Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “tandem repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 523 records · Page 29Linked to original sources
PubMed1996

Investigation of the transfection capability of cloned tandemly-repeated chicken anaemia virus DNA fragments.

Chicken anaemia virus (CAV) is an icosahedral virus, 25 nm in diameter, which, on the basis of its circular single-stranded DNA genome, has recently been classified in the family, Circoviridae. We have investigated whether infectious, monomeric CAV DNA from recombinant plasmids containing tandemly-repeated CAV replicative form (RF) DNAs, following transfection, was generated by homologous recombination or a replicational release mechanism involving rolling circle replication (RCR) of DNA. Experiments designed to locate the virus strand origin of RCR and/or sites of recombination were performed by sequence analyses of hybrid viruses generated after transfection with cloned tandemly-repeated RFs specified by the sequence-distinct Cux-1 and 26P4 isolates. Positive transfection results obtained from 2 recombinant plasmid constructs were shown to have resulted from homologous recombination occurring at different sites within the RF sequence. Three of 5 hybrid viruses analysed were "circularised" within the same 105 bp sequence, that contains four 19bp repeats and with which promoter/enhancer activity has been associated. This region may represent a novel origin or recombination hot-spot within the CAV genome. A distinctive cruciform-loop structure within the non-coding region was shown to contain an S1 nuclease-sensitive site, detected in CAV RF and in recombinant plasmids containing RF inserts.

Base Sequence↗
PubMed1997

Chicken microsatellite markers isolated from libraries enriched for simple tandem repeats.

The total number of microsatellite loci is considered to be at least 10-fold lower in avian species than in mammalian species. Therefore, efficient large-scale cloning of chicken microsatellites, as required for the construction of a high-resolution linkage map, is facilitated by the construction of libraries using an enrichment strategy. In this study, a plasmid library enriched for tandem repeats was constructed from chicken genomic DNA by hybridization selection. Using this technique the proportion of recombinant clones that cross-hybridized to probes containing simple tandem repeats was raised to 16%, compared with < 0.1% in a non-enriched library. Primers were designed from 121 different sequences. Polymerase chain reaction (PCR) analysis of two chicken reference pedigrees enabled 72 loci to be localized within the collaborative chicken genetic map, and at least 30 of the remaining loci have been shown to be informative in these or other crosses.

Animals↗
PubMed1999

Simultaneous genetic typing from multiple short tandem repeat loci using a 96-capillary array electrophoresis system.

Short tandem repeat (STR) markers are highly polymorphic and widely used in human identification and genetic mapping. We demonstrate fast and reliable genotyping based on the four STR loci vWF, THO1, TPOX, CSF1PO by multiple-capillary array electrophoresis. Extracted human genomic DNA was amplified by polymerase chain reaction (PCR). The PCR products were mixed with pooled allelic ladder as an absolute standard and coinjected from a 96-vial tray. Separations were performed in polyvinylpyrrolidone (PVP) sieving matrix with a one-hour turnaround time, with no degradation over 27 runs. Simultaneous one-color laser-induced fluorescence detection was achieved by using a charge-coupled device (CCD) camera. The allele peaks for the unknown sample were identified by comparing the normalized peak intensities of the mixtures to those of the pooled ladder by using a straightforward algorithm. An extremely high level of confidence in matching the bands was indicated with negligible crosstalk (< 0.89%) between adjacent capillaries. This scheme is applicable for STR genotyping with high resolution, high speed and high throughput.

Algorithms↗
PubMed2000

Rapid and sensitive genotyping of dopamine D4 receptor tandem repeats by automated ultrathin-layer gel electrophoresis.

