Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Reporter expression”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3Linked to original sources
PubMed1991

Expression of a retinoic acid response element-hsplacZ transgene defines specific domains of transcriptional activity during mouse embryogenesis.

Treatment with retinoic acid (RA) is known to produce complex teratogenic effects in vertebrates, and its presence in the developing embryo as an endogenous substance has led to the suggestion that RA might be a natural morphogenetic agent. Although our understanding of the molecular mechanism of RA action has improved considerably with the identification of nuclear receptors for RA (RARs) and RA-responsive genes, the exact relationship between the proposed morphogenetic activity of RA and its teratogenic effects remains to be characterized. Here, we show that a RA response element (RARE) present in the RAR beta gene can direct specific spatial and temporal expression of an hsplacZ transgene during mouse embryogenesis. In the early embryo, the transgene is expressed in a specific anterior-posterior domain that is completely obliterated by treatment of pregnant mice with teratogenic doses of RA. The expression of the transgene becomes more restricted as organogenesis progresses and mimics closely the reported expression of the RAR beta gene. These results suggest that, in vivo, some of the morphogenetic effects of RA could be mediated through localized transcriptional activity controlled by the various RARs. The specific pattern of expression of the RAREhsplacZ transgene does not correlate with the proposed sites of action of RA as defined by its teratogenic effects but does support a role for RA in early anterior-posterior patterning along the body axis.

Animals↗
PubMed1982

Genetically engineered viral vaccines--prospects for the future.

Genetic engineering (recombinant DNA technology)--the revolution in molecular biology--has enabled us to isolate any genes from any source in a pure form, and to move them from one cell to another. It has become possible to program bacterial or yeast cells with foreign genes and force the new host to produce commercially valuable proteins (e.g. hormones, enzymes, diagnostic reagents). It is now also possible to produce viral and bacterial antigens in various types of cells. We hope that this will soon enable us to manufacture vaccines cheaply. The production of a foot-and-mouth-disease virus vaccine--the first promising example of a genetically engineered effective vaccine--has recently been reported. Expression of hepatitis B surface antigen, influenza virus haemagglutinin and polio-virus proteins from the cloned genes have also been reported, and many more viral genes have been cloned although not yet expressed in bacteria. Despite the extremely rapid development, there are a number of problems, both technical and immunological, which have to be extensively studied and eventually solved, before we can hope to obtain effective and safe genetically engineered viral vaccines for clinical use.

Bacteria↗
PubMed2026

Transcriptional Mapping of the Human Cannabinoid Receptor 1 (CNR1) Gene Promoter.

The transcriptional regulation of the cannabinoid receptor 1 (CB1R) by promoter/enhancer elements and transcription factors is an area of cannabinoid research that has historically been understudied. To map the promoter region of the human CNR1 gene (the gene encoding CB1R), a 997-base-pair fragment from the sequence upstream of the CNR1 gene was cloned into a secreted luciferase reporter vector, and a series of deletion fragments were constructed. The transcriptional activity of these constructs was tested in human cell lines from three tissues: neuronal tissue (SHSY5Y), kidney tissue (HEK293T), and colonic epithelium (HCT116). Through this mapping, we have identified two key regulatory regions within the promoter. Increased levels of cAMP suppressed reporter expression from the full-length promoter fragment in all three cell lines, and in silico modeling predicts potential cAMP response elements (CRE) within one of the key regulatory sequences. Additionally, the minimal promoter region for CNR1 also appears to be in the second regulatory region identified, and in silico modeling predicts BRE and INR elements within this sequence. These findings begin to unravel the mechanisms by which CNR1 is transcriptionally regulated.

Humans↗
PubMed1992

[Differences in anti-oncogene p53 expression in human monocytes and lymphocytes in vitro].

