Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “mRNA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 559 records · Page 31Linked to original sources
PubMed2002

Unbalanced amounts of HLA-DQA1 allele mRNA: DQA1*03 shows high and DQA1*0501 low amounts of mRNA in heterozygous individuals.

Genes of the HLA-DR, DQ region confer strong susceptibility to type 1 diabetes mellitus (IDDM). A possible mechanism of susceptibility is a difference in the amounts of transcripts of predisposing and neutral or protective haplotypes. In this study we developed an assay to compare the amounts of mRNA of two distinct HLA-DQA1 alleles in peripheral blood lymphocytes (PBLs) of heterozygous individuals, using a quantitative RT-PCR with an internal standard covering all HLA-DQA1 specifities. We also developed an algorithm to calculate the amounts of mRNA for two distinct alleles in heterozygous individuals based on the comparison to the same internal standard. In total, 37 HLA-DQA1 heterozygous individuals were analysed, including patients with IDDM (n = 14) and healthy controls (n = 23). Intra-individually, we observed different amounts of mRNA for different HLA-DQA1 alleles in the order: HLA-DQA1*03 > *01 > *0201 > *05. This order was observed in all individuals. We also observed a variation in the ratio of these unbalanced amounts of mRNA in individuals with the same HLA-DQA1 allele combinations. In all allele combinations the average ratio was increased in patients with IDDM compared to the control samples. HLA-DQA1*03 positive and DQA1*03, *05 heterozygous patients had the highest average ratios. Nevertheless, based on limited sample numbers, these differences did not reach significance. We therefore conclude that variations between HLA-DQA1 alleles are not limited to the nucleotide sequence but are also found at the level of amounts of mRNA.

Diabetes Mellitus, Type 1↗
PubMed1998

Photoperiod affects the ability of testosterone to alter proopiomelanocortin mRNA, but not luteinizing hormone-releasing hormone mRNA, levels in male sheep.

This study tested the hypothesis that photoperiod affects the ability of testosterone to reduce proopiomelanocortin (POMC) mRNA levels in the arcuate nucleus and luteinizing hormone-releasing hormone (LHRH) mRNA levels in both the preoptic area (POA) or medial basal hypothalamus (MBH). Twenty castrated male sheep were assigned to one of four treatment groups (i): short days (SD; n=5) (ii), short days with testosterone (SD+T; n=5) (iii), long days (LD; n=5), or (iii) long days with testosterone (LD+T; n=5). Blood samples were collected twice weekly for the last 3 weeks of photoperiod treatment and assessed for LH to validate the response to photoperiod. After evaluating LH levels, one animal each from the LD+T and SD+T groups was excluded from the analyses. Mean concentrations of LH were lower (P<0.01) in the LD+T group than in the other treatment groups, which did not differ (P>0.10) from each other. Neither POA nor MBH LHRH mRNA levels were affected (P>0.10) by treatment. Conversely, POMC mRNA levels were suppressed (P<0.01) in the LD+T males compared with the other treatment groups which did not differ (P>0.10) from each other. These observations suggest that photoperiod specific, testosterone-induced alterations in LHRH mRNA levels are not a mechanism whereby testosterone suppresses LHRH release, and that increased beta-endorphin synthesis and release do not mediate testosterone-induced seasonal suppression of LHRH release.

Animals↗
PubMed1998

Calcitriol and transforming growth factor-beta upregulate 5-lipoxygenase mRNA expression by increasing gene transcription and mRNA maturation.

Differentiation of the human monocytic cell line Mono Mac 6 with calcitriol plus transforming growth factor-beta (TGFbeta) strongly induces 5-lipoxygenase (5-LO) mRNA and protein expression. The mechanism of 5-LO mRNA induction by these agents was investigated. Analysis of mature 5-LO mRNA by reverse-transcriptase-PCR gave a 42-fold induction which was not due to alterations in 5-LO half life and which was only in part due to an induction of gene transcription. There was an up to fivefold increase in 5-LO primary transcripts by TGFbeta and calcitriol, which could be inhibited by cycloheximide. No significant effects on 5-LO transcription were observed with TGFbeta or calcitriol alone. However, treatment of the cells with either calcitriol or TGFbeta and addition of the corresponding second inducer lead to an about fourfold induction of primary transcript levels. Addition of cycloheximide together with the second inducer inhibited only the TGFbeta but not the calcitriol effects, which indicated that there is a direct stimulation of 5-LO transcription by calcitriol in the presence of TGFbeta-induced proteins. In order to investigate the effects of TGFbeta/calcitriol on 5-LO transcript, elongation and maturation, the relative changes in immature and mature 5-LO RNA species were analyzed by reverse-transcription-PCR. Analysis of exons 1-5 indicated an about threefold induction of 5-LO transcripts by calcitriol/TGFbeta, respectively. However, when exons 6-14 were determined, more pronounced increments were found (3.6-12-fold). Selective analysis of polyadenylated and spliced 5-LO mRNA species gave a 42-fold induction. The effects of both TGFbeta and calcitriol on transcript elongation and maturation were inhibited by cycloheximide. Our results show that induction of 5-LO mRNA by calcitriol and TGFbeta is due to a modest increase in 5-LO gene transcription and to the stimulation of transcript elongation and maturation.

