Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Polyribonucleotides”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3Linked to original sources
PubMed1986

[Synthesis and functional activity of initiation regions of mRNA translation. II. RNA-ligase synthesis of hepta- and decaribonucleotides--components of 20-base polyribonucleotide templates].

Preparative RNA-ligase synthesis of decaribonucleotides, the 5'-and 3'-constituent parts to be used for the synthesis of 20-base polyribonucleotides] simulating minimal translation initiation regions for phage RNA was carried out. The decamers were obtained via appropriate heptamers also by RNA-ligase catalyzed synthesis. Apart from decamers used to prepare the functionally active 20-base polyribonucleotide, the minimal translation initiation region of the replicase gene (R) in MS2 and fr phage--sequence R(-17----3) and two its variants, decanucleotides for other template modification were also synthesized. Three 5'-terminal decamers were isolated and identified including the natural decamer ApApApCpApUpGpApGpG (-17----(-)8) and those with G(-9)----A(-9) and U(-12)----C(-12) nucleotide substitutions, as well as three 3'-terminal products differing from the natural region ApUpUpCpCpCpApUpG (-7----3) in MS2 RNA by U(-6)----A(-6), U(-6)U(-5)----A(-6)A(-5) and CCC----UUU (-3----(-)1) substitutions.

Base Sequence↗
PubMed1985

Enzymatic synthesis of uniformly 32P-labeled polyribonucleotides and high-specific-activity ribonucleoside 5'-[alpha-32P]diphosphates.

Uniformly 32P-labeled polyribonucleotides of high specific activity can be rapidly and easily synthesized from commercially available ribonucleoside 5'-[alpha-32P]triphosphates by using two enzymes in sequence. Myosin ATPase completely and irreversibly converted any triphosphates to diphosphates in 10 min. The product diphosphates, without purification, can be polymerized by polynucleotide phosphorylase (PNPase) in 1 h with an average yield of 60%. By choosing the desired molar ratio of radioactive and nonradioactive tri- or diphosphates, polymers of a wide range of specific activity can be obtained. Since myosin ATPase and PNPase both have little base specificity, the method can be used to synthesize a radiolabeled polymer of any desired base composition.

Adenosine Triphosphatases↗
PubMed1982

Interaction of polyribosomal components and polyribonucleotides with microtubule proteins.

To demonstrate the affinity of RNA-containing polyribosomal components (isolated from L5178y cells) to microtubules, microtubule protein was attached to an insoluble matrix. In contrast to ribosomes, poly(A)(+)mRNA and poly(A)-RNP were found to bind to the matrix. Using synthetic polyribonucleotides, no significant differences in the binding properties of single- and double stranded polymers of different base composition to microtubule protein were observed. However, binding is dependent on the size of the polymer; a minimal chain length of 12 nucleotide units is required.

Animals↗
PubMed1985

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr.

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.

Base Sequence↗
PubMed1978

Induction by synthetic polyribonucleotide poly(I) of differentiation of cultured mouse myeloid leukemic cells.

The effects of some synthetic polyribonucleotides on induction of differentiation of mouse myeloid leukemic M1 cells were examined. Poly(I) was found to be a potent inducer; on treatment with 100--200 microgram/ml of poly(I) for 2--4 days, M1 cells differentiated into cells resembling macrophages and granulocytes and developed phagocytosis and locomotive activities, Fc receptors and lysozyme activity. Poly(C) was less effective than poly(I) for induction of phagocytic activity, while the other single-stranded RNAs, poly(U) and poly(A), had no effect. Double-stranded RNAs, such as poly(I) . poly(C) and poly(A) . poly(U), were cytotoxic to M1 cells, and differentiation of the cells could not be detected even at the highest tolerable concentrations of these double-stranded RNAs.

Animals↗
PubMed1982

Reactivity of mitomycin C with synthetic polyribonucleotides containing guanine or guanine analogs.

The guanine residues in nucleic acids are believed to be the major covalent binding site of the antibiotic mitomycin C. To identify the specific functional group in guanine which reacts with mitomycin C, reactions were run between the antibiotic and poly(G) analogs in which guanine was blocked at the N-7 or O-6 position, or lacked the 2-amino group. Binding ratios were affected to a small extent in the two former cases, but binding was significantly decreased in the absence of the 2-amino group. These results indicate that the most likely binding site of mitomycin C in synthetic polyribonucleotides is the 2-amino group of guanine residues.

