SEARCH · Search PubMed
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
We have compared detailed physical maps of the genomes of four capripoxvirus isolates, representing four capripoxvirus genome types. The comparisons strongly suggest that the progenitor of one of these isolates arose by genetic recombination between members of two of the other three types.
The evolutionary relationships of 26 sequenced members of the poxvirus family have been investigated by comparing their genome organization and gene content and by using DNA and protein sequences for phylogenetic analyses. The central region of the genome of chordopoxviruses (ChPVs) is highly conserved in gene content and arrangement, except for some gene inversions in Fowlpox virus (FPV) and species-specific gene insertions in FPV and Molluscum contagiosum virus (MCV). In the central region 90 genes are conserved in all ChPVs, but no gene from near the termini is conserved throughout the subfamily. Inclusion of two entomopoxvirus (EnPV) sequences reduces the number of conserved genes to 49. The EnPVs are divergent from ChPVs and between themselves. Relationships between ChPV genera were evaluated by comparing the genome size, number of unique genes, gene arrangement and phylogenetic analyses of protein sequences. Overall, genus Avipoxvirus is the most divergent. The next most divergent ChPV genus is Molluscipoxvirus, whose sole member, MCV, infects only man. The Suipoxvirus, Capripoxvirus, Leporipoxvirus and Yatapoxvirus genera cluster together, with Suipoxvirus and Capripoxvirus sharing a common ancestor, and are distinct from the genus Orthopoxvirus (OPV). Within the OPV genus, Monkeypox virus, Ectromelia virus and Cowpox virus strain Brighton Red (BR) do not group closely with any other OPV, Variola virus and Camelpox virus form a subgroup, and Vaccinia virus is most closely related to CPV-GRI-90. This suggests that CPV-BR and GRI-90 should be separate species.
This paper reports the development and evaluation of serological tests for the differentiation of antibodies in animals infected with capripox and parapox viruses. Agar-gel immunodiffusion tests using sera from sheep with naturally-acquired infections and from sheep experimentally inoculated with orf or capripox viruses showed cross reactions. Virus-specific antibody responses to structural proteins of the viruses were analysed by Western-blot analysis. This analysis readily differentiated the infections as either capripox or contagious pustular dermatitis. The antibody responses to the 32 kDa and 26 kDa proteins of capripoxvirus provided a firm basis for differentiation.
Cattle were vaccinated with a recombinant capripox-rinderpest vaccine designed to protect cattle from infection with either rinderpest virus (RPV) or lumpy skin disease virus (LSDV). Vaccination did not induce any adverse clinical responses or show evidence of transmission of the vaccine virus to in-contact control animals. Approximately 50% of the cattle were solidly protected from challenge with a lethal dose of virulent RPV 2 years after vaccination while at 3 years approx. 30% were fully protected. In the case of LSDV, all of 4 vaccinated cattle challenged with virulent LSDV at 2 years were completely protected from clinical disease while 2 of 5 vaccinated cattle were completely protected at 3 years. The recombinant vaccine showed no loss of potency when stored lyophylized at 4 degrees C for up to 1 year. These results indicate that capripoxvirus is a suitable vector for the development of safe, effective and stable recombinant vaccines for cattle.
Sheep-pox and capripox are contagious diseases of domestic small ruminants for which the causal agent is a poxvirus classified into the Capripoxvirus genus. Viruses of this group have a host range specific to sheep, goats, cattle, and possibly buffalo. Thus, they are clearly indicated as vectors for the development of recombinant vaccines for peste des petits ruminants (PPR). Here we report the immune response of goats inoculated with a recombinant capripox-PPR hemagglutinin.
Sheeppox virus (SPPV) is a major livestock pathogen causing economic hardship through reduced production and death of vulnerable sheep, with written descriptions of sheeppox-like disease recorded since antiquity. We report 21 novel ancient SPPV genomes spanning the Eurasian steppe Bronze Age (∼1700 BCE) to the Early Modern period in Western Europe, including multiple genomes obtained from medieval parchment. We estimate that major capripoxvirus lineages diverged ∼11,500 to 3700 years ago, overlapping known translocations and bio-cultural developments in sheep. Our dataset supports SPPV diverging first within the lineage leading to goatpox virus and lumpy skin disease virus, and that known gene inactivation events within SPPV and goatpox virus occur in our earliest SPPV genomes. These findings reveal that the food security of Eurasian communities has been threatened by sheeppox for more than 3700 years and provide insights into the genomic evolution and potential host adaptation of SPPV.