The p53 gene has been associated with malignant transformation as well as "anti-oncogene" activity. In the present report expression of p53 in resting and activated human blood monocytes and lymphocytes is analyzed. It is found that human monocytes freshly isolated by continuous percoll gradient centrifugation contained detectable level of p53 mRNA. Stimulation of monocytes by potent activation inducer Staphylococcus Aureus Cowan I for 3-5 hr caused disappearance of r53 mRNA. In contrast, induction of high level of TNF-alpha mRNA was detected. Addition of cycloheximide had no effect on p53 mRNA content in stimulated monocytes, and caused disappearance of mRNA in resting cells. In lymphocytes cultures p53 mRNA was absent in freshly isolated cells and in resting lymphocytes cultured for 20 hr. Activation of lymphocytes by lectin caused accumulation of p53 mRNA. We suggest that r53 gene regulation and functions might be different in human monocytes and lymphocytes.

Blotting, Northern↗
PubMed1990

Structure and regulation of the blast-2/CD23 antigen in epithelial cells from nasopharyngeal carcinoma.

Undifferentiated nasopharyngeal carcinoma (NPC) is tightly associated with the Epstein-Barr virus (EBV) and very heavily infiltrated with T lymphocytes. We demonstrated recently that NPC epithelial cells produce immuno-regulatory molecules, including the Blast-2/CD23 antigen, which is induced in B lymphocytes upon infection by EBV. We demonstrate here that CD23 expression is a non-constant but highly specific feature of epithelial cells from NPC. The C15 and C17 NPC tumor cells express mainly the b form of CD23, which is known to be non-lineage-specific and IL-4-inducible. C17 cells were found also to weakly express the a form of CD23, which has been described as B cell-specific. In addition, several factors potentially released in vivo by tumor infiltrating lymphocytes (TILs) are able to regulate CD23 expression in NPC cells. In particular, we found that IL-4 was a potent inducer of CD23 expression in C15 cells, as shown at both the protein and the mRNA levels. These results, together with the already reported expression of class II MHC antigens and the release of IL-1 by NPC cells, suggest that the interactions between TILs and malignant cells are a key factor in NPC pathogenesis and development.

Animals↗
PubMed1991

Expression of LDL receptor, apolipoprotein B, apolipoprotein A-I and apolipoprotein A-IV mRNA in various mouse organs as determined by a novel RNA-excess solution hybridization assay.

We report expression of LDL receptor, apolipoprotein B (apoB), apolipoprotein A-I (apoA-I) and apolipoprotein A-IV (apoAIV) mRNA in various mouse organs. These mRNA were quantified by an RNA-excess solution hybridization assay. For preparing specific probes, we cloned cDNA fragments of rat LDL receptor, apoB and apoA-I and mouse apoA-IV into the polylinker region of pGEM3Zf(+) and used the recombinant vectors for preparing 32P-labeled cRNA probes as well as RNA standards using the T7 and SP6 promoters flanking the polylinker regions. Preparation of cRNA probes and RNA standards is faster and more convenient than preparing cDNA probes and ssDNA standards. Absolute levels of mRNA were quantified in the liver, intestine, kidney, heart, lung, spleen and adrenals of females of two mouse strains. C3H/HeJ and C57BL/6J. ApoB, apoA-I and apoA-IV genes in mice are expressed in the liver and intestine and LDL receptor gene is expressed mainly in liver, intestine and adrenals. ApoA-I mRNA levels were found to be 730 and 1039 molecules per cell in liver and intestine, respectively, in C3H mice and 762 and 952 molecules per cell in C57BL mice. ApoB mRNA levels were 66 and 170 molecules per cell in the liver and intestine of C3H and 83 and 243 molecules per cell in C57BL, respectively. ApoA-IV mRNA was found to be 3525 and 2964 molecules per cell in the liver and intestine of female C57BL mice, respectively. LDL receptor mRNA levels were 39, 32 and 14 molecules per cell in the liver, intestine and adrenals of C3H.

Animals↗
PubMed1989

Differential expression of two Xenopus c-myc proto-oncogenes during development.

