Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Transient Mutator”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 577 records · Page 32Linked to original sources
PubMed1981

Role of sulA and sulB in filamentation by lon mutants of Escherichia coli K-12.

Cells containing the pleiotropic Escherichia coli mutation lon filament extensively and die after exposure to ultraviolet light. Outside suppressors of the ultraviolet sensitivity, called sul, have previously been described at two loci; these mutations reverse the ultraviolet sensitivity of lon strains but do not affect the mucoidal or degradation defect of these strains. An isogenic set of strains carrying combinations of lon, sulA, and sulI was constructed, and their behavior during normal growth and after ultraviolet treatment was studied. sulA mutations had no detectable phenotype in lon+ cells; the lon sulA strains filamented transiently after ultraviolet irradiation, as did lon+ sul+ cells. We found that the sulB mutation, which alters cell morphology and slows recovery from transient filamentation after ultraviolet treatment, was epistatic to both lon and sulA. Whereas sulA mutations were recessive to the wild-type allele, sulB was partially dominant. The simplest model to account for our observations is that sulA and lon participate in a pathway of filamentation independent of that which produces transient filamentation in wild-type strains; sulB product may be the target of sulA action and may play a role in normal cell division.

Cell Division↗
PubMed2003

Heterozygous mutations of the gene for Kir 1.1 (ROMK) in antenatal Bartter syndrome presenting with transient hyperkalemia, evolving to a benign course.

Bartter-like syndrome encompasses a set of inherited renal tubular disorders associated with hypokalemic metabolic alkalosis, renal salt wasting, hyperreninemic hyperaldosteronism, and normal blood pressure. Antenatal Bartter syndrome, a subtype of Bartter-like syndrome, is characterized by polyhydramnios, premature delivery, life-threatening episodes of fever and dehydration during the early weeks of life, growth retardation, hypercalciuria, and early-onset nephrocalcinosis. Mutations in the bumetanide-sensitive Na-K-2Cl cotransporter (NKCC2) and ATP-sensitive inwardly rectifying potassium channel (ROMK) of the thick ascending limb of Henle's loop have been identified in the antenatal Bartter syndrome. We report the identification of two heterozygous mutations of the gene for Kir 1.1 (ROMK) from an antenatal Bartter syndrome patient who presented at birth with mild salt wasting and a biochemical findings that mimicked primary pseudohypoaldosteronism type 1, such as hyperkalemia and hyponatremia, and evolved to a relatively benign course. We have identified amino acid exchanges Arg338Stop and Met357Thr in the gene exon 5 for ROMK by PCR and direct sequencing. Both mutations alter the C-terminus of the ROMK protein, and can affect channel function.

Amino Acid Substitution↗
PubMed2003

Transient, recurrent, white matter lesions in X-linked Charcot-Marie-Tooth disease with novel connexin 32 mutation.

BACKGROUND: X-linked hereditary demyelinating neuropathies (Charcot-Marie-Tooth Disease [CMTX]) caused by mutations in the connexin 32 (Cx32) gene account for approximately 10% to 20% of all hereditary demyelinating neuropathies. Mild subclinical central nervous system (CNS) involvement has been previously described, and CMTX patients with transient white matter lesions allied to CNS symptoms have very recently been described. This is of potential interest, as Cx32 is widely expressed in both peripheral nerve and the brain. PATIENTS: We describe a family with hereditary demyelinating neuropathy and transient CNS symptoms. For this study, family members underwent genotyping and detailed clinical, electrophysiological, and magnetic resonance imaging examination. RESULTS: We present a CMTX family with a novel mutation in the Cx32 gene. Affected family members show, in addition to the classic polyneuropathy, transient and reversible white matter lesions on magnetic resonance imaging scans, correlating similarly transient CNS symptoms. CONCLUSION: Patients with CMTX can present with transient CNS symptoms and marked white matter lesions on magnetic resonance imaging scans.

Adult↗
PubMed1999

Quantity of partial agonist activity for antiglucocorticoids complexed with mutant glucocorticoid receptors is constant in two different transactivation assays but not predictable from steroid structure.

