Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 541 records · Page 30Linked to original sources
PubMed2004

[Telomerase inhibitor, telomestatin, a specific mechanism to interact with telomere structure].

A novel telomerase inhibitor, telomestatin, isolated from Streptomyces anulatus is the most potent telomerase inhibitor so far. Telomestatin specifically inhibited telomerase without affecting reverse transcriptases and polymerases. In addition, telomestatin induced telomere shortening, but its ratio was extremely faster than that observed in physiological telomere shortening. These results suggested the existence of other mechanisms to inhibit telomerase. Telomeres consist of guanine rich sequences which compose a characteristic three-dimensional structure designated as G-quadruplex. Stabilization of G-quadruplex structure inhibited the catalysis of not only telomerase but also other DNA interacting molecules. Telomestatin potently stabilized G-quadruplex structure in a specific manner. G-quadruplex structure is also involved in a lot of oncogene promoters. Thus, telomestatin provide the novel therapeutic molecular target for cancer chemotherapy.

Oxazoles↗
PubMed1993

Polynucleotide binding to macrophage scavenger receptors depends on the formation of base-quartet-stabilized four-stranded helices.

Macrophage scavenger receptors exhibit unusually broad, but circumscribed, polyanionic ligand-binding specificity. For example, the polyribonucleotides poly(I) and poly(G) are ligands but poly(A) and poly(C) are not. To further investigate the molecular basis of this polynucleotide-binding specificity, we tested the capacity of various oligodeoxyribonucleic acids to inhibit the scavenger receptor-mediated degradation of 125I-labeled acetylated low density lipoprotein by Chinese hamster ovary cells expressing the type I bovine scavenger receptor. A series of short oligodeoxyriboguanines (dGn, where 5 < or = n < or = 37) were effective inhibitors. The dG6, dG12, and dA5G37 members of this series were shown by circular dichroism and UV spectroscopy to be assembled into four-stranded helices stabilized by G-quartets. [32P]dA5G37 bound directly to scavenger receptors. Partial or complete denaturation of the quadruplex structures of these oligonucleotides by boiling destroyed their inhibitory activity. Receptor activity was also inhibited by d(T4G4)4, a telomere-like oligonucleotide which forms an intramolecular quadruplex. In addition, conversion of the four-stranded potassium salt of poly(I) to the single-stranded lithium salt dramatically reduced its inhibitory activity. Addition of KCl to the Li+ salt resulted in the reformation of poly(I)'s quadruplex structure and restoration of its inhibitory activity. A variety of single-stranded and double-stranded oligo- and polydeoxyribonucleotides (e.g. dA37, HaeIII restriction fragments of phi X174) exhibited very little or no inhibitory activity. Thus, a base-quartet-stabilized four-stranded helix appears to be a necessary structural determinant for polynucleotide binding to and inhibition of scavenger receptors. This conformational requirement accounts for the previously unexplained polyribonucleotide-binding specificity of scavenger receptors. The spatial distribution of the negatively charged phosphates in polynucleotide quadruplexes may form a charged surface which is complementary to the positively charged surface of the collagenous ligand-binding domain of the scavenger receptor.

Animals↗
PubMed2005

Porphyrin derivatives for telomere binding and telomerase inhibition.

The capacity of G-quadruplex ligands to stabilize four-stranded DNA makes them able to inhibit telomerase, which is involved in tumour cell proliferation. A series of cationic metalloporphyrin derivatives was prepared by making variations on a meso-tetrakis(4-N-methyl-pyridiniumyl)porphyrin skeleton (TMPyP). The DNA binding properties of nickel(II) and manganese(III) porphyrins were studied by surface plasmon resonance, and the capacity of the nickel porphyrins to inhibit telomerase was tested in a TRAP assay. The nature of the metal influences the kinetics (the process is faster for Ni than for Mn) and the mode of interaction (stacking or external binding). The chemical alterations did not lead to increased telomerase inhibition. The best selectivity for G-quadruplex DNA was observed for Mn-TMPyP, which has a tenfold preference for quadruplex over duplex.

DNA↗
PubMed2000

Lead is unusually effective in sequence-specific folding of DNA.