Two distinct Xenopus c-myc cDNA clones have been characterized from an oocyte cDNA library. This allowed a comparison of the c-myc protein sequence across the vertebrate phylum to be made and prominent conservations to be identified. The majority of the sequence differences between the two Xenopus c-myc cDNAs are in the 5' and 3' untranslated regions. Sequence-specific oligonucleotide probes from the 5' untranslated region were used to demonstrate the differential expression of the two c-myc mRNAs during development. One of the mRNAs corresponds to the Xenopus c-myc gene previously reported expressed as a stable maternal mRNA uncoupled from cell division during oogenesis (c-myc I). It is the major mRNA species expressed during oogenesis and is expressed again from the zygotic genome in post-gastrula embryos. In contrast, the second c-myc mRNA (c-myc II) is expressed only from the maternal genome during oogenesis. Primer extension experiments show that in the oocyte the transcriptional initiation sites for c-myc I and c-myc II are at different distances from the translational start site. The 'oocyte-specific' and 'somatic-type' developmental regulation of c-myc is reminiscent of polymerase III 5S RNA gene expression in Xenopus, and may provide new insights into the developmental regulation of genes transcribed by RNA polymerase II.

Amino Acid Sequence↗
PubMed1992

Intracerebral transplants of primary muscle cells: a potential 'platform' for transgene expression in the brain.

After the transplantation of rat primary muscle cells into the caudate or cortex of recipient rats, the muscle cells were able to persist for at least 6 months. Muscle cells transfected with expression plasmids prior to transplantation were able to express reporter genes in the brains for at least 2 months. These results suggest that muscle cells might be a useful 'platform' for transgene expression in the brain.

Animals↗
PubMed1985

Emotional communication in close relationships.

Emotional communication patterns characterizing interactions between partners in close relationships were investigated by asking 29 couples who were married or living together to engage in a videotaped discussion of a problem they were having in their relationship. In a later experimental session, partners identified specific communications that they believed had an important influence on the discussion and then rated the communications in terms of the feelings the communicator intended to convey and the recipient's reactions. Partners attempted to reciprocate both the positive and negative feelings that they perceived their partner to express toward them. However, only negative feelings were actually reciprocated. This was because subjects were sensitive to differences in the negative feelings their partners reported expressing and interpreted those feelings correctly, but they were inaccurate in perceiving their partners' expressions of positive feelings. Men (but not women) interpreted their partners' failures to express love as an indication of hostility, whereas women (but not men) interpreted their partners' lack of hostility as an indication of love. These and other results were conceptualized in terms of a general model of emotional communication. Parameters of the model pertaining to the hostility of partners' communications were often related to women's satisfaction with their relationship and their beliefs about relationships in general. However, they were unrelated to men's satisfaction and general beliefs. This suggested that women are generally more adversely affected by overt expression of hostility than are men.

Adolescent↗
PubMed1991

Temporal and spatial patterns of transgene expression in aging adult mice provide insights about the origins, organization, and differentiation of the intestinal epithelium.