An unsolved question in steroid hormone action is why the amount of agonist activity displayed by antisteroids is not constant but varies with the assay conditions. Receptor mutations have provided insight into hormone action, presumably due to changes in the tertiary structure of the receptor that alter its interaction surfaces with the transcriptional machinery or/and co-factors. We have now employed two mechanistically different induction assays to determine whether disparate transactivation processes are similarly altered by receptor mutations. The two activation assays studied were (i) the standard induction of GREtkLUC in transiently transfected CV-1 cells and (ii) a novel modulation of endogenous receptor activity by transiently transfected receptors in HeLa cells. Five different mutations in the ligand binding and DNA binding domains of the rat glucocorticoid receptor (CS1, CS1/CD, 451/9, C656G, and R732Q) and seven steroids of varied structures (five antagonists and two agonists) were selected for use. The results in both induction assays were the same. However, no generalizations regarding steroid structure and activity emerged. Neither of two potent glucocorticoids were active with GR-CS1, or GR-CS1/CD, while RU 486 was the only antisteroid with appreciable agonist activity. With the GR-451/9 mutant, three antagonists afforded partial agonist activity. We confirmed that the C656G mutant is both "super-sensitive" and "super-selective" for transactivation. In contrast, the R732Q mutation caused significant decreases in activity with both antagonists and subsaturating concentrations of agonists. This inability to generalize about the behavior of any class of steroids with mutant receptors may reflect an induced fit for each receptor steroid complex. Nevertheless, the activity of a given steroid appeared to be constant in two different transactivation assays for a given mutant receptor. Thus, disparate transactivation processes may utilize identical receptor surfaces, even in the expression of partial agonist activity for specific antiglucocorticoids.

Amino Acid Substitution↗
PubMed2005

A point mutation affecting an SP1 binding site in the promoter of the ferrochelatase gene impairs gene transcription and causes erythropoietic protoporphyria.

OBJECTIVE: Clinical manifestation of erythropoietic protoporphyria (EPP) results from coinheritance of a mutated allele and a wild-type low-expressed allele of the ferrochelatase (FECH) gene. Currently, up to 90 different mutations affecting the coding region or splicing junctions of the FECH gene have been identified. Despite the high molecular heterogeneity, no functional mutations have been previously reported in the promoter region. The weaker allele expression has been controversially associated to the presence of different intragenic polymorphisms. METHODS: We applied a two-step screening strategy using denaturing gradient gel electrophoresis followed by direct sequencing in order to rapidly identify FECH gene mutations in Italian EPP patients. We identified two unrelated subjects showing a normal FECH coding region but a single G>C base substitution at position -250 in the FECH promoter and the -251G, IVS1-23T, and IVS3-48C polymorphisms in trans to the substitution. To investigate the effect of the -250G>C mutation on protein binding to the FECH promoter, we conducted electro mobility shift assay (EMSA) and supershift analysis. To determine its effect on the transcriptional activity, K562 and Jurkat cell lines were transiently transfected. RESULTS: EMSA showed that the -250G>C mutation results in the loss of an SP1 binding site, and transient transfection assays demonstrated that such mutation strongly impairs promoter activity. Moreover, we showed that the -251A>G polymorphism, although unable to affect SP1 binding, displays a significant reduction in the transcriptional activity of the promoter. CONCLUSION: This is the first report of a mutation in the FECH promoter affecting binding of a transcription factor and causing EPP phenotype.

Base Sequence↗
PubMed2005

Glycosylation of the osmoresponsive transient receptor potential channel TRPV4 on Asn-651 influences membrane trafficking.

We identified a consensus N-linked glycosylation motif within the pore-forming loop between the fifth and sixth transmembrane segments of the osmoresponsive transient receptor potential (TRP) channel TRPV4. Mutation of this residue from Asn to Gln (i.e., TRPV4(N651Q)) resulted in loss of a slower migrating band on anti-TRPV4 immunoblots and a marked reduction in lectin-precipitable TRPV4 immunoreactivity. HEK293 cells transiently transfected with the mutant TRPV4(N651Q) exhibited increased calcium entry in response to hypotonic stress relative to wild-type TRPV4 transfectants. This increase in hypotonicity responsiveness was associated with an increase in plasma membrane targeting of TRPV4(N651Q) relative to wild-type TRPV4 in both HEK293 and COS-7 cells but had no effect on overall channel abundance in whole cell lysates. Residue N651 of TRPV4 is immediately adjacent to the pore-forming loop. Although glycosylation in this vicinity has not been reported for a TRP channel, the structurally related hexahelical hyperpolarization-activated cyclic nucleotide-gated channel, HCN2, and the voltage-gated potassium channel, human ether-a-go-go-related (HERG), share a nearly identically situated and experimentally confirmed N-linked glycosylation site which promotes rather than limits channel insertion into the plasma membrane. These data point to a potentially conserved structural and functional feature influencing membrane trafficking across diverse members of the voltage-gated-like ion channel superfamily.