Arachidonate 5-Lipoxygenase↗
PubMed1999

Dexamethasone inhibits both growth hormone (GH)-induction of insulin-like growth factor-I (IGF-I) mRNA and GH receptor (GHR) mRNA levels in rat primary cultured hepatocytes.

Glucocorticoids are potent inhibitors of growth. In this work, we investigated whether glucocorticoids inhibit the stimulatory action of GH on IGF-I gene expression in rat hepatocytes. GH increased IGF-I mRNA levels 11-fold after 24 h, whereas high doses of DXM (10(-6)M) caused a slight (2.6-fold) increase of IGF-I mRNA levels. However, high doses of DXM (10(-6)M) inhibited the induction of IGF-I mRNA by GH. To assess the role of GHR in this inhibition, we investigated the regulation of GHR expression. High doses of DXM decreased GHR mRNA levels. This effect was already detectable 6 h after addition of 10(-6)M DXM and was dose-dependent, with a maximal inhibition observed at a concentration of 10(-6)M. In conclusion, our results show that high doses of DXM inhibits the GH-induced IGF-I gene expression and the GHR gene expression. The parallel decrease of GHR and GH-induced IGF-I mRNA suggests that the GH resistance caused by DXM is mediated by diminished GH receptor synthesis.

Animals↗
PubMed1989

3' noncoding region of phosphoenolpyruvate carboxykinase mRNA contains a glucocorticoid-responsive mRNA-stabilizing element.

The stabilization of phosphoenolpyruvate carboxykinase mRNA by glucocorticoids appears to result from the interaction of an induced factor with an RNA element located in the 3' noncoding sequence of the mRNA. This element can confer glucocorticoid-dependent stabilization upon a heterologous mRNA, and thus strategies developed to investigate the control of mRNA transcription can now be applied to the analysis of hormone-regulated mRNA stabilization.

Animals↗
PubMed1995

Nitric oxide signaling to iron-regulatory protein: direct control of ferritin mRNA translation and transferrin receptor mRNA stability in transfected fibroblasts.

Iron-regulatory protein (IRP) is a master regulator of cellular iron homeostasis. Expression of several genes involved in iron uptake, storage, and utilization is regulated by binding of IRP to iron-responsive elements (IREs), structural motifs within the untranslated regions of their mRNAs. IRP-binding to IREs is controlled by cellular iron availability. Recent work revealed that nitric oxide (NO) can mimic the effect of iron chelation on IRP and on ferritin mRNA translation, whereas the stabilization of transferrin receptor mRNA following NO-mediated IRP activation could not be observed in gamma-interferon/lipopolysaccharide-stimulated murine macrophages. In this study, we establish the function of NO as a signaling molecule to IRP and as a regulator of mRNA translation and stabilization. Fibroblasts with undetectable levels of endogenous NO synthase activity were stably transfected with a cDNA encoding murine macrophage inducible NO synthase. Synthesis of NO activates IRE binding, which in turn represses ferritin mRNA translation and stabilizes transferrin receptor mRNA against targeted degradation. Furthermore, iron starvation and NO release are shown to be independent signals to IRP. The posttranscriptional control of iron metabolism is thus intimately connected with the NO pathways.

Amino Acid Oxidoreductases↗
PubMed1997

A 20-nucleotide (A + U)-rich element of beta2-adrenergic receptor (beta2AR) mRNA mediates binding to beta2AR-binding protein and is obligate for agonist-induced destabilization of receptor mRNA.