We have used liver fatty acid-binding protein/human growth hormone (L-FABP/hGH) fusion genes to explore the temporal and spatial differentiation of intestinal epithelial cells in 1- to 12-month-old transgenic mice. The intact, endogenous L-FABP gene (Fabpl) was not expressed in the colon at any time. Young adult transgenic mice containing nucleotides -596 to +21 of the rat L-FABP gene linked to the hGH gene (minus its 5' nontranscribed domain) demonstrated inappropriate expression of hGH in enterocytes and many enteroendocrine cells of most proximal and mid-colonic crypts (glands). Rare patches of hGH-negative crypts were present. With increasing age, a wave of "extinction" of L-FABP (-596 to +21)/hGH expression occurred, first in the distal colon and then in successively more proximal regions, leaving by 10 months of age only rare hGH-positive multicrypt patches. At no time during this progressive silencing of transgene expression were crypts observed that contained a mixture of hGH-positive and -negative cells at a particular cell stratum. Young (5-7 weeks) mice containing a L-FABP (-4000 to +21)/hGH transgene also demonstrated inappropriate expression of the transgene in most proximal colonic crypts. However, the additional 3.3 kilobases of upstream sequence resulted in much more rapid extinction of reporter expression, leaving by 5 months of age only scattered single crypts with detectable levels of hGH. This age-related extinction of L-FABP/hGH expression did not involve enterocytes and enteroendocrine cells in the (proximal) small intestine. These results indicate that cis-acting elements outside of nucleotides -4000 to +21 are necessary to fully modulate suppression of colonic L-FABP expression. They also define fundamental changes in colonic epithelial cell populations during adult life. Our data suggest that (i) a single stem cell gives rise to all cells that populate a given colonic crypt, (ii) stem cells represented in several adjacent crypts may be derived from a common progenitor, and (iii) such a progenitor cell may repopulate colonic crypts with stem cells during adult life. Since each colonic crypt contains the amplified descendants of its stem cell, transgenes may be powerful tools for characterizing the spatial and biological features of gut stem cells and their progenitors during life.

Aging↗
PubMed1987

Abundant expression of homeobox genes in mouse embryonal carcinoma cells correlates with chemically induced differentiation.

Mammalian homeobox-containing genes might play a role in embryonal pattern formation. In favor of this view is the recently reported expression of such genes during mouse embryogenesis [Manley, J. L. & Levine, M. S. (1985) Cell 43, 1-2]. The embryo-derived stem cells and in particular the pluripotent embryonal carcinoma (EC) cell lines are generally considered as a valid model of early mouse development. Homeobox-containing genes were shown to be expressed in differentiating EC cells. We have analyzed the expression of several of these genes in three EC cell lines triggered to differentiate by alternative treatments in the presence or in the absence of retinoic acid. In both types of conditions, C17S1 (clone 1003) and PCC7.S Aza R1 EC cells were induced to differentiate into mainly neurones, and PSA-1 EC cells were induced to differentiate into a large spectrum of tissue derivatives. Induction to high levels of expression of several homeobox-containing genes during differentiation occurs only in the presence of retinoic acid. Nonchemical treatment triggering differentiation does not lead to detectable expression of these genes. Accumulation to high amounts of homeobox-containing gene transcripts in these experiments seems to correlate with retinoic acid-induced EC cell differentiation rather than with EC cell differentiation as such.

Animals↗
PubMed1992

Induced CD25 expression in a human B-lymphoma cell line transfected with the Epstein-Barr virus nuclear antigen 2 gene.

Two EBV-negative human B-lymphoma cell lines, BJAB and DG75, were transfected with an Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA-2) gene, which plays a critical role in the EBV-induced immortalization of primary B lymphocytes. Furthermore, DG75 cells were co-transfected with the EBNA-2 gene and a latent membrane protein (LMP) gene. Expression of eight surface antigens on the resultant EBNA-2-expressing cell clones was analyzed by flowcytometry. None of the EBNA-2-expressing cell clones derived from BJAB and DG75 showed a significant increase in the expression of cell surface marker CD23, of which enhancement by EBNA-2 in a different EBV-negative human B cell line, Louckes, was previously reported. Expression of CD25 (IL-2R/Tac) on cell surface, however, was induced in two of six DG75-derived cell clones. One of the two CD25-induced cell clones was expressing EBNA-2 only, and the other was co-expressing EBNA-2 and LMP. The results suggest that EBNA-2 has a potential to up-regulate CD25 independently of CD23 on human B cells.

Antigens, Surface↗
PubMed1992

3,5,3'-Triiodothyronine positively regulates both MyoD1 gene transcription and terminal differentiation in C2 myoblasts.