Prior studies have revealed possible association between the presence of a seven repeat of the 48 bp variable number tandem repeat polymorphism of the human dopamine D4 receptor gene (DRD4) and some normal and pathological human traits, such as novelty seeking, hyperactivity disorders, and substance abuse. Some reports supported this finding whereas others did not. Incorrect genotyping could be one of the reasons for these controversial results, and might originate from preferential amplification of shorter polymerase chain reaction (PCR) products, resulting in the so-called allele dropout. In this paper we optimized the conditions for simultaneous amplification of shorter and longer amplicons of the 48 bp repeat region of the DRD4 gene in order to avoid the loss of the longer allele and consequent incorrect genotyping, using very low DNA template concentrations and partial replacement of 2'-deoxyguanosine-5'-triphosphate (dGTP) by 2'-deoxyinosine-5'-triphosphate (dITP). The optimized PCR method in combination with high throughput automated ultrathin-layer gel electrophoresis was suitable for rapid genotyping from less than a nanogram DNA using noninvasive sampling (buccal epithelial cells). All detected genotypes are presented, including such rear heterozygotes as the 2 x and 8 x 48 bp repeats in the same sample, showing the reliability of our novel detection method of longer alleles in the presence of shorter alleles.

Automation↗
PubMed1994

Identification of a novel tandemly repeated sequence present in an intron of the glucose phosphate isomerase (GPI) gene in mouse and man.

Glucose phosphate isomerase (GPI, glucose 6-phosphate ketol-isomerase, EC 5.3.1.9) is a housekeeping gene expressed in all tissues and organisms that utilize glycolysis and gluconeogenesis. Deficiency in humans leads to a rare form of nonspherocytic hemolytic anemia. We have isolated a 3.2-kb mouse cDNA containing glucose phosphate isomerase coding sequence and a 2.1-kb intronic sequence and a large proportion of the human gene (approaching 55 kb) in four phage lambda recombinants. A 4-kb intronic fragment from the human gene showing homology to the mouse intronic sequence has been isolated and sequenced. The fragment contains approximately 1.5 kb of sequence that is composed of 30 repeat units of a novel 50-bp tandemly repeated units. The mouse intronic sequence contains 18 similar units. The human consensus sequence differs from the mouse consensus sequence at only 7 positions out of 50 (positions 16, 26, 27, 42, 43, 47, and 48). A probe containing the repeat element detects polymorphisms, specific to glucose phosphate isomerase, in human DNA. The repeat element does not appear to be present at any other loci in human DNA. The conservation of this intronic repeat element extends to pig and Chinese hamster.

Animals↗
PubMed1995

Population genetics of short tandem repeat (STR) loci.

To investigate the population genetics of short tandem repeat (STR) polymorphisms in human populations, we have studied the allele frequency distributions of four STR loci (HUMTH01, HUMVWA31, HUMF13A1 and HUMFES) in 16 different population surveys which can be categorised within three broadly defined ethnic groups: Caucasian, Asian (Indian subcontinent), and African (Afro-Caribbean and US black). We have observed that allele frequency distributions of populations within ethnic groups are similar; consequently, genetic distances are an order of magnitude lower than between ethnic groups. Inbreeding coefficients (F-statistics) and calculations of the number of mean heterozygous loci per individual, along with estimates of variance, did not suggest that the populations were substructured. This included a study of an immigrant Asian population known to comprise at least three different sub-groups. Finally, an indication of the discriminating power is given by calculation of likelihood ratios (LR) of each individual tested across all four loci. Approximately 70% of Caucasians give an LR of greater than 10,000; the test is even more discriminating in Afro-Caribbeans--approximately 90% of tests are greater than 10,000.

Alleles↗
PubMed1995

Spanish population data on 7 tetrameric short tandem repeat loci.

Allele and genotype frequencies for 7 tetrameric short tandem repeat loci were determined in a Spanish population sample (N = 186-244) using PCR and subsequent analysis of the PCR products by denaturing polyacrylamide gel electrophoresis followed by silver staining. The loci were HUMFES/FPS, HUMVWA, HUMTHO1, HUMF13B, HUMCSF1PO, HUMF13A1 and HUMTPOX and all loci met Hardy-Weinberg expectations. In addition, little evidence was found for association of alleles among the 7 loci. Thus the allele frequency data can be used in identity testing to estimate the frequency of a multiple PCR-based DNA profile in the Spanish population.

Gene Frequency↗
PubMed2000

Quantitative evaluation of post-bone marrow transplant engraftment status using fluorescent-labeled variable number of tandem repeats.