The Mr 35,000 beta-adrenergic receptor mRNA-binding protein, termed betaARB protein, is induced by beta-adrenergic agonists and binds to beta2-receptor mRNAs that display agonist-induced destabilization. A cognate sequence in the mRNA was identified previously that provides for betaARB protein binding in vitro. In the present work, the sequence established in vitro for binding of betaARB protein to hamster beta2-adrenergic receptor mRNA was probed in vivo by site-directed mutagenesis of the 3'-untranslated region and expression in Chinese hamster ovary cells. A 20-nucleotide, (A + U)-rich region in the 3'-untranslated region consisting of an AUUUUA hexamer flanked by defined U-rich regions constitutes the binding domain for betaARB protein. U to G substitution in the hexamer region attenuates the binding of betaARB protein, whereas U to G substitution of hexamer and flanking U-rich domains abolishes binding of betaARB protein and stabilizes beta2-adrenergic receptor mRNA levels in transfectant clones challenged with either isoproterenol or cyclic AMP. These results demonstrate that binding of betaARB protein to the 20-nucleotide, (A + U)-rich domain mediates the agonist and cyclic AMP-induced mRNA decay of G protein-linked receptors, such as the beta2-adrenergic receptor.

Adrenergic beta-Agonists↗
PubMed1998

p21(waf1) mRNA contains a conserved element in its 3'-untranslated region that is bound by the Elav-like mRNA-stabilizing proteins.

The Elav-like proteins are specific mRNA-binding proteins that regulate mRNA stability. The neuronal members of this family (HuD, HuC, and Hel-N1) are required for neuronal differentiation. In this report, using purified HuD protein we have localized a high affinity HuD binding site to a 42-nucleotide region within a U-rich tract in the 3'-untranslated region p21(waf1) mRNA. The binding of HuD to this site is readily displaced by an RNA oligonucleotide encoding the HuD binding site of c-fos. The sequence of this binding site is well conserved in human, mouse, and rat p21(waf1) mRNA. p21(waf1) is an inhibitor of cyclin-dependent kinases and proliferating cell nuclear antigen and induces cell cycle arrest at G1/S, a requisite early step in cell differentiation. The identification of an Elav-like protein binding site in the 3'-untranslated region of p21(waf1) provides a novel link between the induction of differentiation, mRNA stability, and the termination of the cell cycle.

Animals↗
PubMed2000

Identification of AUF1 as a parathyroid hormone mRNA 3'-untranslated region-binding protein that determines parathyroid hormone mRNA stability.

Parathyroid hormone (PTH) mRNA levels are post-transcriptionally increased by hypocalcemia and decreased by hypophosphatemia, and this is mediated by cytosolic proteins binding to the PTH mRNA 3'-untranslated region (UTR). The same proteins are also present in other tissues, such as brain, but only in the parathyroid is their binding regulated by calcium and phosphate. The function of the PTH mRNA 3'-UTR-binding proteins was studied using an in vitro degradation assay. Competition for the parathyroid-binding proteins by excess unlabeled 3'-UTR destabilized the full-length PTH transcript in this assay, indicating that these proteins protect the RNA from RNase activity. The PTH RNA 3'-UTR-binding proteins were purified by RNA affinity chromatography of rat brain S-100 extracts. The eluate from the column was enriched in PTH RNA 3'-UTR binding activity. Addition of eluate to the in vitro degradation assay with parathyroid protein extracts stabilized the PTH transcript. A major band from the eluate at 50 kDa was sequenced and was identical to AU-rich binding protein (AUF1). Recombinant AUF1 bound the full-length PTH mRNA and the 3'-UTR. Added recombinant AUF1 also stabilized the PTH transcript in the in vitro degradation assay. Our results show that AUF1 is a protein that binds to the PTH mRNA 3'-UTR and stabilizes the PTH transcript.

3' Untranslated Regions↗
PubMed2000

Interactions of CCCH zinc finger proteins with mRNA. Binding of tristetraprolin-related zinc finger proteins to Au-rich elements and destabilization of mRNA.