Thyroid hormones are among the positive regulators of muscle development in vivo, but little is known about the way they work. We demonstrate here that MyoD1, one of the master genes controlling myogenesis, is a target of T3. After proliferating C2 myoblasts have been treated with T3 for 15 h, we observed a rise in MyoD1 expression at both the mRNA and protein levels. This is the first positive hormonal control of MyoD1 gene expression reported so far. We also provide data which suggest that T3 nuclear receptor(s) have a direct role on MyoD1 gene transcription: 1) C2 cells express the alpha 1 form of T3 nuclear receptors; 2) T3 up-regulates MyoD1 gene transcription and does not affect MyoD1 mRNA stability, as demonstrated by run-on and actinomycin D chase experiments, respectively; and 3) this transcriptional activation does not need the synthesis of intermediate protein(s) since it is not abolished by simultaneous treatment with cycloheximide. Moreover, in presence of T3, the increase of MyoD1 transcripts is associated with a faster terminal differentiation. Indeed we observed an earlier expression of various markers of myogenesis including myogenin (a regulatory gene of the MyoD1 family mainly involved in the triggering of terminal differentiation), myosin light chain 1A, and troponin T in T3-treated cells vs. untreated cells. We suggest that the regulation of a pivotal myogenic gene could be an important step in the control exerted by T3 on muscle development in vivo.

Animals↗
PubMed1991

Human dystrophin expression in mdx mice after intramuscular injection of DNA constructs.

Duchenne's muscular dystrophy (DMD), which affects one in 3,500 males, causes progressive myopathy of skeletal and cardiac muscles and premature death. One approach to treatment would be to introduce the normal dystrophin gene into diseased muscle cells. When pure plasmid DNA is injected into rodent skeletal or cardiac muscle, the cells express reporter genes. We now show that a 12-kilobase full-length human dystrophin complementary DNA gene and a 6.3-kilobase Becker-like gene can be expressed in cultured cells and in vivo. When the human dystrophin expression plasmids are injected intramuscularly into dystrophin-deficient mdx mice, the human dystrophin proteins are present in the cytoplasm and sarcolemma of approximately 1% of the myofibres. Myofibres expressing human dystrophin contain an increased proportion of peripheral nuclei. The results indicate that transfer of the dystrophin gene into the myofibres of DMD patients could be beneficial, but a larger number of genetically modified myofibres will be necessary for clinical efficacy.

Animals↗
PubMed1992

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine Deaminase↗
PubMed1992

Markers for dysplasia of the upper aerodigestive tract. Suprabasal expression of PCNA, p53, and CK19 in alcohol-fixed, embedded tissue.

Recognition of premalignant lesions in the oral epithelium has the potential to increase survival rates for squamous cell carcinoma of the oral cavity. It has previously been reported that cytokeratin 19 (CK19), a 40-kd epithelial cytoskeletal protein within the suprabasal squamous epithelium, is a specific marker of moderate-to-severe dysplasia and carcinoma in situ in oral cavity squamous epithelium. In contrast, normal epithelium and hyperplastic lesions reportedly express CK19 only in the basal layer if at all. The authors chose to test and extend this hypothesis by studying suprabasal CK19 expression and dysplasia of the oral cavity and upper aerodigestive tract in paraffin-embedded specimens that had been fixed in alcohol, a superior fixative for the preservation of cytokeratins. The authors examined 56 alcohol-fixed, paraffin-embedded specimens including 37 from the oral cavity, using two antibodies specific for CK19 (Ks19.1 and 4.62), an antibody to the nuclear proliferation marker, proliferating cell nuclear antigen (PCNA) (19A2), and an antibody to the putative tumor suppressor gene, p53 (pAb1801). The lesions were classified as normal, hyperplasia, mild dysplasia, moderate dysplasia, severe dysplasia/carcinoma in situ, or invasive squamous cell carcinoma, following standard histologic criteria. Immunocytochemically stained sections were scored for the presence or absence of suprabasal CK19, suprabasal PCNA, and p53 positivity, regardless of location. The immunostaining patterns of the two anti-CK19 antibodies were essentially equivalent. Except for one laryngeal specimen, normal epithelium, when positive, showed CK19 expression only in scattered cells throughout the basal layer. Proliferating cell nuclear antigen-positive nuclei were found exclusively in the basal layer. In areas of hyperplasia, CK19 immunostaining was absent or confined to the basal layer in 20 of 38 specimens and was expressed in suprabasal cells in 18 of 38 hyperplastic specimens. Proliferating cell nuclear antigen immunostaining in all cases of hyperplasia was limited to the basal layer. Severe dysplasia and carcinoma in situ showed suprabasal CK19 staining in six of nine specimens and no CK19 staining in three of nine specimens. In contrast, suprabasal PCNA immunostaining was found in all dysplasia and carcinoma in situ cases. p53 expression was detected in three of nine severe dysplasia/CIS specimens and was immunocytochemically undetectable in all normal, hyperplasia, and mild to moderate dysplasia specimens. The authors conclude that suprabasal CK19 expression is neither a sensitive nor a specific marker of premalignancy in oral epithelium and cannot be used to distinguish hyperplasia from dysplasia. In contrast, a strong correlation between suprabasal expression of PCNA, a marker for proliferating cells, and dysplasia/carcinoma in situ was evident.(ABSTRACT TRUNCATED AT 400 WORDS)