DNA quadruplex structures based on the guanine quartet are typically stabilized by monovalent cations such as K(+), Na(+), or NH(+)(3). Certain divalent cations can also induce quadruplex formation, such as Sr(2+). Here we show that Pb(2+) binds with unusually high affinity to the thrombin binding aptamer, d(GGTTGGTGTGGTTGG), inducing a unimolecular folded structure. At micromolar concentrations the binding is stoichiometric, and a single lead cation suffices to fold the aptamer. The lead-induced changes in UV and CD spectra are characteristic of folded quadruplexes, although the long wavelength CD maximum occurs at 312 nm rather than the typical value of 293 nm. The one-dimensional exchangeable proton NMR spectrum shows resonances expected for imino protons involved in guanine quartet base-pairing. Furthermore, two-dimensional NMR experiments reveal NOE contacts typically seen in folded structures formed by guanine quartets, such as the K(+) form of the thrombin aptamer. Only sequences capable of forming guanine quartets appear to bind Pb(+2) tightly and change conformation. This sequence-specific, tight DNA binding may be relevant to possible genotoxic effects of lead in the environment.

Base Pairing↗
PubMed2006

The new models of the human telomere d[AGGG(TTAGGG)3] in K+ solution.

The human telomeric sequence d[AGGG(TTAGGG)(3)] has been found to form different types of G-quadruplex structures. NMR revealed that in Na(+) solution this 22 nucleotide (nt) sequence exhibits an antiparallel structure, whereas crystallographic studies in the presence of K(+) showed a dramatically different parallel structure. The structure of this 22 nt sequence in the presence of K(+) has drawn intense interest as the intracellular K(+) concentration is greater than that of Na(+). However, the question of the type of structure for the 22 nt telomeric sequence in K(+) solution remains open. In this study, we substituted the Gs in the sequence with 8-bromoguanine and examined the resultant structures and thermal stabilities by circular dichroism (CD) spectroscopy. The results suggest that the 22 nt in K(+) solution exists as a mixture of mixed-parallel/antiparallel and chair-type G-quadruplex. To date, the exact structure of human telomeric G-quadruplex in K(+) solution is extremely controversial. The present study provides valuable information for understanding the discrepancies between the crystal and solution studies. We discuss the possible implications of the structure in understanding higher-order telomeric DNA structure and T-loop formation.

Base Sequence↗
PubMed2006

Nuclease resistance of telomere-like oligonucleotides monitored in live cells by fluorescence anisotropy imaging.

Telomeres carry important biological functions such as the protection of chromosomes. In this paper, we have developed a fluorescence anisotropy imaging system for monitoring DNA digestion inside live cells. The nuclease-resistant capability of telomere-like ssDNAs in nuclei of human breast cancer cells is studied. We found that those oligonucleotides were clearly more stable than regular DNA sequences during the time course of the experiments. We conclude that the G-quadruplex structure of the telomere-like ssDNA makes it inherently more stable in intracellular environments than non-G-quadruplex structures. This will help us understand why the G-quadruplex forming telomere sequences were adopted by almost all eukaryotic cells to protect the ends of chromosomes. This is the first time such a phenomenon was observed in live cells. Our fluorescence anisotropy imaging provides an efficient way to directly monitor DNA digestion in any region of live cells in real time, providing insights into many important and related intracellular processes.

Breast Neoplasms↗
PubMed2001

Platination of the (T2G4)4 telomeric sequence: a structural and cross-linking study.

The telomeric sequence (T(2)G(4))(4) was platinated in aqueous solutions containing 50 mM LiClO(4), NaClO(4), or KClO(4). The identification of the guanines which reacted with [Pt(NH(3))(3)(H(2)O)](2+) revealed that the same type of folding exists in the presence of the three cations and that the latter determine the relative stabilities of the G-quadruplex structures in the order K(+) > Na(+) >> Li(+). The tri-ammine complex yielded ca. 40--90% of adducts, mono- and poly-platinated, bound to 4 guanines out of the 16 guanines in the sequence, in the decreasing amounts G9 > G15 >> G3 > G21. The formation of these adducts was interpreted with a G-quadruplex structure obtained by restrained molecular dynamics (rMD) simulations which confirms the schematic model proposed by Williamson et al. [(1989) Cell 59, 871--880]. The bifunctional complexes cis- and trans-[Pt(NH(3))(2)(H(2)O)(2)](2+) also first reacted with G9 and G15 and gave cross-linked adducts between two guanines, which did not exceed 5% each of the products formed. Both the cis and trans isomers formed a G3-G15 platinum chelate, and the second also formed bis-chelates at both ends of the G-quadruplex structure: G3-G15/G9-G21 and G3-G15/G9-G24. The rMD simulations showed that the cross-linking reactions by the trans complex can occur without disturbing the stacking of the three G-quartets.

