Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RIBOSOMES”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 523 records · Page 29Linked to original sources
PubMed1990

Identification of a region of Escherichia coli ribosomal protein L2 required for the assembly of L16 into the 50 S ribosomal subunit.

In vitro mutagenesis of rplB was used to generate changes in a conserved region of Escherichia coli ribosomal protein L2 between Gly221 and His231. Mutants were selected by temperature sensitivity using an inducible expression system. A mutant L2 protein with the deletion of Thr222 to Asp228 was readily distinguishable from wild-type L2 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and ribosomes from the strain overexpressing this mutant protein were characterized by sucrose density gradient centrifugation and protein composition. In addition to 30 S and 50 S ribosomal subunits, cell lysates contained a new component that sedimented at 40 S in 1 mM Mg2+ and at 48 S in 10 mM Mg2+. These particles contained mutant L2 protein exclusively, completely lacked L16, and had reduced amounts of L28, L33, and L34. They did not reassociate with 30 S ribosomal subunits and were inactive in polyphenylalanine synthesis. Other mutants in the same conserved region, including the substitution of His229 by Gln229, produced similar aberrant 50 S particles that sedimented at 40 S and failed to associate with 30 S subunits.

Amino Acid Sequence↗
PubMed1990

Identification of a plastid-specific ribosomal protein in the 30 S subunit of chloroplast ribosomes and isolation of the cDNA clone encoding its cytoplasmic precursor.

We describe the isolation and characterization of a chloroplast ribosomal protein and a clone of its cDNA. This protein has no homology to any Escherichia coli ribosomal protein or to any known proteins. Due to this novel finding we propose it be called PSrp-1, i.e. a plastid-specific ribosomal protein. The precursor form of PSrp-1, deduced from the cDNA sequence, is 302-amino acid residues long. The mature PSrp-1, identified by amino-terminal sequencing, is a protein of 236 residues. The NH2-terminal 66 amino acids form the transit peptide that targets PSrp-1 into the chloroplast. We show that PSrp-1 is a protein of the chloroplast 30 S ribosomal subunit by Western blotting and sequencing the excised protein after two-dimensional gel electrophoresis. The possible evolutionary origin of PSrp-1 from the nucleated host cell of the endosymbiont theory is discussed.

Amino Acid Sequence↗
PubMed1986

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene].

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.

Base Sequence↗
PubMed1987

The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28 S ribosomal RNA caused by the toxins.

Ricin is a potent cytotoxic protein derived from the higher plant Ricinus communis that inactivates eukaryotic ribosomes. In this paper we have studied the mechanism of action of ricin A-chain on rat liver ribosomes in vitro. Our findings indicate that the toxin inactivates the ribosomes by modifying both or either of two nucleoside residues, G4323 and A4324, in 28 S rRNA. These nucleotides are located close to the alpha-sarcin cleavage site and become resistant to all ribonucleases tested. The examination of the lability of phosphodiester bonds of these nucleotides to both mild alkaline digestion and aniline treatment at acidic pH suggests that the base of A4324 is removed by the toxin. This unique activity of ricin A-chain was also observed when naked 28 S rRNA is used as a substrate, indicating that the toxin directly acts on the RNA. Similar activity on 28 S rRNA is also exhibited by abrin and modeccin, ricin-related toxins, suggesting a general mechanistic pathway for ribosome inactivation by lectin toxins.

Animals↗
PubMed1994

The importance of conserved nucleotides of 23 S ribosomal RNA and transfer RNA in ribosome catalyzed peptide bond formation.