Amino Acid Sequence↗
PubMed2006

Homozygous C2362F von Willebrand factor induces intracellular retention of mutant von Willebrand factor resulting in autosomal recessive severe von Willebrand disease.

The missense mutation of cysteine 2362 to a phenylalanine in von Willebrand factor (VWF) has been detected in several Italian families with autosomal recessive, severe von Willebrand disease. We investigated how this amino acid change in VWF may lead to a predominantly quantitative defect. This mutation was studied in vitro by transient expression of the full-length mutant VWF-C2362F protein and in vivo by analysis of plasma VWF after infusion of 1-deamino-8-d-arginine vasopressin (DDAVP) in a patient homozygous for this mutation. Single transfections of pSVHVWF-C2362F and co-transfections of mutant and wild-type constructs resulted in 8% and 50% VWF antigen, respectively, in conditioned medium. These reduced levels are in accordance with observations in homozygous and heterozygous carriers of the mutation. In addition, VWF-C2362F was retained intracellularly. Similar results were obtained for C2362F and C2362A. After infusion of DDAVP in a homozygous patient, a twofold decrease in half-life of plasma VWF-C2362F was observed. This was not explained by increased susceptibility of recombinant VWF-C2362F to ADAMTS13. It was concluded that VWF-C2362F causes reduced VWF plasma levels due to impaired secretion and intracellular retention. Furthermore, it is the loss of cysteine 2362 rather than the introduction of the bulky amino acid side chain that causes these effects.

ADAM Proteins↗
PubMed2002

NK cell inhibitory receptor Ly-49C residues involved in MHC class I binding.

Mouse NK cells express Ly-49 receptors specific for classical MHC class I molecules. Several of the Ly-49 receptors have been characterized in terms of function and ligand specificity. However, the only Ly-49 receptor-ligand interaction previously described in detail is that between Ly-49A and H-2D(d), as studied by point mutations in the ligand and the crystal structure of the co-complex of these molecules. It is not known whether other Ly-49 receptors bind MHC class I in a similar manner as Ly-49A. Here we have studied the effect of mutations in Ly-49C on binding to the MHC class I molecules H-2K(b), H-2D(b), and H-2D(d). The MHC class I molecules were used as soluble tetramers to stain transiently transfected 293T cells expressing the mutated Ly-49C receptors. Three of nine mutations in Ly-49C led to loss of MHC class I binding. The three Ly-49C mutations that affected MHC binding correspond to Ly-49A residues that are in contact or close to H-2D(d) in the co-crystal, demonstrating that MHC class I binding by Ly-49C is dependent on residues in the same area as that used by Ly-49A for ligand contacts.

Amino Acid Substitution↗
PubMed2006

Two domains that control prefusion stability and transport competence of the measles virus fusion protein.

Most viral glycoproteins mediating membrane fusion adopt a metastable native conformation and undergo major conformational changes during fusion. We previously described a panel of compounds that specifically prevent fusion induced by measles virus (MV), most likely by interfering with conformational rearrangements of the MV fusion (F) protein. To further elucidate the basis of inhibition and better understand the mechanism of MV glycoprotein-mediated fusion, we generated and characterized resistant MV variants. Spontaneous mutations conferring drug resistance were confirmed in transient assays and in the context of recombinant virions and were in all cases located in the fusion protein. Several mutations emerged independently at F position 462, which is located in the C-terminal heptad repeat (HR-B) domain. In peptide competition assays, all HR-B mutants at residue 462 revealed reduced affinity for binding to the HR-A core complex compared to unmodified HR-B. Combining mutations at residue 462 with mutations in the distal F head region, which we had previously identified as mediating drug resistance, causes intracellular retention of the mutant proteins. The transport competence and activity of the mutants can be restored, however, by incubation at reduced temperature or in the presence of the inhibitory compounds, indicating that the F escape mutants have a reduced conformational stability and that the inhibitors stabilize a transport-competent conformation of the F trimer. The data support the conclusion that residues located in the head domain of the F trimer and the HR-B region contribute jointly to controlling F conformational stability.