Base Sequence↗
PubMed2003

G-quartets direct assembly of HIV-1 nucleocapsid protein along single-stranded DNA.

The d(TTGGGGGGTACAGTGCA) sequence, derived from the human immunodeficiency virus type 1 (HIV-1) central DNA flap, can form in vitro an intermolecular parallel DNA quadruplex. This work demonstrates that the HIV-1 nucleocapsid protein (NCp) exhibits a high affinity (10(8) M(-1)) for this quadruplex. This interaction is predominantly hydrophobic, maintained by a stabilization between G-quartet planes and the C-terminal zinc finger of the protein. It also requires 5 nt long tails flanking the quartets plus both the second zinc-finger and the N-terminal domain of NCp. The initial binding nucleates an ordered arrangement of consecutive NCp along the four single-stranded tails. Such a process requires the N-terminal zinc finger, and was found to occur for DNA site sizes shorter than usual in a sequence-dependent manner. Concurrently, NCp binding is efficient on a G'2 quadruplex also derived from the HIV-1 central DNA flap. Apart from their implication within the DNA flap, these data lead to a model for the nucleic acid architecture within the viral nucleocapsid, where adjacent single-stranded tails and NCp promote a compact assembly of NCp and nucleic acid growing from stably and primary bound NCp.

Base Sequence↗
PubMed2006

Factors regulating thermodynamic stability of DNA structures under molecular crowding conditions.

The condition in a living cell is molecularly crowded with various biomolecules. The total concentration of the biomolecules inside Escherichia coli is in the range of 300-400 g/L. This is distinct from typical biomolecular concentrations of less than 1g/L, which is generally used for experiments in vitro. Here, we analyzed quantitatively the effects of molecular crowding on the thermodynamics of antiparallel G-quadruplex formation via Hoogsteen base pairs and of antiparallel hairpin-looped duplex (HP duplex) formation via Watson-Crick base pairs. The free energy changes for G-quadruplex and duplex formations decreased and increased when the concentration of poly(ethylene glycol) 200 was increased from 0 to 40 wt%, respectively. These results showed that the antiparallel G-quadruplex is stabilized under molecular crowding conditions but the HP duplex is destabilized.

Aptamers, Nucleotide↗
PubMed2000

A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations.

We report on the identification of an A.(G.G.G.G).A hexad pairing alignment which involves recognition of the exposed minor groove of opposing guanines within a G.G.G.G tetrad through sheared G.A mismatch formation. This unexpected hexad pairing alignment was identified for the d(G-G-A-G-G-A-G) sequence in 150 mM Na(+) (or K(+)) cation solution where four symmetry-related strands align into a novel dimeric motif. Each symmetric half of the dimeric "hexad" motif is composed of two strands and contains a stacked array of an A.(G.G.G.G).A hexad, a G.G.G.G tetrad, and an A.A mismatch. Each strand in the hexad motif contains two successive turns, that together define an S-shaped double chain reversal fold, which connects the two G-G steps aligned parallel to each other along adjacent edges of the quadruplex. Our studies also establish a novel structural transition for the d(G-G-A-G-G-A-N) sequence, N=T and G, from an "arrowhead" motif stabilized through cross-strand stacking and mismatch formation in 10 mM Na(+) solution (reported previously), to a dimeric hexad motif stabilized by extensive inter-subunit stacking of symmetry-related A.(G.G.G.G).A hexads in 150 mM Na(+) solution. Potential monovalent cation binding sites within the arrowhead and hexad motifs have been probed by a combination of Brownian dynamics and unconstrained molecular dynamics calculations. We could not identify stable monovalent cation-binding sites in the low salt arrowhead motif. By contrast, five electronegative pockets were identified in the moderate salt dimeric hexad motif. Three of these are involved in cation binding sites sandwiched between G.G.G. G tetrad planes and two others, are involved in water-mediated cation binding sites spanning the unoccupied grooves associated with the adjacent stacked A.(G.G.G.G).A hexads. Our demonstration of A.(G. G.G.G).A hexad formation opens opportunities for the design of adenine-rich G-quadruplex-interacting oligomers that could potentially target base edges of stacked G.G.G.G tetrads. Such an approach could complement current efforts to design groove-binding and intercalating ligands that target G-quadruplexes in attempts designed to block the activity of the enzyme telomerase.