BACKGROUND: The analysis of highly polymorphic variable number of tandem repeat (VNTR) loci is useful for the estimation of donor-host chimerism in bone marrow transplant recipients. METHODS AND RESULTS: A rapid and sensitive engraftment assay has been developed in which the VNTR loci, D1S80, D17S5, D1S111, and apoB, are amplified with fluorescent-labeled (Cy5.5) oligonucleotide primers, followed by analysis using the Visible Genetics, Inc, OpenGene System. The degree of chimerism is then calculated by determining the percentage of host contribution to the total informative allele peak area. Reconstitution experiments and analysis of 383 posttransplantation DNA samples, isolated from 71 different bone marrow transplant recipients, were evaluated as part of assay development. Reconstitution studies showed assay linearity and sensitivity of at least 1%. Patient results were compared with a previous analysis in which unlabeled PCR products were quantified on silver-stained polyacrylamide gels. High concordance was observed between fluorescent analysis and silver-staining method in all 71 patients. CONCLUSIONS: Fluorescent analysis offers many advantages over previous methods, including faster turnaround time, decreased DNA requirements, greater resolution and/or sensitivity, and objective interpretation.

Bone Marrow Transplantation↗
PubMed2000

Sequence variation of two hypervariable short tandem repeats at the D22S683 and D6S477 loci.

For two short tandem repeats at the D22S683 and D6S477 loci, 30 and 22 selected alleles, respectively were sequenced. A total of 20 different alleles were found for the D22S683 locus and 12 alleles for the D6S477 locus. In both systems the alleles were designated according to the total number of repeats. D22S683 is a hypervariable STR consisting of blocks of (TATC) repeats with a basic sequence structure (TATATC)n (TATC)n (ATC)0-1 (TATC)n. The D6S477 locus consists of blocks of (TCTA) repeats with a basic sequence structure (TCTA)n (TA)1 (TCTA)0-2 (TA)0-1 (TCTA)n. Population data showed a heterozygosity of 0.89 for D22S683 and 0.75 for D6S477. These STRs are promising markers for forensic genetics as they are robust and can be easily included in multiplexes.

Alleles↗
PubMed1996

Identification of a variable number tandem repeat region in the human T cell receptor alpha-delta (TCRAD) locus.

A number of different polymorphisms have been observed in coding as well as in non-coding regions of T cell receptor (TCR) genes. We report the identification and characterization of a highly polymorphic locus in the 3' noncoding region of the human T cell receptor alpha/delta (TCRAD) on chromosome 14. In 202 unrelated individuals, ten different alleles were distinguished by polymerase chain reaction (PCR) and a heterozygosity rate of 64% was calculated. Sequence analysis revealed that this polymorphic region consists of 10 bp imperfect repeat units and represents a variable number tandem repeat region (VNTR). Stable Mendelian inheritance of this novel polymorphic marker was proven in four families. The localization of this VNTR polymorphism in the TCRAD locus should make it a useful system for linkage analysis in immunological disorders with a known role of TCRAD.

Base Sequence↗
PubMed1992

Avian species-specific tandem repeats contain nuclear protein binding sites.

Three avian highly repetitive tandem repeats were identified and examined. These repeats had similar unit lengths (about 42 bp long) but completely different sequences each containing particular protein binding sites. Each of these repeats was found within only one of the five closely related genera studied.

Animals↗
PubMed1996

Long tandemly repeated repetitive (LTRR) sequences in the filamentous cyanobacterium Anabaena sp. PCC 7120.

Nucleotide sequence analysis of the DNA region carrying transposon Tn5-1087b from the Anabaena 7120 nitrogen fixation-deficient mutant YC16 revealed the presence of a novel repeated DNA element in cyanobacteria designated long tandemly repeated repetitive (LTRR) sequence. The LTRR element is 37 bp long and contains an inverted repeat sequence. 17 copies of the LTRR element, 13 of which were completely identical, were identified within a 1.3 kb DNA fragment, which was flanked by two divergently transcribed genes homologous to bacteriophage T4 'gene 15' and Rhizobium meliloti exoD, respectively. LTRR-like sequences occur in several DNA regions in Anabaena 7120 and in other cyanobacteria. Furthermore, the presence of an LTRR-like DNA region in mitochondrial plasmids of Vicia faba indicates strong conservation of such structures during evolution.

Amino Acid Sequence↗
PubMed1998

Short tandem repeat polymorphism evolution in humans.