Antibiotics, Antineoplastic↗
PubMed2006

Affinity separation of polyribonucleotide-binding human blood proteins.

Using affinity columns with immobilized poly(A), poly(G), poly(U), poly(C), and poly(A).poly(U) and poly(G) x poly(C) duplexes several polyribonucleotide-binding blood plasma proteins have been captured. Albumin and keratins K1 and K2e have been detected to bind polypurine tracts. The in vitro glycated albumin binds poly(A) and poly(G) more efficiently than the unmodified protein. The major polypyrimidine-binding blood plasma protein (28 kDa) can catalyze the hydrolysis of poly(U).

Blood Proteins↗
PubMed1995

Unusual single-stranded polyribonucleotides as potent anti-HIV agents.

Polyribonucleotides (PTMG and PMTI) containing 1-methyl-6-thioguanosine or 1-methyl-6-thioinosine, respectively, as the sole nucleoside component are shown to be potent inhibitors of various strains of HIV-1 and HIV-2 in a number of human lymphocyte and macrophage cell lines in tissue culture as well as in fresh human peripheral blood lymphocytes and macrophages. PMTI and PMTG exhibit potencies in the range of 10(-7)-10(-8) M in these systems. The polynucleotides are active against virus strains resistant to AZT and pyridinone derivatives. Both PMTI and PMTG are synergistic with AZT and with ddI, and both inhibit HIV reverse transcriptase at nanomolar concentrations. The polymers show little or no toxicity in human cell lines at the highest doses tested (100 micrograms/mL, or about 0.2-1 microM). This class of compounds represents a new lead in AIDS therapeutic drug discovery.

Antiviral Agents↗
PubMed1998

Antiviral oligo- and polyribonucleotides containing selected triazolo[2,3-a]purines.

Several amphipathic (hydrophobic base, hydrophilic backbone) polyribonucleotides have recently been shown to have potent antiviral activity against HIV and human cytomegalovirus (HCMV). The working hypothesis developed during these studies was that the ability to form an ordered, non-hydrogen-bonded array in solution was an important criterion for activity. To explore further the role of structure and molecular size on the inhibition of virus replication, one new polynucleotide and two 32-mer oligonucleotides based on the triazolo[2,3-a]purine ring system have now been prepared. High-molecular-weight polynucleotide 4a (PTPR) and sulfur-containing 32-mer 5b (TTPR) were moderately active against HIV but showed greater potency against HDMV than ganciclovir. Both 4a and 5b gave clear evidence of cooperative melting behavior, whereas inactive 32-mer 5a showed no such behavior.

Animals↗
PubMed1978

Androgenic regulation of elongation of polyribonucleotide chains on rat ventral-prostate chromatin.

The kinetics of polyribonucleotide-chain elongation by rat ventral-prostate RNA polymerase B with homologous chromatin as a template were investigated. Chain elongation was measured under conditions wherein all initiation had occurred, no reinitiation took place and the reaction rate was constant. The kinetic behaviour of prostate RNA polymerase B was consistent with a mathematical model formulated for the multisubstrate enzyme. The addition of each nucleoside triphosphate was independent of the other three. The overall rate of chain elongation was lower when prostate chromatin from castrated rats was used than with prostate chromatin from normal rats. The inclusion of dihydrotestosterone-receptor complexes stimulated the rate of elongation. Androgenic effects did not appear to be directed towards the addition of individual nucleoside triphosphates, but probably towards one of the other major events in RNA-chain elongation, i.e., unwinding of DNA or movement of the enzyme along the template.

Animals↗
PubMed1984

Interaction of the 1 alpha,25-dihydroxyvitamin D3 receptor with RNA and synthetic polyribonucleotides.