Adenine↗
PubMed2004

Distinctive features in the structure and dynamics of the DNA repeat sequence GGCGGG.

G-rich DNA has been known to form a variety of folded and multistranded structures, with even single base modifications causing important structural changes. But, very little is known about the dynamic characteristics of the structures, which may play crucial roles in facilitating the structural transitions. In this background, we report here NMR investigations on the structure and dynamics of a DNA repeat sequence GGCGGG in aqueous solution containing Na+ ions at neutral pH. The chosen sequence d-TGGCGGGT forms a parallel quadruplex with a C-tetrad in the middle, formed by symmetrical pairing of four Cs in a plane via NH2-O2 H-bonds. 13C relaxation measurements at natural abundance for C' sugar carbons provided valuable insight into the sequence specific dynamism of G and C-tetrads in the quadruplex. The C4 tetrad seems to introduce high conformational dynamism at milli- to micro-second time scale in the quadruplex. Concomitantly, there is a decrease in the pico-second time scale dynamics. Interestingly, these effects are seen more prominently at the G-tetrads on the 3' end of C-tetrad than on its 5' end. These observations would have important implications for the roles the tetrads may play in many biological functions.

Base Composition↗
PubMed2004

Solid-state 23Na NMR determination of the number and coordination of sodium cations bound to Oxytricha nova telomere repeat d(G4T4G4).

We report a solid-state (23)Na NMR study of the bound sodium cations in a G-quadruplex formed by Oxytricha nova telomere DNA repeat, d(G(4)T(4)G(4)) (Oxy-1.5). Using a 2D multiple-quantum magic-angle spinning (23)Na NMR method, we observed three sodium cations residing inside the quadruplex channel of the Na(+) form of Oxy-1.5. Each of these sodium cations is sandwiched between two G-quartets. We found no evidence for sodium cations in the T(4) loop region. For comparison, solid-state (15)N MAS NMR spectra were also obtained for the (15)NH(4)(+) form of Oxy-1.5. The insufficient resolution in the (15)N MAS NMR spectra did not permit determination of the number of NH(4)(+) ions inside the quadruplex channel. The solid-state (23)Na and (15)N NMR spectra for Oxy-1.5 were also compared with those obtained for guanosine 5'-monophosphate.

Animals↗
PubMed2005

DNA structure-dependent recruitment of telomeric proteins to single-stranded/double-stranded DNA junctions.

Telomeres protect chromosome ends by assembling unique protein-DNA complexes. TRF2 is a telomere binding protein that is involved in protecting the G-strand overhang, a 3', guanine-rich, overhang at the telomere terminus. TRF2 may protect the G-strand overhang by recognizing some organizational aspect of the telomeric single-stranded/double-stranded (ss/ds) DNA junction. This work demonstrates that TRF2, purified or in crude extracts, recognizes telomeric ss/ds DNA junctions containing wild type telomeric sequence in the ds region and a G-strand overhang with at least one telomeric repeat. Telomeric complexes containing TRF2 and pot1 assemble less efficiently when the G-strand overhang is in the form of an intramolecular G-quadruplex. However, recruitment of the DNA repair proteins, WRN, Mre11, and Ku86, is not inhibited by a G-quadruplex. This suggests that an intramolecular G-quadruplex has the potential to disrupt certain telomeric assemblies, but efficient recruitment of appropriate DNA repair proteins provides the means to overcome this obstacle.

Binding Sites↗
PubMed2004

Development of a pentaplex X-chromosomal short tandem repeat typing system and population genetic studies.