We have constructed the double mutant G2252C/G2253C in Escherichia coli 23 S rRNA by site-directed mutagenesis. These phylogenetically conserved residues are protected from chemical modification by the 3' CCA terminus of the peptidyl-tRNA site (P site)-bound tRNA. Expression of C2252/C2253 23 S rRNA in E. coli severely compromises cell growth. Mutant rRNA is assembled into 50 S subunits and 70 S ribosomes but is discriminated against in polysomes. Mutant ribosomes function at lower rates in peptidyltransferase assays than wild type ribosomes. To test whether this defect derives from disruption of base pairing with the 2 cytidines of the invariant 3' CCA terminus of tRNA, a mutant E. coli tRNAPhe gene was constructed, with the CCA sequence changed to GGA. As deacylated species, mutant and wild type tRNAPhe inhibit peptidyl transfer identically. Mutant tRNAPhe was aminoacylated in vitro but failed to react as a P site substrate, with either mutant or wild type ribosomes. These results support a role for G2252 and G2253 of 23 S rRNA in peptidyltransferase function and a role for the 3' residues of peptidyl-tRNA in catalytically productive P site interaction; but they fail to provide evidence supporting canonical base pairing between these 23 S residues and the 3' end of peptidyl-tRNA.

Base Sequence↗
PubMed1989

Structure of synthetic unmethylated 16S ribosomal RNA as purified RNA and in reconstituted 30S ribosomal subunits.

16S ribosomal RNA was made by in vitro transcription of a cloned gene, and its structure was compared to authentic 16S ribosomal RNA. The comparison was made by subjecting the two types of 16S rRNA to chemical reagents that react specifically with unpaired bases and determining the extent of reaction by reverse transcription and gel electrophoresis of the cDNA. In solution, the rRNAs were indistinguishable in their pattern of reactivity, except for a difference at A1408 and many differences in the region between residues 470 and 562. When the 16S rRNAs were reconstituted into 30S ribosomal subunits, these reactivity differences were absent. When the synthetic 16S rRNA was reconstituted into 30S subunits and then extracted and tested in solution, its pattern of chemical reactivity in the 470-562 region was the same as authentic 16S rRNA, but differences in the 1408-1410 region persisted. This study indicates that the synthetic 16S rRNA has a secondary structure in solution similar to a native secondary structure except in two regions, one apparently incorrectly folded during synthesis and the other in which nucleotides which are normally methylated in authentic 16S rRNA may be responsible for a structural difference.

Base Sequence↗
PubMed2000

A nucleolar protein related to ribosomal protein L7 is required for an early step in large ribosomal subunit biogenesis.

The Saccharomyces cerevisiae Rlp7 protein has extensive identity and similarity to the large ribosomal subunit L7 proteins and shares an RNA-binding domain with them. Rlp7p is not a ribosomal protein; however, it is encoded by an essential gene and therefore must perform a function essential for cell growth. In this report, we show that Rlp7p is a nucleolar protein that plays a critical role in processing of precursors to the large ribosomal subunit RNAs. Pulse-chase labeling experiments with Rlp7p-depleted cells reveal that neither 5.8S(S), 5.8S(L), nor 25S is produced, indicating that both the major and minor processing pathways are affected. Analysis of processing intermediates by primer extension indicates that Rlp7p-depleted cells accumulate the 27SA(3) precursor RNA, which is normally the major substrate (85%) used to produce the 5.8S and 25S rRNAs, and the ratio of 27SB(L) to 27SB(S) precursors changes from approximately 1:8 to 8:1 (depleted cells). Because 27SA(3) is the direct precursor to 27SB(S), we conclude that Rlp7p is specifically required for the 5' to 3' exonucleolytic trimming of the 27SA(3) into the 27SB(S) precursor. As it is essential for processing in both the major and minor pathways, we propose that Rlp7p may act as a specificity factor that binds precursor rRNAs and tethers the enzymes that carry out the early 5' to 3' exonucleolytic reactions that generate the mature rRNAs. Rlp7p may also be required for the endonucleolytic cleavage in internal transcribed spacer 2 that separates the 5.8S rRNA from the 25S rRNA.

Cell Nucleolus↗
PubMed1989

Protein-induced conformational changes in 16 S ribosomal RNA during the initial assembly steps of the Escherichia coli 30 S ribosomal subunit.