The interaction of the 1 alpha,25-dihydroxyvitamin D3 receptor with RNA and synthetic polynucleotides has been examined by using receptor from rachitic chicken intestine. Total intestinal RNA inhibited the binding of receptor to calf thymus DNA-cellulose with an efficiency equivalent to single-stranded DNA. A comparison of the inhibitory activity of several polyribonucleotides gave the following order of activities: poly(I) = poly(G) greater than or equal to double-stranded DNA greater than single-stranded DNA = poly(U). Poly(A), poly(C), and the ribonucleoside monophosphates AMP, GMP, CMP, and UMP had minimal activity. A preference for single-stranded homopolymers was observed [i.e., poly(I) and poly(U) were active, whereas poly(I):poly(C) and poly(U):poly(A) were not]. The ability of nucleic acids to displace receptor from DNA-cellulose was also measured. Both poly(G) and poly(I) were more active than double-stranded DNA in this assay. Furthermore, differences were noted between intestinal RNA fractions separated on the basis of poly(A) content. Receptor also bound to immobilized intestinal RNA and polynucleotides. The KCl concentration necessary to disrupt binding to a given polynucleotide generally paralleled the activity of that molecule in DNA-cellulose inhibition and displacement assays. These results suggest that the 1 alpha,25-dihydroxyvitamin D3 receptor can interact with RNA as well as DNA.

Animals↗
PubMed1998

Polyribonucleotide phosphorylase is a double-stranded DNA-binding protein.

Polyribonucleotide phosphorylase (PNPase) is one of the critical components of the E. coli RNA degradosome, which consists of both PNPase and endoribonuclease RNase E. The function of this complex is to control the rate of mRNA degradation. The PNPase possesses two enzymatic activities, namely 3'-5' processive exoribonuclease activity and 5'-3' RNA polymerase activity. In the present study, we used conventional chromatography to purify an E. coli protein that binds to a specific double-stranded DNA sequence. Microsequencing of the purified protein showed that this DNA-binding protein was PNPase. Our data further demonstrate that PNPase binds to DNA in a sequence-specific manner. These data suggest that PNPase may have previously unappreciated DNA-related functions in addition to its known role in mRNA degradation.

Amino Acid Sequence↗
PubMed1999

Boranophosphates support the RNase H cleavage of polyribonucleotides.

Modification of the phosphodiester linkages in DNA by replacing one of the nonbridging oxygens with borane, BH3, produces an isoelectronic mimic of DNA called boranophosphates. Nonstereoregular oligodeoxyribonucleoside all-boranophosphates are shown here for the first time to elicit the RNase H hydrolysis of polyribonucleotides. We compared the ability of three types of dodecamers (dodecathymidine phosphate, phosphorothioate, and boranophosphate) to mediate the cleavage of poly(A) by Escherichia coli RNase H1. The rates of poly(A) hydrolysis induced by boranophosphates were 76-fold (at 20 degrees C) and 18-fold (at 30 degrees C) greater than the rates induced by dodecathymidine phosphate. In conjunction with the measured melting temperatures for each heteroduplex, carried out under the same conditions as the RNAse H cleavage experiments, the data establish an inverse relationship between the heteroduplex thermostability and the rate of poly(A) hydrolysis. Chromatographic analysis revealed another correlation: the higher the heteroduplex Tm, the higher the pApA:pApApA ratio in the corresponding hydrolysates. The specific content of these final products provides insight into the relative contribution of RNase H1 exonucleolytic/endonucleolytic mechanisms, with a low ratio for the lower melting heteroduplexes reflecting more endonucleolytic-type hydrolysis. In total, our data support the concept that antisense molecules with a weakened hybridization potential enhance the rate of hydrolysis of RNA in RNA-DNA hybrids.

Base Pairing↗
PubMed1982

The interactions of androgen receptor with poly(A)-containing RNA and polyribonucleotides.

The androgen receptor from mouse kidney cytosol binds not only to DNA but also to RNA as assayed by competition with DNA-cellulose centrifugation or by direct binding with agarose-polynucleotides. The dihydrotestosterone-receptor complex interacts more strongly to poly(A)-containing mRNA than to native natural DNA; it binds much more tightly to synthetic poly(G) than to natural DNA and other homopolyribonucleotides such as poly(U), poly(A), or poly(C). Poly(U) is moderately effective in competing for the complex, whereas poly(A) and poly(C) re not effective. Competition studies with heteropolyribonucleotides show that polymers containing G are most effective on binding to the androgen receptor, whereas those containing U are moderately effective, and those containing only A and C are least effective. Several analogues of poly(G), such as poly(X), poly(I), and poly(m7G) interact very well with the dihydrotestosterone-receptor with some differences in the bindings. A double-stranded polymer, poly(I) . poly(C) competes poorly for the androgen receptor. The observations that the androgen receptor binds to RNA and interacts with polyribonucleotides selectively suggest that androgen receptor-RNA interaction could play important roles in gene regulation.

