 subunit composition, and repressed transcription. TIF2/GRIP1, reportedly a coactivator for GR and the thyroid hormone receptor (TR), was recruited to col3A and potentiated GR-mediated repression in the presence of a GR agonist but not antagonist. GRIP1 mutants deficient in GR binding and coactivator functions were also defective for corepression, and a GRIP1 fragment containing the GR-interacting region functioned as a dominant-negative for repression. In contrast, repression by TR was unaffected by GRIP1. Thus, the composition of regulatory complexes, and the biological activities of the bound factors, are dynamic and dependent on cell and response element contexts. Cofactors such as GRIP1 probably contain distinct surfaces for activation and repression that function in a context-dependent manner.

Animals↗

PubMed1999

Mechanisms of lung neutrophil activation after hemorrhage or endotoxemia: roles of reactive oxygen intermediates, NF-kappa B, and cyclic AMP response element binding protein.

Acute inflammatory lung injury occurs frequently in the setting of severe infection or blood loss. Accumulation of activated neutrophils in the lungs and increased pulmonary proinflammatory cytokine levels are major characteristics of acute lung injury. In the present experiments, we examined mechanisms leading to neutrophil accumulation and activation in the lungs after endotoxemia or hemorrhage. Levels of IL-1 beta, TNF-alpha, and macrophage inflammatory protein-2 mRNA were increased in lung neutrophils from endotoxemic or hemorrhaged mice compared with those present in lung neutrophils from control mice or in peripheral blood neutrophils from endotoxemic, hemorrhaged, or control mice. The transcriptional regulatory factors NF-kappa B and cAMP response element binding protein were activated in lung but not blood neutrophils after hemorrhage or endotoxemia. Xanthine oxidase inhibition, achieved by feeding allopurinol or tungsten-containing diets, did not affect neutrophil trafficking to the lungs after hemorrhage or endotoxemia. Xanthine oxidase inhibition did prevent hemorrhage- but not endotoxemia-induced increases in proinflammatory cytokine expression among lung neutrophils. Hemorrhage- or endotoxemia-associated activation of NF-kappa B in lung neutrophils was not affected by inhibition of xanthine oxidase. cAMP response element binding protein activation was increased after hemorrhage, but not endotoxemia, in mice fed xanthine oxidase-inhibiting diets. Our results indicate that xanthine oxidase modulates cAMP response element binding protein activation and proinflammatory cytokine expression in lung neutrophils after hemorrhage, but not endotoxemia. These findings suggest that the mechanisms leading to acute inflammatory lung injury after hemorrhage differ from those associated with endotoxemia.

Animals↗

PubMed1998

A zinc finger homeodomain transcription factor binds specific thyroid hormone response elements.

Thyroid hormone receptors can act through response elements (TREs) having a wide variation of sequence. We screened for transcription factors that bind the rat (r) glycoprotein hormone alpha-subunit TRE (alpha-sub), and isolated a cDNA, termed zinc finger homeodomain enhancer-binding protein (Zfhep), which encodes two separate zinc finger domains (ZD1 and ZD2), and a region similar to homeodomains. DNA-binding assays show that ZD1 or ZD2 can bind the alpha-subunit, rat growth hormone, or thyrotropin beta (TSHbeta) gene TREs, but do not bind DR4 or palindromic (pal) TREs. Methylation interference footprinting demonstrates that Zfhep binds the alpha-sub overlapping the TR-binding site. Similarly, the ZD1 protein footprints over TR-binding halfsites of the rat growth hormone (rGH) and TSHbeta TREs. Hence, Zfhep binding is dependent on sequences within and outside the AGGTCA TR-binding halfsite. Interactions of non-receptor transcription factors (such as Zfhep) with certain TREs are important to modify gene-specific regulation by thyroid hormones.

Amino Acid Sequence↗

PubMed1995

Transcription factors RFX1/EF-C and ATF-1 associate with the adenovirus E1A-responsive element of the human proliferating cell nuclear antigen promoter.

The proliferating cell nuclear antigen (PCNA) is an adenovirus E1A-inducible factor that is intimately linked to the processes of DNA replication and cell cycle regulation. Previously, we defined a novel cis-acting element, the PCNA E1A-responsive element (PERE), that confers induction by the E1A 243R oncoprotein upon the human PCNA promoter. To better understand the regulation of PCNA expression by E1A 243R, we have identified cellular transcription factors that associate with the PERE. In electrophoretic mobility shift assays, the PERE formed three major complexes (P1, P2 and P3) with proteins in nuclear extracts from HeLa or 293 cells. Formation of complexes P2 and P3, which correlates with PCNA promoter activity in vivo, requires the activating transcription factor (ATF) binding site found within the PERE [Labrie et al. (1993) Mol. Cell. Biol., 13, 1697-1707]. Antibody interference experiments and mobility shift assays performed with in vitro-synthesized protein indicated that the transcription factor ATF-1 is a major component of these complexes. Similar assays demonstrated that the hepatitis B virus enhancer-associated protein RFX1 constitutes a major component of the P1 complex. In addition, we examined the binding of proteins to the minimal E1A-responsive promoter to identify other factors important for transcription from the PCNA promoter. Mobility shift assays revealed that a fragment encompassing the region from -87 to +62 relative to the transcription initiation site forms at least five complexes, EH1-EH5, with HeLa cell nuclear extracts. The transcription factor YY1 associates with the initiator element of the PCNA promoter. The identification of these transcription factors will allow their roles in the activation of PCNA by E1A to be evaluated.

Activating Transcription Factor 1↗