Amino Acid Sequence↗
PubMed2002

Identification of a new type 2M von Willebrand disease mutation also at position 1324 of von Willebrand factor.

Type 2M von Willebrand disease (VWD) refers to variants with decreased platelet-dependent function that is not associated with the loss of high molecular weight (HMW) von Willebrand factor (VWF) multimers. This category includes the so-called "phenotype B" responsible for inexistent ristocetin-induced but normal botrocetin-induced binding of VWF to platelet glycoprotein lb. The missense mutation G1324S was identified in the first patient reported to display "phenotype B". We report here on the identification in four members of a French family of a missense mutation also affecting this glycine residue but changing it into an alanine residue. These individuals are heterozygous for this mutation and two of them display an additional quantitative VWF deficiency resulting from a stop codon at position 2470. After transient transfection in Cos-7 cells, the mutated recombinant protein harbouring the G1324A substitution was shown to exhibit normal multimers and inexistent ristocetin-induced but normal botrocetin-induced binding to GPIb, confirming the classification of this new mutation as a type 2M VWD mutation.

Adult↗
PubMed1992

Identification and expression of a common missense mutation (L302P) in the acid sphingomyelinase gene of Ashkenazi Jewish type A Niemann-Pick disease patients.

Types A and B Niemann-Pick disease (NPD) result from the deficient activity of acid sphingomyelinase (ASM; E.C. 3.1.4.12) and the resultant lysosomal accumulation of sphingomyelin. Type A disease is a fatal, neurodegenerative disorder of infancy, whereas type B disease has no neurologic manifestations and is characterized primarily by reticuloendothelial involvement and survival into adulthood. Both disorders occur more frequently among individuals of Ashkenazi Jewish ancestry than in the general population. Recently, a missense mutation in the ASM gene (designated R496L) was detected in more than 30% of the ASM alleles from Ashkenazi Jewish type A NPD patients. We report a second, common mutation that resulted from a T to C transition at nucleotide 905 and predicted a leucine to proline substitution at ASM codon 302 (designated L302P). Notably, the L302P mutation occurred in 23.5% (8 of 34) of the Ashkenazi Jewish type A NPD alleles studied. In contrast, it was not found in any of the ASM alleles from non-Jewish type A patients, in 36 alleles from type B patients, or in 100 ASM alleles from normal Ashkenazi Jewish individuals. To confirm the authenticities of the L302P and R496L mutations, each nucleotide change was separately introduced into the full-length ASM cDNA by site-directed mutagenesis and transiently expressed in COS-1 cells. Neither mutation expressed ASM catalytic activity, consistent with the type A phenotype of homoallelic patients. The identification of the L302P mutation should further facilitate molecular carrier detection for NPD in the Ashkenazi Jewish population, particularly because the L302P mutation can be easily detected using the restriction enzyme, AlwNl.

Base Sequence↗
PubMed2005

Nonsense-associated alternative splicing of the human thyroglobulin gene.

INTRODUCTION: We have described in previous articles a nonsense mutation (4588C>T, R1511X) in exon 22 of the thyroglobulin (TG) gene in a member of a family with a complex history of congenital goiter. In the mutated thyroid gland, full-length thyroglobulin mRNA is almost undetectable. However, a smaller transcript is detected in which the mutated exon 22 is skipped and the reading frame restored. It is conceivable that alternative splicing might be a mechanism involved in the rescue of nonsense mutations. METHODS: To investigate whether the detection of the alternative mRNA is due to an increase in its concentration or its preferential amplification during reverse transcriptase-PCR in the absence of the normal full-length mRNA competitor, we set up an assay in which the competitor mRNA was provided. We also studied the effect of the 4588C>T mutation on exon definition and processing using wild-type and mutated minigenes. RESULTS: The detection of the alternative mRNA lacking exon 22 is not caused by the absence of the full-length competitor. In contrast, our results demonstrate that the alternative transcript preferentially accumulates in the mutated thyroid at a level similar to the full-length transcript in control tissue. Transient expression experiments with wild-type and mutated minigenes indicate that the mutated exon is as efficiently spliced as the wild-type, suggesting that the 4588C>T mutation does not interfere with exon 22 definition and processing. CONCLUSIONS: The alternative splicing of the TG gene described in this article constitutes a new case of nonsense-associated alternative splicing. We have shown that the mutation itself does not interfere with exon definition and processing in vitro. Our results support the hypothesis that the alternative splicing of the mutated exon is driven by the interruption of the reading frame.