Animals↗
PubMed1963

Polypeptide synthesis in sea urchin embryogenesis: an examination with synthetic polyribonucleotides.

After fertilization of the sea urchin egg the rate of protein synthesis by a cell-free ribosomal system increases markedly. This increase can be attributed to newly synthesized messenger RNA, since (i) the rate of polypeptide synthesis elicited by synthetic messenger polyribonucleotides changes only slightly after fertilization, and (ii) the enzymes for the formation of amino acyl transfer RNA's of phenylalanine and leucine and the polymerization of polypeptide are in excess in the unfertilized egg. Polypeptide synthesis has been characterized in development to the gastrula stage.

Animals↗
PubMedDate not supplied

[Hydrolysis and the inactivation of double-stranded polyribonucleotides by monkey blood serum].

The effect of Macaca rhesus monkey blood serum on double-stranded polyribonucleotide complexes poly (I).poly (C), poly (G).poly (C), and poly (G,I).poly (C) was studied. The poly (I).poly (C) complex was found to be the most sensitive to hydrolysis as indicated by a decrease of the molecular weight, accumulation of acid-soluble products and a sharp decline of the antiviral and interferon-inducing activities in tissue culture after incubation of the complex in the presence of the serum at 37 degrees C for 1 hour. The poly (G).poly (C) complex was the most stable, and retained its original activity in tissue culture and a high molecular weight after 3-hour incubation with the serum. The interferon-inducing activity of all the complexes under study assayed by intravenous injection in a dose of 2 mg to M. rhesus monkeys was similarly low irrespective of their sensitivity to the serum. Conjectural species features of the interferon induction system in monkeys are discussed.

Animals↗
PubMed1992

[Resistance of natural and synthetic polyribonucleotide inducers of interferon to human blood ribonucleases].

The resistance of polyribonucleotide inductors of interferon to blood ribonucleases was studied. Blood resistance of larifan and ridostin in the free and shielded state as well as that of the complexes of poly(I)-poly(C) and poly(G)-poly(C) were also investigated. A protective action of polylysine against the inductors was detected which, in case it had no effect on the biological activity of the drugs, could provide its recommendation as a compound for shielding the inductors.

Carboxymethylcellulose Sodium↗
PubMedDate not supplied

[Interaction of trivaline with single-stranded polyribonucleotides].

Binding of tripeptide H-Val3-(NH)2-Dns (TVP) to polyribonucleotides was studied by fluorescence methods, circular and flow linear dichroism, equilibrium dialysis and electron microscopy. It was found that TVP binds to poly(U) in monomer, dimer and tetramer forms with binding constants of about 10(3), 40, 18.10(4) M, respectively. The cooperativity parameter for peptide dimer binding is 2000. The peptide forms tetramer complexes with poly(A), poly(C), poly(G) also. The formation of a complex between the peptide tetramer and nucleic acid is accompanied by a significant increase in the fluorescence intensity. The cooperative binding of TVP dimers to poly(U), poly(A), poly(C) is accompanied by a dramatic decrease in the flexibility of polynucleotide chains. However, it has a small effect (if any) on the flexibility of the poly(G) chain. The observed similarity of thermodynamic, optical and hydrodynamic++ properties of TVP complexes with single-stranded and double-stranded nucleic acids may reflect a similarity in the geometries of peptide complexes with nucleic acids. Electron microscopy studies show that peptide binding to poly(U) and dsDNA leads to compactization of the nucleic acids caused by interaction between the peptide tetramers bound to a nucleic acid. At the first stage of the compactization process the well-organized rod-like particles are formed, each consisting of one or more single-stranded polynucleotide fibers. Increasing the peptide concentration stimulates a side-by-side association and folding of the rods with the formation of macromolecular "leech-like" structures with the thickness of 20-50 nm.

Circular Dichroism↗