Quadruplex and pentaplex systems for polymerase chain reaction amplification of X-chromosomal short tandem repeats DXS101, HPRTB, DXS8377, DXS981 (STRX1) and DXS6789 were developed for automated profiling of liquid and membrane-bound DNA samples. Chinese, Japanese and Thai populations were typed using a quadruplex system, while German and Philippine populations were analyzed using a five-locus system. Out of 88 meioses studied in Philippine family samples at each locus, a possible one repeat deletion (allele 51 to 50) at DXS8377 was observed in a father-daughter pair. Exact tests performed on genotype data from females in the Philippine, German and Thai populations indicated that these groups conform to Hardy-Weinberg equilibrium. Exact tests for population differentiation indicate significant variations in allele distributions, particularly at loci DXS101, DXS981 and DXS6789. Considered individually, DXS8377 was the most polymorphic and HPRTB the least polymorphic locus in these five populations. When the forensic efficiency of the quadruplex system was calculated, the combined power of discrimination among males (PD(M)) was no lower than 0.998, while among females the combined PD(F) was at least 0.9999 in all populations. The combined power of paternity exclusion was a minimum of 0.998 in trio cases and 0.98 in motherless cases. The addition of locus DXS6789 to the German and Philippine population databases using a pentaplex increased the forensic efficiency of the analysis system.

Asia↗
PubMed1995

A phase diagram for sodium and potassium ion control of polymorphism in telomeric DNA.

Switching between antiparallel and parallel quadruplex structures of telomeric DNA under the control of intracellular Na+ and K+ has been implicated in the pairing of chromosomes during meiosis. Using Raman spectroscopy, we have determined the dependence of the interquadruplex equilibrium of the telomeric repeat of Oxytricha nova, upon solution concentrations of Na+ and K+. Both alkali cations facilitate the formation of an antiparallel foldback quadruplex at low concentration, and a parallel extended quadruplex at higher concentration. However, K+ is more effective than Na+ in inducing the parallel association. We propose a phase diagram relating d(T4G4)4 polymorphism to intracellular [Na+]/[K+] ratios. The phase diagram indicates that the interquadruplex equilibrium is highly sensitive to changes in the mole fraction of either cation when the total concentration falls within the interval 65 to 225 mM, a range which encompasses total of the Na+ and K+ concentrations occurring in a typical mammalian cell. These results support a role for the guanine-rich overhang of eukaryotic DNA in promoting chromosome association during meiotic synapsis.

Animals↗
PubMed2003

Interactions of cryptolepine and neocryptolepine with unusual DNA structures.

Cryptolepine, the main alkaloid present in the roots of Cryptolepis sanguinolenta, presents a large spectrum of biological properties. It has been reported to behave like a DNA intercalator with a preference for GC-rich sequences. In this study, dialysis competition assay and mass spectrometry experiments were used to determine the affinity of cryptolepine and neocryptolepine for DNA structures among duplexes, triplexes, quadruplexes and single strands. Our data confirm that cryptolepine and neocryptolepine prefer GC over AT-rich duplex sequences, but also recognize triplex and quadruplex structures. These compounds are weak telomerase inhibitors and exhibit a significant preference for triplexes over quadruplexes or duplexes.

Alkaloids↗
PubMed2004

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin.

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.

Base Sequence↗
PubMed1998

Porphyrin binding to quadrupled T4G4.

We have recently reported the cation-induced self-assembly of DNA oligomers of the general sequence C4T4G4T1-4G4 into high-molecular weight multistranded structures [Marotta, S.P., Tamburri, P.A., and Sheardy, R.D. (1996) Biochemistry 35, 10484-10492]. The architecture of the proposed structure consists of a series of four leafed G4 tetrads tethered together via one or two T1-4 strands and thus resembles a long four-sided hollow tube with periodic "pockets". These pockets possess electrostatic, hydrogen bonding, and hydrophobic contact points and should be ideal candidates for the binding of small molecules. To assess the potential of using porphyrins as probes for these structures, we have investigated the interaction of tetrakis(4-N-methylpyridyl)porphine (H2TMPyP) with the simple quadruplex formed by T4G4 and with the duplex formed by CGCGATATCGCG. Visible absorption, circular dichroism, and fluorescent energy transfer studies indicate that H2TMPyP binds to both the duplex and quadruplex via intercalation at low [porphyrin]/[DNA molecule] ratios, i.e., in the presence of excess potential DNA binding sites. Analyses of Scatchard plots show that H2TMpyP binds with high affinity to both DNA secondary structures but binds to the quadruplex with an affinity 2 times greater than that of the duplex.

Circular Dichroism↗