Alternative Splicing↗
PubMed2004

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.

3' Untranslated Regions↗
PubMed1999

Redesign of cytochrome c peroxidase into a manganese peroxidase: role of tryptophans in peroxidase activity.

Trp191Phe and Trp51Phe mutations have been introduced into an engineered cytochrome c peroxidase (CcP) containing a Mn(II)-binding site reported previously (MnCcP; see Yeung, B. K.-S., et al. (1997) Chem. Biol. 5, 215-221). The goal of the present study is to elucidate the role of tryptophans in peroxidase activity since CcP contains both Trp51 and Trp191 while manganese peroxidase (MnP) contains phenylalanine residues at the corresponding positions. The presence of Trp191 in CcP allows formation of a unique high-valent intermediate containing a ferryl oxo and tryptophan radical called compound I'. The absence of a tryptophan residue at this position in MnP is the main reason for the formation of an intermediate called compound I which contains a ferryl oxo and porphyrin pi-cation radical. In this study, we showed that introduction of the Trp191Phe mutation to MnCcP did not improve MnP activity (specific activity: MnCcP, 0.750 micromol min-1 mg-1; MnCcP(W191F), 0.560 micromol min-1 mg-1. k(cat)/K(m): MnCcP, 0.0517 s-1 mM-1; MnCcP(W191F), 0.0568 s-1 mM-1) despite the fact that introduction of the same mutation to WTCcP caused the formation of a transient compound I (decay rate, 60 s-1). However, introducing both the Trp191Phe and Trp51Phe mutations not only resulted in a longer lived compound I in WTCcP (decay rate, 18 s-1), but also significantly improved MnP activity in MnCcP (MnCcP(W51F, W191F): specific activity, 8.0 micromol min-1 mg-1; k(cat)/K(m), 0. 599 s-1 mM-1). The increase in activity can be attributed to the Trp51Phe mutation since MnCcP(W51F) showed significantly increased MnP activity relative to MnCcP (specific activity, 3.2 micromol min-1 mg-1; k(cat)/K(m), 0.325 s-1 mM-1). As with MnP, the activity of MnCcP(W51F, W191F) was found to increase with decreasing pH. Our results demonstrate that, while the Trp191Phe and Trp51Phe mutations both play important roles in stabilizing compound I, only the Trp51Phe mutation contributes significantly to increasing the MnP activity because this mutation increases the reactivity of compound II, whose oxidation of Mn(II) is the rate-determining step in the reaction mechanism.

Cytochrome-c Peroxidase↗
PubMed1993

Directional regulatory activity of cis-acting elements in the bidirectional alpha 1(IV) and alpha 2(IV) collagen gene promoter.

The genes for the type IV collagen alpha 1 and alpha 2 chains are regulated by a common alpha 130-base pair (bp) bidirectional promoter. In an attempt to explore the regulation of expression of both genes, we have constructed a minilocus plasmid containing minigenes for the human alpha 1 (IV) and alpha 2(IV) collagen genes located head-to-head like the endogenous genes. The directional regulation of this promoter was studied by introducing site-directed mutations into the promoter of the minigenes. In transient transfections the levels of transcripts of both minigenes were measured, and the influence of mutations on the direction of transcription was studied. The mutational analysis showed that a CCCTCCC motif and a GC box located in the center of the common promoter as well as GC boxes in exon 1 of the alpha 2(IV) gene are potent activating elements for both genes. The promoter of the alpha 1(IV) and alpha 2(IV) collagen genes contains no classical TATA boxes. Even so, A+T-rich sequence motifs, which have no obvious homology to the TATA box located 25-30 bp upstream of exon 1 in each gene, direct the initiation of transcription predominantly about 30 bp downstream of their location. Disruption of the A+T-rich sequence decreased the activity of the promoter considerably, and in addition, the generated classical TATA boxes hindered maintenance of normal bidirectional transcription and changed the ratio of the alpha 1(IV) and alpha 2(IV) transcripts. The CCAAT box in the alpha 2(IV) chain coding strand activated the promoter in the alpha 2(IV) gene direction, but not in the alpha 1(IV) gene direction.