Macrophages derived from tristetraprolin (TTP)-deficient mice exhibited increased tumor necrosis factor alpha (TNFalpha) release as a consequence of increased stability of TNFalpha mRNA. TTP was then shown to destabilize TNFalpha mRNA after binding directly to the AU-rich region (ARE) of the 3'-untranslated region of the TNFalpha mRNA. In mammals and in Xenopus, TTP is the prototype of a small family of three known zinc finger proteins containing two CCCH zinc fingers spaced 18 amino acids apart; a fourth more distantly related family member has been identified in Xenopus and fish. We show here that representatives of all four family members were able to bind to the TNFalpha ARE in a cell-free system and, in most cases, promote the breakdown of TNFalpha mRNA in intact cells. Because the primary sequences of these CCCH proteins are most closely related in their tandem zinc finger domains, we tested whether various fragments of TTP that contained both zinc fingers resembled the intact protein in these assays. We found that amino- and carboxyl-terminal truncated forms of TTP, as well as a 77 amino acid fragment that contained both zinc fingers, could bind to the TNFalpha ARE in cell-free cross-linking and gel shift assays. In addition, these truncated forms of TTP could also stimulate the apparent deadenylation and/or breakdown of TNFalpha mRNA in intact cells. Alignments of the tandem zinc finger domains from all four groups of homologous proteins have identified invariant residues as well as group-specific signature amino acids that presumably contribute to ARE binding and protein-specific activities, respectively.

3' Untranslated Regions↗
PubMed2000

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗
PubMed2000

Cell cycle-coupled variation in topoisomerase IIalpha mRNA is regulated by the 3'-untranslated region. Possible role of redox-sensitive protein binding in mRNA accumulation.

Mammalian topoisomerase IIalpha (Topo II) is a highly regulated enzyme essential for many cellular processes including the G(2) cell cycle checkpoint. Because Topo II gene expression is regulated posttranscriptionally during the cell cycle, we investigated the possible role of the 3'-untranslated region (3'-UTR) in controlling Topo II mRNA accumulation. Reporter assays in stably transfected cells demonstrated that, similar to endogenous Topo II mRNA levels, the mRNA levels of reporter genes containing the Topo II 3'-UTR varied during the cell cycle and were maximal in S and G(2)/M relative to G(1). Topo II 3'-UTR sequence analysis and RNA-protein binding assays identified a 177-nucleotide (base pairs 4772-4949) region containing an AUUUUUA motif sufficient for protein binding. Multiple proteins (84, 70, 44, and 37 kDa) bound this region, and the binding of 84- and 37-kDa (tentatively identified as the adenosine- or uridine-rich element-binding factor AUF1) proteins was enhanced in G(1), correlating with decreased Topo II mRNA levels. The binding activity was enhanced in cellular extracts or cells treated with thiol-reducing agents, and increased binding correlated with decreased Topo II mRNA levels. These results support the hypothesis that cell cycle-coupled Topo II gene expression is regulated by interaction of the 3'-UTR with redox-sensitive protein complexes.

3' Untranslated Regions↗
PubMed2001

Interactions of CCCH zinc finger proteins with mRNA: tristetraprolin-mediated AU-rich element-dependent mRNA degradation can occur in the absence of a poly(A) tail.

The CCCH family of tandem zinc finger proteins has recently been shown to promote the turnover of certain mRNAs containing class II AU-rich elements (AREs). In the case of one member of this family, tristetraprolin (TTP), absence of the protein in knockout mice leads to stabilization of two mRNAs containing AREs of this type, those encoding tumor necrosis factor alpha (TNFalpha) and granulocyte-macrophage colony-stimulating factor. To begin to decipher the mechanism by which these zinc finger proteins stimulate the breakdown of this class of mRNAs, we co-transfected TTP and its related CCCH proteins into 293 cells with vectors encoding full-length TNFalpha, granulocyte-macrophage colony-stimulating factor, and interleukin-3 mRNAs. Co-expression of the CCCH proteins caused the rapid turnover of these ARE-containing mRNAs and also promoted the accumulation of stable breakdown intermediates that were truncated at the 3'-end of the mRNA, even further 5' than the 5'-end of the poly(A) tail. To determine whether an intact poly(A) tail was necessary for TTP to promote this type of mRNA degradation, we inserted the TNFalpha ARE into a nonpolyadenylated histone mRNA and also attached a histone 3'-end-processing sequence to the 3'-end of nonpolyadenylated interleukin-3 and TNFalpha mRNAs. In all three cases, TTP stimulated the turnover of the ARE-containing mRNAs, despite the demonstrated absence of a poly(A) tail. These studies indicate that members of this class of CCCH proteins can promote class II ARE-containing mRNA turnover even in the absence of a poly(A) tail, suggesting that the processive removal of the poly(A) tail may not be required for this type of CCCH protein-stimulated mRNA turnover.

Animals↗
PubMed2001

Translational repression of the Escherichia coli alpha operon mRNA: importance of an mRNA conformational switch and a ternary entrapment complex.