INTRODUCTION: Lumpy Skin Disease Virus (LSDV), a member of the genus Capripoxvirus within the family Poxviridae, is an economically important transboundary viral pathogen affecting cattle and water buffalo. The disease causes severe production losses through decreased milk yield, infertility, hide damage, reduced growth performance, and occasional mortality. The rapid geographic spread of LSDV, together with its vectorborne transmission and emerging recombinant strains, has intensified the need for improved understanding of viral pathogenesis, host immune responses, and effective prevention strategies. In particular, the role of the bovine Major Histocompatibility Complex (BoLA/MHC) in regulating antiviral immunity, disease susceptibility, and vaccine responsiveness has gained increasing scientific attention. METHODS: This review summarises the published literature related to the epidemiology, transmission, structure, pathogenesis, diagnosis, prevention, and control of LSDV, with special emphasis on the immunological and molecular role of bovine MHC molecules. Relevant studies concerning BoLA-mediated antigen presentation, immunoinformaticsbased epitope prediction, vaccine development, antiviral drug repurposing, molecular docking, genomic surveillance, and diagnostic approaches, including PCR- and ELISAbased assays, were critically evaluated. Recent advances in computational biology, molecular virology, and host-pathogen interaction studies were also reviewed. RESULTS: The reviewed studies demonstrate that Lumpy Skin Disease Virus (LSDV) possesses a complex double-stranded DNA genome enabling immune modulation and efficient transmission through arthropod vectors such as mosquitoes, ticks, and biting flies. Disease progression involves systemic viral replication, vascular injury, dermal necrosis, and inflammatory skin lesions. Real-time PCR remains the most sensitive diagnostic method for early detection, while ELISA supports surveillance. Evidence highlights the central role of bovine Major Histocompatibility Complex (BoLA) molecules in antigen presentation and T-cell activation. Computational studies identified promising BoLA-binding epitopes and repurposed antiviral candidates, including ivermectin, theaflavin, canagliflozin, and tepotinib, for future therapeutic development. DISCUSSION: Current evidence indicates that effective LSDV control requires integration of molecular diagnostics, vector management, vaccination, and host immunogenetics. BoLAguided immunoinformatics provides promising opportunities for developing multi-epitope vaccines, although experimental validation remains essential. Similarly, repurposed antiviral candidates require comprehensive in vivo and pharmacological evaluation before clinical application. Future research should focus on elucidating viral immune-evasion mechanisms, validating predicted epitopes, and translating computational findings into practical vaccines and therapeutics for sustainable disease control. CONCLUSION: Lumpy Skin Disease continues to pose a major threat to global cattle health and livestock economies. Advances in molecular diagnostics, genomic surveillance, antiviral drug discovery, and BoLA-guided vaccine design provide promising opportunities for improved disease control. Understanding the interaction between LSDV and the bovine MHC system is essential for developing next-generation vaccines, immunotherapeutics, and precision disease-management strategies. Future research should prioritise experimental validation of predicted epitopes, large-scale vaccine trials, and mechanistic studies on host-virus immune interactions to establish effective and sustainable global control programs for LSDV.
Goat pox virus was isolated during an outbreak of pox infection among goats in the Sersenk district, Iraq. The isolated virus grew on the chorioallantoic membranes of developing chick embryos and in primary lamb testis cell cultures. It was identified morphologically as a pox virus and serologically as a member of the Capripoxvirus group in the family Poxviridae. The isolated virus was designated the "Sersenk" strain.
In 1984 capripox entered Bangladesh developing into a severe epidemic causing high mortality in the indigenous goat population. Although at present mainly confined to the western districts the disease has spread to some central and northern districts and unless controlled could spread further. Clinically and biochemically the strain is closely related to a strain previously isolated in central India. It has been shown that restriction endonuclease analysis of the genome of field isolates of capripoxvirus can provide a useful epidemiological technique in investigating outbreaks of capripox.
In order to study the importance of an intact thymidine kinase (TK) gene for the vaccine strain of a southern African capripoxvirus, namely, lumpy skin disease virus (LSDV) (type SA-Neethling), a TK disruption recombinant was generated expressing the Escherichia coli beta-galactosidase (lacZ) reporter gene. A comparative growth study of the recombinant and wild-type (wt) LSDV in TK-positive primary and secondary cells and TK-negative secondary cells was performed. It was found that although recombinant and wt virus both grew in TK-positive cells without selection, the recombinant was unable to grow in TK-negative cells (with or without selection), indicating that TK activity is important, if not essential, for normal growth of LSDV.