Base Sequence↗
PubMed1999

A frame-shift mutation in the type I parathyroid hormone (PTH)/PTH-related peptide receptor causing Blomstrand lethal osteochondrodysplasia.

Blomstrand osteochondrodysplasia (BOCD) is a rare lethal skeletal dysplasia characterized by accelerated endochondral and intramembranous ossification. Comparison of the characteristics of BOCD with type I PTH/PTH-related peptide (PTHrP) receptor-ablated mice reveals striking similarities that are most prominent in the growth plate. In both cases, the growth plate is reduced in size due to a strongly diminished zone of resting cartilage and the near absence of columnar arrangement of proliferating chondrocytes. This overall similarity suggested that an inactivating mutation of the PTH/PTHrP receptor might be the underlying genetic defect causing BOCD. Indeed, inactivating mutations of the PTH/PTHrP receptor have been recently identified in two cases of BOCD. We describe here a novel inactivating mutation in the PTH/PTHrP receptor. Sequence analysis of all coding exons of the type I PTH/ PTHrP receptor gene and complementary DNA of a case with BOCD identified a homozygous point mutation in exon EL2 in which one nucleotide (G at position 1122) was absent. The mutation was inherited from both parents, supporting the autosomal recessive nature of the disease. The missense mutation resulted in a shift in the open reading frame, leading to a truncated protein that completely diverged from the wild-type sequence after amino acid 364. The mutant receptor, therefore, lacked transmembrane domains 5, 6, and 7; the connecting intra- and extracellular loops; and the cytoplasmic tail. Functional analysis of the mutant receptor in COS-7 cells and of dermal fibroblasts obtained from the case proved that the mutation was indeed inactivating. Neither the transiently transfected COS-7 cells nor the dermal fibroblasts responded to a challenge with PTH or PTHrP with a rise in intracellular cAMP levels, in sharp contrast to control cells. Our results provide further evidence that BOCD is caused by inactivating mutations of the type I PTH/PTHrP receptor and underscore the importance of this receptor in mammalian skeletal development.

Adult↗
PubMed1998

Hepatitis B virus mutants associated with 3TC and famciclovir administration are replication defective.

Hepatitis B virus (HBV) variant strains may develop during therapy for chronic infection with the nucleoside analog 2',3'-dideoxy-3'-thiacytidine (3TC). HBV mutants result from isoleucine (I) or valine (V) substitutions in the methionine (M) of the YMDD motif in the viral reverse-transcriptase catalytic domain. In addition, other mutations in the reverse-transcriptase "B domain" involving either a phenylalanine (F)-to-leucine (L) at amino acid 501 (F501L) or an L-to-M substitution at amino acid 515 (L515M) have been observed during 3TC and Famciclovir therapy as well. To determine the biologic consequences of these mutations on viral replication, variant viral genomes were constructed and transiently transfected into hepatocellular carcinoma (HCC) and HEK 293 human embryo kidney-derived cell lines. In transiently transfected HCC cells, the viruses bearing the YI/VDD or F501L mutations had greatly impaired replication as compared to wild-type virus, whereas the virus carrying the L515M substitution showed the least defect. Double mutants with the L515M substitution showed intermediate defect between the YI/VDD or F501L and the L515M single-mutant strains. In contrast, when transfected into HEK 293 cells, the viruses bearing the YI/VDD or L515M mutation replicated as wild-type. However, under conditions of deoxynucleotide depletion produced by hydroxyurea treatment of HEK 293 cells, all mutants but not the wild-type virus exhibited a reduced replication phenotype similar to that observed in HCC cells. In both HCC and HEK 293 cells, the mutant viruses carrying the F501L substitution showed a decreased pregenomic RNA encapsidation level, suggesting that the defect in HBV DNA synthesis occurs at the RNA packaging level. These findings show that 3TC and Famciclovir selected mutations alter the properties of the HBV reverse transcriptase, resulting in impaired viral replication within the cell.

2-Aminopurine↗