The mechanism of 16 S ribosomal RNA folding into its compact form in the native 30 S ribosomal subunit of Escherichia coli was studied by scanning transmission electron microscopy and circular dichroism spectroscopy. This approach made it possible to visualize and quantitatively analyze the conformational changes induced in 16 S rRNA under various ionic conditions and to characterize the interactions of ribosomal proteins S4, S8, S15, S20, S17 and S7, the six proteins known to bind to 16 S rRNA in the initial assembly steps. 16 S rRNA and the reconstituted RNA-protein core particles were characterized by their mass, morphology, radii of gyration (RG), and the extent and stability of 16 S rRNA secondary structure. The stepwise binding of S4, S8 and S15 led to a corresponding increase of mass and was accompanied by increased folding of 16 S rRNA in the core particles, as evident from the electron micrographs and from the decrease of RG values from 114 A and 91 A. Although the binding of S20, S17 and S7 continued the trend of mass increase, the RG values of these core particles showed a variable trend. While there was a slight increase in the RG value of the S20 core particles to 94 A, the RG value remained unchanged (94 A) with the further addition of S17. With subsequent addition of S7 to the core particles, the RG values showed an increase to 108 A. Association with S7 led to the formation of a globular mass cluster with a diameter of about 115 A and a mass of about 300 kDa. The rest of the mass (about 330 kDa) remained loosely coiled, giving the core particle a "medusa-like" appearance. Morphology of the 16 S rRNA and 16 S rRNA-protein core particles, even those with all six proteins, does not resemble the native 30 S subunit, contrary to what has been reported by others. The circular dichroism spectra of the 16 S rRNA-protein complexes and of free 16 S rRNA indicate a similarity of RNA secondary structure in the core particles with the first four proteins, S4, S8, S15, S20. The circular dichroism melting profiles of these core particles show only insignificant variations, implying no obvious changes in the distribution or the stability of the helical segments of 16 S rRNA. However, subsequent binding of proteins S17 and S7 affected both the extent and the thermal stability of 16 S rRNA secondary structure.(ABSTRACT TRUNCATED AT 400 WORDS)

Buffers↗
PubMed2002

Orientation of ribosome recycling factor in the ribosome from directed hydroxyl radical probing.

Ribosome recycling factor (RRF) disassembles posttermination complexes in conjunction with elongation factor EF-G, liberating ribosomes for further rounds of translation. The striking resemblance of its L-shaped structure to that of tRNA has suggested that the mode of action of RRF may be based on mimicry of tRNA. Directed hydroxyl radical probing of 16S and 23S rRNA from Fe(II) tethered to ten positions on the surface of E. coli RRF constrains it to a well-defined location in the subunit interface cavity. Surprisingly, the orientation of RRF in the ribosome differs markedly from any of those previously observed for tRNA, suggesting that structural mimicry does not necessarily reflect functional mimicry.

Escherichia coli↗
PubMed1989

Effect of point mutations in the decoding site (C1400) region of 16S ribosomal RNA on the ability of ribosomes to carry out individual steps of protein synthesis.

In order to probe the relationship between structure and function of the ribosome, an in vitro system [Denman et al. (1988) Biochemistry (preceding paper in this issue)] was used to make a series of base changes around C1400, a residue known to be at the decoding site. Replacement of C1400 by U, A, or G, deletion of single bases at and to either side of C1400, and insertion of C or U next to C1400 were done. In a separate study, a mutant with seven extra nucleotides at the 3' end was constructed. The activity of these 11 mutants in A and P site binding and in initiation-dependent and initiation-independent peptide synthesis was analyzed. None of the base substitutions of C1400 were markedly inhibitory despite the almost complete conservation of this residue in ribosomal RNAs from a wide range of species. The insertions and deletions completely blocked initiation-dependent peptide synthesis but markedly stimulated the initiation-independent reaction. The effects on tRNA binding were variable. The extra stem and loop at the 3' end blocked initiation-dependent peptide synthesis but did not influence the other assays. The only modification to block all ribosomal function was the deletion of G1401. It appears that while the conserved and cross-linkable C1400 is not essential for function, the adjacent conserved G1401 is.