Thymidine kinase enzymes isolated from a variety of sources are generally considered to have a native molecular weight of 80-90 kDa composed of two 40-45 kDa subunits. Although these parameters may accurately describe the atypical deoxypyrimidine kinases expressed by members of the Herpesviridae, the nucleotide sequences of thymidine kinase genes isolated from human, mouse, chicken and variety of poxviruses (vaccinia virus, monkeypox virus, variola virus, fowlpox virus and capripoxvirus) predict molecular weights on the order of 20-25 kDa for the derived primary translation products. To resolve this apparent dilemma, velocity sedimentation centrifugation, gel filtration chromatography and protein cross-linking procedures were employed to provide experimental evidence that enzymatically-active vaccinia virus thymidine kinase is a homotetrameric complex of 20 kDa monomers with a native Mr of 80 kDa.
Traditional vaccines against diseases caused by viruses are based on live attenuated viruses or killed virus preparations. Through the application of molecular biology it is now possible to consider several new approaches to making vaccines, which may combine increased efficacy with greater safety. One of these approaches is to manipulate genetically a virus so that it carries and expresses a foreign gene (or part of a gene) which codes for a protective antigen for another disease. Adeno-, polio- and herpesviruses have been engineered to act as vectors in this way but vaccinia virus remains the main candidate for a recombinant virus vector for vaccine use. The broad host-range of vaccinia virus has made it an effective vector for the analysis of expression of "foreign" antigens as well as a tool for the dissection of the host animal's immune system. For practical purposes in veterinary vaccines, recombinant viruses based on other poxviruses, with more restricted host-ranges, may have certain advantages. Work on the development of recombinant avipoxviruses and capripoxviruses as prototype vaccines for use in poultry and ruminants, respectively, is discussed and illustrated.
In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.
Lumpy skin disease virus (LSDV), a member of the capripoxvirus genus of the Poxviridae, is the etiologic agent of an important disease of cattle in Africa. Here we report the genomic sequence of LSDV. The 151-kbp LSDV genome consists of a central coding region bounded by identical 2.4 kbp-inverted terminal repeats and contains 156 putative genes. Comparison of LSDV with chordopoxviruses of other genera reveals 146 conserved genes which encode proteins involved in transcription and mRNA biogenesis, nucleotide metabolism, DNA replication, protein processing, virion structure and assembly, and viral virulence and host range. In the central genomic region, LSDV genes share a high degree of colinearity and amino acid identity (average of 65%) with genes of other known mammalian poxviruses, particularly suipoxvirus, yatapoxvirus, and leporipoxviruses. In the terminal regions, colinearity is disrupted and poxvirus homologues are either absent or share a lower percentage of amino acid identity (average of 43%). Most of these differences involve genes and gene families with likely functions involving viral virulence and host range. Although LSDV resembles leporipoxviruses in gene content and organization, it also contains homologues of interleukin-10 (IL-10), IL-1 binding proteins, G protein-coupled CC chemokine receptor, and epidermal growth factor-like protein which are found in other poxvirus genera. These data show that although LSDV is closely related to other members of the Chordopoxvirinae, it contains a unique complement of genes responsible for viral host range and virulence.
Swinepox virus (SWPV), the sole member of the Suipoxvirus genus of the Poxviridae, is the etiologic agent of a worldwide disease specific for swine. Here we report the genomic sequence of SWPV. The 146-kbp SWPV genome consists of a central coding region bounded by identical 3.7-kbp inverted terminal repeats and contains 150 putative genes. Comparison of SWPV with chordopoxviruses reveals 146 conserved genes encoding proteins involved in basic replicative functions, viral virulence, host range, and immune evasion. Notably, these include genes with similarity to genes for gamma interferon (IFN-gamma) receptor, IFN resistance protein, interleukin-18 binding protein, IFN-alpha/beta binding protein, extracellular enveloped virus host range protein, dUTPase, hydroxysteroid dehydrogenase, superoxide dismutase, serpin, herpesvirus major histocompatibility complex inhibitor, ectromelia virus macrophage host range protein, myxoma virus M011L, variola virus B22R, four ankyrin repeat proteins, three kelch-like proteins, five vaccinia virus (VV) A52R-like family proteins, and two G protein-coupled receptors. The most conserved genomic region is centrally located and corresponds to the VV region located between genes F9L and A38L. Within the terminal 13 kbp, colinearity is disrupted and multiple poxvirus gene homologues are absent or share a lower percentage of amino acid identity. Most of these differences involve genes and gene families with likely functions involving viral virulence and host range. Three open reading frames (SPV018, SPV019. and SPV020) are unique for SWPV. Phylogenetic analysis, genome organization, and amino acid identity indicate that SWPV is most closely related to the capripoxvirus lumpy skin disease virus, followed by the yatapoxvirus yaba-like disease virus and the leporipoxviruses. The gene complement of SWPV better defines Suipoxvirus within the Chordopoxvirinae subfamily and provides a basis for future genetic comparisons.