Ribosomal protein S4 represses synthesis of the four ribosomal proteins (including itself) in the Escherichia coli alpha operon by binding to a nested pseudoknot structure that spans the ribosome binding site. A model for the repression mechanism previously proposed two unusual features: (i) the mRNA switches between conformations that are "active" or "inactive" in translation, with S4 as an allosteric effector of the inactive form, and (ii) S4 holds the 30 S subunit in an unproductive complex on the mRNA ("entrapment"), in contrast to direct competition between repressor and ribosome binding ("displacement"). These two key points have been experimentally tested. First, it is found that the mRNA pseudoknot exists in an equilibrium between two conformers with different electrophoretic mobilities. S4 selectively binds to one form of the RNA, as predicted for an allosteric effector; binding of ribosomal 30 S subunits is nearly equal in the two forms. Second, we have used S4 labeled at a unique cysteine with either of two fluorophores to characterize its interactions with mRNA and 30 S subunits. Equilibrium experiments detect the formation of a specific ternary complex of S4, mRNA pseudoknot, and 30 S subunits. The existence of this ternary complex is unambiguous evidence for translational repression of the alpha operon by an entrapment mechanism.

Allosteric Site↗
PubMed2003

T-cell-derived interleukin-17 regulates the level and stability of cyclooxygenase-2 (COX-2) mRNA through restricted activation of the p38 mitogen-activated protein kinase cascade: role of distal sequences in the 3'-untranslated region of COX-2 mRNA.

Although interleukin-17 (IL-17) is the pre-eminent T-cell-derived pro-inflammatory cytokine, its cellular mechanism of action remains poorly understood. We explored novel signaling pathways mediating IL-17 induction of the cyclooxygenase-2 (COX-2) gene in human chondrocytes, synovial fibroblasts, and macrophages. In preliminary work, recombinant human (rh) IL-17 stimulated a rapid (5-15 min), substantial (>8-fold), and sustained (>24 h) increase in COX-2 mRNA, protein, and prostaglandin E2 release. Screening experiments with cell-permeable kinase inhibitors (e.g. SB202190 and p38 inhibitor), Western analysis using specific anti-phospho-antibodies to a variety of mitogen-activated protein kinase cascade intermediates, co-transfection studies using chimeric cytomegalovirus-driven constructs of GAL4 DNA-binding domains fused to the transactivation domains of transcription factors together with Gal-4 binding element-luciferase reporters, ectopic overexpression of activated protein kinase expression plasmids (e.g. MKK3/6), or transfection experiments with wild-type and mutant COX-2 promoter constructs revealed that rhIL-17 induction of the COX-2 gene was mediated exclusively by the stress-activated protein kinase 2/p38 cascade. A rhIL-17-dependent transcriptional pulse (1.76 +/- 0.11-fold induction) was initiated by ATF-2/CREB-1 transactivation through the ATF/CRE enhancer site in the proximal promoter. However, steady-state levels of rhIL-17-induced COX-2 mRNA declined rapidly (<2 h) to control levels under wash-out conditions. Adding rhIL-17 to transcriptionally arrested cells stabilized COX-2 mRNA for up to 6 h, a process compromised by SB202190. Deletion analysis using transfected chimeric luciferase-COX-2 mRNA 3'-untranslated region reporter constructs revealed that rhIL-17 increased reporter gene mRNA stability and protein synthesis via distal regions (-545 to -1414 bases) of the 3'-untranslated region. This response was mediated entirely by the stress-activated protein kinase 2/p38 cascade. As such, IL-17 can exert direct transcriptional and post-transcriptional control over target proinflammatory cytokines and oncogenes.

3' Untranslated Regions↗
PubMed2004

Tissue distribution of AU-rich mRNA-binding proteins involved in regulation of mRNA decay.