Antigens, Neoplasm↗
PubMed1992

Expression of GATA-3 during lymphocyte differentiation and mouse embryogenesis.

The GATA family of C4 zinc-finger transcription factors has been implicated in tissue-specific gene regulation in birds and mammals. One of the members of this family, GATA-3, is reportedly expressed specifically in the T-cell lineage, where it interacts with GATA motifs in the TCR-alpha, TCR-beta, and TCR-delta enhancers, thereby controlling the T-cell phenotype. To evaluate the differentiation control properties of GATA-3, we have now documented its expression pattern during lymphoid differentiation and murine embryogenesis. The onset of GATA-3 expression in the lymphoid lineage was studied in a panel of lymphoid (precursor) cell lines by Northern blot analysis. GATA-3 was uniquely expressed in T-lineage lymphocytes expressing TCR and CD3 genes; it was absent from TCR/CD3 mRNA-negative prothymocytes and from all B-lineage cells. In order to obtain information on the expression of GATA-3 outside the immune system, in situ hybridization was performed on mouse embryos on day 11.5-14.5 of gestation. GATA-3 mRNA was detected in fetal thymus and in erythroid cells. Outside the haemopoietic system, we detected GATA-3 mRNA throughout the central nervous system, in kidney, in the epidermis, lens fibers, the inner ear, whisker follicles, and in the primary palate. These data provide new clues about the potential role of GATA-3 during mouse development, and will aid the interpretation of currently ongoing gene knockout experiments.

Adrenal Glands↗
PubMed1990

Some effects of growth conditions on steady state and heat shock induced htpG gene expression in continuous cultures of Escherichia coli.

Most of the data concerning heat shock gene expression reported in the literature are derived from batch culture experiments under substrate and nutrient sufficient conditions. Here, the effects of dilution rate and medium composition on the steady state and heat shock induced htpG gene expression have been investigated in continuous cultures of Escherichia coli, using a chromosomal htpG-lacZ gene fusion. During steady state growth temperature dependent patterns of the relative htpG expression were found to be largely similar, irrespective of the growth condition. However, nitrogen-limited growth resulted in a markedly reduced specific steady state htpG expression as compared to growth under carbon limitation or in complex medium, correlating qualitatively with the total cellular protein content. During heat shock, tight temperature controlled expression was evident. While the relative heat shock induced expression was largely identical at various dilution rates in a given growth medium, significantly different response patterns were observed in the three growth media at any given dilution rate. From these results a clearly temperature regulated htpG expression during both, steady and transient state growth in continuous culture is evident, which is further significantly affected by the growth condition used.

Culture Media↗