The Yatapoxvirus genus of poxviruses is comprised of Yaba monkey tumor virus (YMTV), Tanapox virus, and Yaba-like disease virus (YLDV), which all have the ability to infect primates, including humans. Unlike other poxviruses, YMTV induces formation of focalized histiocytomas upon infection. To gain a greater understanding of the Yatapoxvirus genus and the unique tumor formation properties of YMTV, we sequenced the 134,721-bp genome of YMTV. The genome of YMTV encodes at least 140 open reading frames, all of which are also found as orthologs in the closely related YLDV. However, 13 open reading frames found in YLDV are completely absent from YMTV. Common to both YLDV and YMTV are the unusually large noncoding regions between many open reading frames. To determine whether any of these noncoding regions might be functionally significant, we carried out a comparative analysis between the putative noncoding regions of YMTV and similar noncoding regions from other poxviruses. This approach identified three new gene poxvirus families, defined as orthologs of YMTV23.5L, YMTV28.5L, and YMTV120.5L, which are highly conserved in virtually all poxvirus species. Furthermore, the comparative analysis also revealed a 40-bp nucleotide sequence at approximately 14,700 bases from the left terminus that was 100% identical in the comparable intergene site within members of the Yatapoxvirus, Suipoxvirus, and Capripoxvirus genera and 95% conserved in the Leporipoxvirus genus. This conserved sequence was shown to function as a poxvirus late promoter element in transfected and infected cells, but other functions, such as an involvement in viral replication or packaging, cannot be excluded. Finally, we summarize the predicted immunomodulatory protein repertoire in the Yatapoxvirus genus as a whole.
Lumpy skin disease (LSD) virus (LSDV) was isolated for the first time from cattle in Egypt in 2 disease outbreaks. Bovine herpesvirus-4 (BHV-4) and LSDV were detected in a pooled sample from the first outbreak (Suez). Only LSDV was isolated from the second outbreak (Ismalia). The capripoxviruses were identified as LSDV by neutralization with specific antiserum and by their ability to produce generalized LSD in experimentally inoculated cattle.
Lumpy skin disease (LSD) is a disease of cattle, primarily in Africa and Madagascar and rarely in the Middle East. It is caused by a capripoxvirus that belongs to the family Poxviridae. The disease is of economic importance in endemic areas. Effective control of LSD requires accurate and rapid laboratory techniques to confirm a tentative clinical diagnosis. Comparative studies on different diagnostic tests used at different stages of the disease have not been done. The aim of this study was to compare several of these tests. Six seronegative bulls, between 11 and 20 months of age, were infected intravenously and kept in an insect-free facility. The course of the infection was monitored. During a 3-month period blood samples and skin biopsies were collected for virus isolation and polymerase chain reaction (PCR). Skin biopsies were also examined using transmission electron microscopy (TEM). The incubation period in infected animals varied from 4-5 days. The length of the viraemic period did not correlate with the severity of clinical disease. Viraemia was detected from 1-12 days using virus isolation and from 4-11 days using the PCR, which is longer than has previously been reported. Virus was isolated from skin biopsies until Day 39 post infection (p.i.) and PCR could demonstrate viral DNA until Day 92 p.i. Transmission electron microscopy of negatively stained skin biopsies detected LSD virus only in one of the four bulls that developed skin lesions until Day 33 p.i. The PCR was a fast and sensitive method to demonstrate viral DNA in blood and skin samples. It could detect viral nucleic acid in skin lesions 53 days longer than virus isolation. Virus isolation from blood and skin samples was sensitive and reliable, but as a single test it may be too time-consuming to use although this depends on how rapidly the diagnosis must be confirmed. In conclusion, this study showed the PCR to be superior in detecting LSD virus from blood and skin samples. However, virus isolation is still required when the infectivity of the LSD virus is to be determined.