Chromosome Deletion↗
PubMed1987

Effects of ribosome dissociation on the structure of the ribosome-associated 5.8S RNA.

Diethyl pyrocarbonate reactivity and thermal denaturation were used to probe potential ribosomal interactions between tRNA and the small 5.8S and 5S rRNAs. Puromycin, an analogue of the terminal aminoacyl-adenosine portion of aminoacyl-tRNA, was observed to increase the accessibility of the 5.8S rRNA, including the highly conserved GAACp sequences. EDTA which releases both tRNA and the 5S rRNA-protein complex resulted in an even greater accessibility in the 5.8S rRNA. The thermal dissociation of whole ribosomes resulted in the release of all three RNAs, with a striking similarity in the denaturation profiles. These results strongly suggest an interdependence in the ribosome-associated structures of the small rRNAs and provide in situ evidence for the various 5S rRNA, 5.8S rRNA, and tRNA containing ribonucleoprotein complexes previously reconstituted through affinity chromatography.

Base Sequence↗
PubMed1995

The acidic ribosomal proteins of different yeast species. Phosphorylation by ribosome-associated protein kinases.

Two major ribosomal proteins of Mr 13 kDa and 38 kDa were identified as phosphorylation substrates for ribosome-bound protein kinases from different yeast species. The phosphorylation level was much higher in ribosomes from the cells collected at the exponential growth phase, than in those from the stationary phase. Isoelectrofocusing of the protein band of 13 kDa and subsequent silver staining allowed to identify from four in the case of Pichia stipitis up to ten in Saccharomyces cerevisiae. Saccharomycodes Ludwigii, Torulopsis utilis and Kloeckera apiculata individual peptides. In the most of the yeast species studies five phosphorylated peptides were observed. However, only one or two such phosphopeptides were detected in Pichia stipitis and Trichosporon cutaneum ribosomes, respectively. The same phosphoprotein forms were identified in the in vivo 32P-labelling experiments.

Fungal Proteins↗
PubMed1991

The organization and expression of the Saccharomyces cerevisiae L4 ribosomal protein genes and their identification as the homologues of the mammalian ribosomal protein gene L7a.

A cDNA for the mouse ribosomal protein (rp) L7a, formerly called Surf-3, was used as a probe to isolate two homologous genes from Saccharomyces cerevisiae. The two yeast genes (L4-1 and L4-2) were identified as encoding S. cerevisiae L4 by 2D gel analysis of the product of the in vitro translation of hybrid-selected mRNA and additionally by direct amino acid sequencing. The DNA sequences of the two yeast genes were highly homologous (95%) over the 771 bp that encode the 256 amino acids of the coding regions but showed little homology outside the coding region. L4-1 differed from L4-2 by 7 out of the 256 amino acids in the coding region, which is the greatest divergence between the products of any two duplicated yeast ribosomal protein genes so far reported. There is strong homology between the mouse rpL7a/Surf-3 and the yeast L4 genes -57% at the nucleic acid level and also 57% at the amino acid level (though some regions reach as much as 80-90% homology). While most yeast ribosomal protein genes contain an intron in their 5' region both L4-1 and L4-2 are intronless. The mRNAs derived from each yeast gene contained heterogenous 5' and 3' ends but in each case the untranslated leaders were short. The L4-1 mRNA was found to be much more abundant than the L4-2 mRNA as assessed by cDNA and transcription analyses. Yeast cells containing a disruption of the L4-1 gene formed much smaller colonies than either wild-type or disrupted L4-2 strains. Disruption of both L4 genes is a lethal event, probably due to an inability to produce functional ribosomes.

Amino Acid Sequence↗
PubMed1974

The extraction of proteins from eukaryotic ribosomes and ribosomal subunits.