Forty-five dinucleotide short tandem repeat polymorphisms were typed in ten large samples of a globally distributed set of populations. Although these markers had been selected for high heterozygosity in European populations, we found them to be sufficiently informative for linkage analysis in non-Europeans. Heterozygosity, mean number of alleles, and mean number of private alleles followed a common trend: they were highest in the African samples, were somewhat lower in Europeans and East Asians, and were lowest in Amerindians. Genetic distances also reflected this pattern, and distances modelled after the stepwise mutation model yielded trees that were less in agreement with other genetic and archaeological evidence than distances based on differentiation by drift (FST). Genetic variation in non-Africans seems to be a subset of that in Africans, supporting the replacement hypothesis for the origin of modern humans.

Alleles↗
PubMed1996

HMG box proteins interact with multiple tandemly repeated (GCC)n (GGC)m DNA sequences.

A number of tandemly repeated DNA sequences have the ability to form hairpin structures by forming non-standard base pairs. When (GCC)15 and (GGC)15 strands are annealed together, the expected duplex is the only product. However, when (GCC)15 is annealed with (GCC)10, depending on the relative concentrations, up to five complexes can be detected in native gels. Three of these species are susceptible to limited digestion by Exo VII, suggesting they are duplexes containing single stranded tails. The remaining two bands are resistant to the enzyme, and have low mobility on native gels, consistent with branched structures. The latter complexes bind HMG box proteins, members of a highly abundant class of non-histone proteins of the nucleus. These proteins, modeled in this study by the second box fragment from rat HMG1, HMGb, interact strongly with branched or chemically modified DNA, relative to normal duplexes. The expansion of triplet repeats in genomic DNA is associated with tumor formation as well with a variety of heritable neurologiocal disorders. It is our thesis that the stability of branched intermediate structures that arise in replication of these sequences and promote expansion can be influenced directly by the presence of two highly abundant proteins in the cell nucleus: the HMG box proteins, HMG1/2, and the histone H1, which associates with HMG1/2.

Bacterial Proteins↗
PubMed1990

Frequency distribution of the alleles of several variable number of tandem repeat DNA polymorphisms in the Italian population.

Variable number of tandem repeat (VNTR) DNA polymorphisms were studied in a random sample of 100 Italians. The following systems were used: YNH24/MspI, CMM101/MspI, MLJ14/RsaI, EFD64.2/RsaI, EFD64.2/HinfI, JCZ3.1/HinfI and AW101/EcoRI. For each system, the allele size, number and frequency were determined. The number of alleles, for the different VNTRs, varied from 21 to 44, and the heterozygosity from 70 to 90%. All the VNTRs showed a modal distribution of fragment size and overrepresentation of the lower-molecular-weight DNA fragments. All of them exhibited greater variability than that reported for the North American population. These data will be useful for individual identification purposes and for calculating the probability of random inheritance of a particular allele in the Italian population. The results are discussed in relation with the possible mechanism of generation of new-length alleles.

Alleles↗
PubMed1992

Nucleotide sequence of the Urechis caupo core histone gene tandem repeat.

The 4942 bp nucleotide sequence of a repeating unit from the core histone gene tandem repeat of Urechis caupo and the predicted amino acid sequence of the four core histones are presented. Putative promoter elements including the CAP site and TATA box as well as multiple CAAT-like sequences are identified upstream from each gene. Upstream from each core histone gene are 26 or 30 bp sequences that may have a promoter function and appear to be unique to Urechis histone genes. Located 5' to both H2A and H2B is the 26 bp sequence, GGTCATGTGACTCTAATACCGCGCTG. An identical, but inverted, 26 bp sequence is present upstream of H4. Upstream from the H3 gene, two regions of a 30 bp sequence, GGTCTTGTGGCGGGAACAAATACCGCAACG, are very similar to corresponding regions of the 26 bp sequence. Additional 10 bp conserved sequences, CAGCGGGCGC, are present only upstream from the H2A and H2B genes. Conserved sequences containing a region of dyad symmetry followed by a purine-rich sequence that are typical of histone mRNA termination sites are present 27 to 36 bp 3' from the termination codon. Short repetitive DNA sequence elements are present in the spacer sequences between the H2A and H3 genes and the H2B and H4 gene.

Amino Acid Sequence↗