Short lived cytokine and proto-oncogene mRNAs are destabilized by an A+U-rich element (ARE) in the 3'-untranslated region. Several regulatory proteins bind to AREs in cytokine and proto-oncogene mRNAs, participate in inhibiting or promoting their rapid degradation of ARE mRNAs, and influence cytokine expression and cellular transformation in experimental models. The tissue distribution and cellular localization of the different AU-rich binding proteins (AUBPs), however, have not been uniformly characterized in the mouse, a model for ARE mRNA decay. We therefore carried out immunoblot and immunohistochemical analyses of the different AUBPs using the same mouse tissues. We show that HuR protein, a major AUBP that stabilizes the ARE mRNAs, is most strongly expressed in the thymus, spleen (predominantly in lymphocytic cells), intestine, and testes. AUF1 protein, a negative regulator of ARE mRNA stability, displayed strong expression in thymus and spleen cells within lymphocytic cells, moderate expression in the epithelial linings of lungs, gonadal tissues, and nuclei of most neurons in the brain, and little expression in the other tissues. Tristetraprolin, a negative regulator of ARE mRNA stability, displayed a largely non-overlapping tissue distribution with AUF1 and was predominantly expressed in the liver and testis. KH-type splicing regulatory protein, a presumptive negative regulator of ARE mRNA stability, was distributed widely in murine organs. These results indicate that HuR and AUF1, which functionally oppose each other, have generally similar distributions, suggesting that the balance between HuR and AUF1 is likely important in control of short lived mRNA degradation, lymphocyte development, and/or cytokine production, and possibly in certain aspects of neurological function.

Animals↗
PubMed2005

Reuptake of extracellular amelogenin by dental epithelial cells results in increased levels of amelogenin mRNA through enhanced mRNA stabilization.

Amelogenin is an extracellular matrix protein secreted by ameloblasts and is a major component of enamel matrix. Recently, in addition to their role in enamel formation, the biological activity of enamel proteins in the process of cell differentiation has recently become widely appreciated. In this study, we examined the biological activity of amelogenin on ameloblast differentiation. Recombinant mouse amelogenin (rm-amelogenin) enhanced the expression of endogenous amelogenin mRNA in a cultured dental epithelial cell line (HAT-7), despite a lack of increased amelogenin promoter activity. To solve this discrepancy, we analyzed the effects of rm-amelogenin on the stability of amelogenin mRNA. The half-life of amelogenin mRNA is extremely short, but in the presence of rm-amelogenin its half-life was extended three times longer than the control. Furthermore, we showed the entry of exogenous fluorescein isothiocyanate-conjugated rm-amelogenin into the cytoplasm of HAT-7 cells. It follows from our results that exogenous amelogenin increases amelogenin mRNA levels through stabilization of mRNA in the cytoplasm of HAT-7 cells. Here we speculated that during differentiation, dental epithelial cells utilize a unique mechanism for increasing the production of amelogenin, the reuptake of secreted amelogenin.

3' Untranslated Regions↗
PubMed2003

Daily profiles of plasma prolactin (PRL), growth hormone (GH), insulin-like growth factor-1 (IGF-1), luteinizing hormone (LH), testosterone, and melatonin, and of pituitary PRL mRNA and GH mRNA in male Long Evans rats in acute phase of adjuvant arthritis.

We studied the effects of adjuvant arthritis (AA) on the endocrine circadian rhythms of plasma prolactin (PRL), growth hormone (GH), insulin-like growth factor-1 (IGF-1), luteinizing hormone (LH), testosterone, and melatonin and of pituitary PRL and GH mRNA in male Long Evans rats. Groups of control and AA rats (studied 23 days after AA induction) that were housed under a 12/12 h light/dark cycle (light on at 06:00 h) were killed at 4 h intervals starting at 14:00 h. Cosinor analysis revealed a significant 12 h rhythm in PRL and PRL mRNA (p < 0.001) in controls with peaks at 14:00 h and 02:00 h, respectively. The peak at 02:00 h was abolished in the AA group resulting in a significant 24 h rhythm in parallel with that of PRL (p < 0.05) and PRL mRNA (p < 0.0001). Growth hormone showed no rhythm, but a significant rhythm of GH mRNA was present in both groups (p < 0.0001). Insulin-like growth factor-1 showed a 24 h rhythm in control but not in AA rats. The mean values of GH, GH mRNA, and IGF-1 were significantly reduced in AA. Luteinizing hormone displayed a significant 24 h rhythm (p < 0.01) peaking in the dark period in the control but not AA group. Testosterone showed in phase temporal changes of LH levels with AA abolishing the 02:00 h peak. Melatonin exhibited a significant 24 h rhythm in control (p < 0.001) and AA (p < 0.01) rats with maximum levels during the dark phase; the mesor value was higher in the AA males. These results demonstrate that AA interferes with the rhythms of all the studied hormones except the non-24 h (arrhythmic) GH secretion pattern and the rhythm in melatonin. The persistence of a distinct melatonin rhythm in AA suggests the observed disturbances of hormonal rhythms in this condition do not occur at the level of the pineal gland.

Animals↗