Proteins were extracted from rat liver ribosomes and ribosomal subunits: with 67% acetic acid (in the presence of 3.3 mM, 33 mM, or 67 mM Mg) with 2 M LiCL in 4 M urea; with 0.25 N HCI; with 1% SDS; and after RNase digestion. The most efficient extraction and the best recovery were either with acetic acid in the presence of 33 mM or 67 mM Mg, or with LiCI-urea. Protein extracted with acetic acid, LiCi-urea, or with HCI had little or no contamination with RNA. The ribosomal proteins were analyzed by two-dimensional polyacrylamide gel electrophoresis: the proteins extracted with acetic acid were the most soluble in the sample gel solution; their electrophoretograms displayed the maximum number of spots and the smallest number of derivatives or altered proteins. Preparations of protein extracted with SDS or RNase were relatively insoluble in the sample gel solution, and proteins extracted with HCI showed a large number of derivatives. All things considered, the most satisfactory method for the extraction of protein from eukaryotic ribosomes is with 67% acetic acid in the presence of 33 mM MgCl2.

Animals↗
PubMed1976

Genetic studies of the ribosomal proteins in Escherichia coli. X. Mapping of the ribosomal proteins, L21 and S15, by intergeneric mating experiments between Serratia marcescens and Escherichia coli K12.

Episomes of E. coli, which cover argG but not the str region, were transferred to Serratia marcescens. Ribosomal proteins from these hybrid strains were analyzed with phospho-cellulose or carboxy-methyl-cellulose column chromatography. Two E. coli ribosomal proteins, L21 and S15, could be detected in the ribosome from the hybrid strains in addition to the ribosomal proteins of S. marcescens.

Bacterial Proteins↗
PubMed1976

Genetic studies of the ribosomal proteins in Escherichia coli. IX. Mapping of the ribosomal proteins, S2 and S20, by intergeneric mating experiments between Serratia marcescens and Escherichia coli K12.

Episomes of E. coli K12, which cover thrleu region of the chromosome, were transferred to Serratia marcescens. Ribosomal proteins from these hybrid strains were analyzed with phosphocellulose column chromatography. Two E. coli 30S ribosomal proteins, S2 and S20, could be detected in the ribosome of the hybrid strain in addition to all ribosomal proteins of S. marcescens.

Chromatography, Ion Exchange↗
PubMed1986

Archaebacterial and eukaryotic ribosomal subunits can form active hybrid ribosomes.

Purified ribosomal subunits from the extremely thermoacidophilic archaebacterium Sulfolobus solfataricus are able to recognize ribosomal subunits from the yeast Saccharomyces cerevisiae forming hybrid monosomes that can be revealed by sucrose gradient analysis and are active in peptide bond formation. Both reciprocal combinations (archaebacterial 30 S + eukaryotic 60 S and archaebacterial 50 S + eukaryotic 40 S) are functional. In contrast, no hybrid couples are formed between subunits of yeast and Escherichia coli ribosomes. These results indicate that ribosomes of at least one archaebacterial species share specific structural features with those of the lower eukaryote S. cerevisiae.

Archaea↗
PubMed1983

Protection of ribosomal RNA from kethoxal in polyribosomes. Implication of specific sites in ribosome function.

In an attempt to probe the topography of 5 S, 16 S and 23 S RNAs in a functionally engaged ribosome, polysomes were probed using the structure-sensitive, guanine-specific reagent kethoxal. Reactivities of guanine residues at 38 specific ribosomal RNA sites in polysomes were compared with their corresponding reactivities in vacant 70 S ribosomes. No polysome-specific protection was seen for 5 S RNA. In 16 S RNA, positions 530, 693 or 1079, 966, 1338 and 1517 showed protection in polysomes; all of these sites have highly conserved primary and secondary structures, and include several methylated nucleotides. In 23 S RNA, polysome protection is seen at positions 277, 1071, 1475 or 2112, 2116 and 2751. We attribute polysome-specific protection either to direct contact of transfer RNA and/or messenger RNA with the protected sites or to tRNA and/or mRNA-induced changes in ribosome conformation involving the protected sites.

Aldehydes↗